A Comparative Proteomic Analysis of the Buds and the Young Expanding Leaves of the Tea Plant (Camellia sinensis L.)
Abstract
:1. Introduction
2. Results
2.1. Analysis of Metabolite Profiles
2.2. Protein Identification
2.3. Functional Classification of the Differentially Expressed Proteins
Accession Number | Proteins Name and Species | Score | Mass (Da) | Coverage | Peptide Count | Fold Change (Leaves/Bud) | Function |
---|---|---|---|---|---|---|---|
gi|350536667| | Dihydrolipoamide dehydrogenase precursor [Solanum lycopersicum] | 202 | 68,166 | 13.9 | 5 | 2.164 | Metabolism |
gi|15081610| | Xyloglucan endotransglycosylase XET2 [Vitis vinifera] | 137 | 39,952 | 12.4 | 3 | 1.614 | Metabolism |
gi|76786311| | Flavonol synthase [Camellia sinensis] | 288 | 45,768 | 27.9 | 6 | 1.788 | Metabolism |
gi|225458243| | PREDICTED: isoflavone reductase homolog P3 [Vitis vinifera] | 315 | 37,529 | 31.6 | 7 | 2.649 | Metabolism |
gi|359491464| | PREDICTED: lysosomal α-mannosidase [Vitis vinifera] | 111 | 38,176 | 12.7 | 3 | 1.825 | Metabolism |
gi|71535021| | α-glucosidase [Medicago sativa] | 204 | 86,320 | 6 | 4 | 2.353 | Metabolism |
gi|255578100| | Dihydrolipoamide succinyltransferase component of 2-oxoglutarate dehydrogenase, putative [Ricinus communis] | 57 | 38,166 | 6.9 | 2 | 1.878 | Metabolism |
gi|225426623| | PREDICTED: 2-keto-3-deoxy-l-rhamnonate aldolase-like [Vitis vinifera] | 78 | 21,742 | 10.2 | 1 | 2.281 | Metabolism |
gi|193290728| | Putative pyruvate dehydrogenase E3 subunit [Capsicum annuum] | 74 | 42,069 | 8.3 | 2 | 1.567 | Metabolism |
gi|255566959| | NADH-cytochrome B5 reductase, putative [Ricinus communis] | 32 | 11,336 | 11.4 | 1 | 1.58 | Metabolism |
sp|Q9SVG4| | Reticuline oxidase-like protein [Spinacia oleracea] | 108 | 30,376 | 6.9 | 1 | 1.729 | Metabolism |
sp|Q9M069| | Glucan endo-1,3-β-glucosidase 7 [Arabidopsis thaliana] | 139 | 40,171 | 16.2 | 3 | 1.568 | Metabolism |
gi|147767550| | Hypothetical protein VITISV_013343 [Vitis vinifera] | 159 | 20,700 | 22.4 | 2 | 1.542 | Metabolism |
gi|193290702| | Putative 3-isopropylmalate dehydrogenase small subunit [Capsicum annuum] | 354 | 25,595 | 36.2 | 4 | 1.681 | Metabolism |
gi|225451235| | PREDICTED: cysteine synthase isoform 2 [Vitis vinifera] | 321 | 47,206 | 14.9 | 4 | 2.216 | Metabolism |
gi|225454278| | PREDICTED: cysteine synthase, chloroplastic/chromoplastic isoform 1 [Vitis vinifera] | 60 | 40,113 | 10.5 | 2 | 1.905 | Metabolism |
sp|P50246| | Adenosylhomocysteinase [Medicago sativa] | 186 | 65,326 | 11.9 | 5 | 1.551 | Metabolism |
sp|P47999| | Cysteine synthase, chloroplastic/chromoplastic [Arabidopsis thaliana] | 111 | 51,056 | 14.5 | 4 | 1.856 | Metabolism |
sp|P94170| | Carbonic anhydrase [Nostoc sp.] | 191 | 12,938 | 27.6 | 2 | 2.527 | Metabolism |
sp|Q42876| | Leucine aminopeptidase 2, chloroplastic [Solanum lycopersicum] | 124 | 74,254 | 3.9 | 2 | 1.852 | Metabolism |
gi|75755999| | TO87b-13 [Taraxacum officinale] | 260 | 83,317 | 6 | 3 | 2.18 | Metabolism |
gi|330318698| | Light-inducible protein atls1 [Camellia sinensis] | 115 | 18,370 | 8.8 | 1 | 2.68 | Metabolism |
gi|224098154| | predicted protein [Populus trichocarpa] | 145 | 29,956 | 28.8 | 5 | 1.504 | Metabolism |
gi|225433426| | PREDICTED: 3-ketoacyl-CoA thiolase 2, peroxisomal isoform 2 [Vitis vinifera] | 197 | 7506 | 51.9 | 2 | 1.568 | Metabolism |
gi|225462452| | PREDICTED: GDSL esterase/lipase At5g45670 [Vitis vinifera] | 250 | 22,819 | 30.5 | 4 | 1.79 | Metabolism |
sp|Q93YW8| | GDSL esterase/lipase At4g18970 [Arabidopsis thaliana] | 250 | 22,819 | 30.5 | 4 | 1.79 | Metabolism |
sp|Q9SYF0| | GDSL esterase/lipase 2 [Arabidopsis thaliana] | 316 | 46,565 | 14.2 | 5 | 2.203 | Metabolism |
sp|Q9LZS7| | GDSL esterase/lipase At5g03610 [Arabidopsis thaliana] | 80 | 45,316 | 11.8 | 3 | 3.399 | Metabolism |
gi|296088201| | Unnamed protein product [Vitis vinifera] | 73 | 30,392 | 9.5 | 2 | 1.55 | Metabolism |
gi|18140567| | Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit [Camellia japonica] | 518 | 52,867 | 15.8 | 6 | 0.357 | Metabolism |
gi|156106226| | Rubisco activase [Camellia sinensis] | 646 | 43,205 | 31.4 | 7 | 0.564 | Metabolism |
gi|20257362| | Ribulose 1,5-bisphosphate carboxylase/oxygenase, partial (chloroplast) [Schima superba] | 303 | 24,090 | 10.3 | 2 | 0.465 | Metabolism |
gi|255553993| | Phosphoenolpyruvate carboxylase, putative [Ricinus communis] | 108 | 32,666 | 14.7 | 3 | 0.469 | Metabolism |
gi|169807676| | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase [Platanus x acerifolia] | 322 | 69,081 | 17 | 6 | 0.543 | Metabolism |
gi|356524319| | PREDICTED: probable glycerophosphoryl diester phosphodiesterase 1-like [Glycine max] | 212 | 56,841 | 8.8 | 3 | 0.552 | Metabolism |
gi|2266947| | Phosphoenolpyruvate carboxylase 1 [Gossypium hirsutum] | 173 | 94,629 | 7.7 | 5 | 0.477 | Metabolism |
gi|255581778| | chlorophyll A/B binding protein, putative [Ricinus communis] | 96 | 41,261 | 3.8 | 1 | 0.664 | Metabolism |
sp|P81833| | Thylakoid lumenal 29 kDa protein, chloroplastic (Fragment) [Spinacia oleracea] | 176 | 43,057 | 22.2 | 4 | 0.651 | Metabolism |
sp|Q8H1Q1| | Thylakoid lumenal protein At1g12250, chloroplastic [Spinacia oleracea] | 254 | 35,331 | 21.5 | 4 | 0.655 | Metabolism |
sp|O04138| | Chitinase 4 [Oryza sativa subsp. Japonica] | 223 | 30,457 | 19.4 | 3 | 0.466 | Metabolism |
sp|Q9FKK7| | Xylose isomerase [Spinacia oleracea] | 172 | 63,511 | 13 | 4 | 0.575 | Metabolism |
gi|27804768| | Sedoheptulose-1,7-bisphosphatase precursor [Oryza sativa Indica Group] | 268 | 54,158 | 8.7 | 3 | 0.58 | Metabolism |
gi|380508822| | Putative hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyltransferase [Camellia sinensis] | 48 | 7531 | 32.7 | 2 | 0.493 | Metabolism |
gi|330318804| | Photosystem I reaction center subunit XI [Camellia sinensis] | 132 | 27,128 | 20.5 | 3 | 0.63 | Metabolism |
gi|357521691| | Atypical receptor-like kinase MARK [Medicago truncatula] | 94 | 45,630 | 9.6 | 3 | 0.562 | Metabolism |
gi|357494517| | Calcium dependent protein kinase [Medicago truncatula] | 118 | 14,910 | 21.8 | 2 | 0.422 | Metabolism |
gi|297744280| | Unnamed protein product [Vitis vinifera] | 82 | 49,263 | 13.9 | 3 | 0.47 | Metabolism |
sp|Q56YA5| | Serine--glyoxylate aminotransferase [Spinacia oleracea] | 124 | 32,097 | 7 | 1 | 0.251 | Metabolism |
sp|P45726| | Phenylalanine ammonia-lyase [Camellia sinensis] | 463 | 90,257 | 19.2 | 11 | 0.63 | Metabolism |
gi|71480741| | β-1,3-glucanase [Camellia sinensis] | 126 | 60,244 | 2.4 | 1 | 0.565 | Metabolism |
sp|P46637| | Arginase [Spinacia oleracea] | 470 | 39,198 | 21 | 6 | 0.47 | Metabolism |
sp|Q6AUR2| | Nitrogen regulatory protein P-II homolog [Oryza sativa subsp. Japonica] | 101 | 28,420 | 12.8 | 3 | 0.648 | Metabolism |
gi|302566881| | Lipoxygenase [Camellia sinensis] | 72 | 59,000 | 10.2 | 3 | 0.54 | Metabolism |
gi|194466253| | N-acetyltransferase [Arachis hypogaea] | 103 | 29,065 | 12 | 2 | 0.605 | Metabolism |
sp|Q9LZ72| | 3-ketoacyl-CoA synthase 21 [Spinacia oleracea] | 120 | 62,270 | 7.7 | 3 | 0.532 | Metabolism |
sp|Q570B4| | 3-ketoacyl-CoA synthase 10 [Spinacia oleracea] | 53 | 38,242 | 3.8 | 1 | 0.455 | Metabolism |
sp|Q9FJ41| | GDSL esterase/lipase At5g45950 [Spinacia oleracea] | 138 | 50,893 | 9.3 | 2 | 0.619 | Metabolism |
sp|Q9LEB4| | Polyadenylate-binding protein RBP45 [Nicotiana plumbaginifolia] | 135 | 56,285 | 10.6 | 4 | 1.53 | Nucleic acid metabolism |
sp|Q43349| | 29 kDa ribonucleoprotein, chloroplastic [Spinacia oleracea] | 43 | 34,389 | 7.1 | 2 | 1.624 | Nucleic acid metabolism |
sp|P43333| | U2 small nuclear ribonucleoprotein A´ [Spinacia oleracea] | 135 | 40,620 | 14.3 | 3 | 1.574 | Nucleic acid metabolism |
gi|307940738| | G-strand specific single-stranded telomere-binding protein 1 [Nicotiana tabacum] | 250 | 22,819 | 30.5 | 4 | 1.79 | Nucleic acid metabolism |
sp|Q84L31| | Putative DNA repair protein RAD23-3 [Spinacia oleracea] | 174 | 42,346 | 15.4 | 4 | 1.533 | Nucleic acid metabolism |
gi|255603771| | DNA binding protein, putative [Ricinus communis] | 250 | 22,819 | 30.5 | 4 | 1.79 | Nucleic acid metabolism |
gi|255603771| | DNA binding protein, putative [Ricinus communis] | 177 | 41,602 | 16.9 | 3 | 2.491 | Nucleic acid metabolism |
sp|Q9S7C9| | Putative DNA-binding protein ESCAROLA [Spinacia oleracea] | 250 | 38,185 | 17 | 4 | 1.664 | Nucleic acid metabolism |
gi|79596510| | AT hook motif DNA-binding family protein [Spinacia oleracea] | 137 | 29,457 | 21.1 | 4 | 2.576 | Nucleic acid metabolism |
sp|Q9S7C9| | Putative DNA-binding protein ESCAROLA [Spinacia oleracea] | 250 | 38,185 | 17 | 4 | 1.664 | Nucleic acid metabolism |
gi|45533923| | Glycine-rich RNA-binding protein RGP-1c [Nicotiana sylvestris] | 487 | 21,422 | 28.1 | 4 | 2.945 | Nucleic acid metabolism |
sp|Q9SVM8| | Glycine-rich RNA-binding protein 2, mitochondrial [Spinacia oleracea] | 410 | 20,091 | 17.1 | 2 | 1.506 | Nucleic acid metabolism |
gi|225440996| | PREDICTED: histone deacetylase HDT1-like [Vitis vinifera] | 99 | 37,638 | 12.2 | 3 | 3.522 | Nucleic acid metabolism |
sp|Q9XI36| | Methyl-CpG-binding domain-containing protein 10 [Spinacia oleracea] | 285 | 42,453 | 37.6 | 7 | 1.364 | Nucleic acid metabolism |
gi|225457458| | PREDICTED: transcription factor BTF3 [Vitis vinifera] | 170 | 25,374 | 35.6 | 4 | 1.829 | Nucleic acid metabolism |
gi|297723091| | Os04g0385700 [Oryza sativa Japonica Group] | 56 | 34,525 | 4.3 | 1 | 2.34 | Nucleic acid metabolism |
gi|296081863| | Unnamed protein product [Vitis vinifera] | 177 | 38,697 | 15.7 | 3 | 2.094 | Nucleic acid metabolism |
gi|297744195| | Unnamed protein product [Vitis vinifera] | 155 | 29,045 | 22.4 | 3 | 2.146 | Nucleic acid metabolism |
gi|255642098| | Unknown [Glycine max] | 119 | 51,914 | 10.3 | 4 | 2.23 | Nucleic acid metabolism |
sp|Q9LFN6| | DEAD-box ATP-dependent RNA helicase 56 [Spinacia oleracea] | 220 | 54,506 | 18.6 | 5 | 0.649 | Nucleic acid metabolism |
sp|Q84UQ1| | DEAD-box ATP-dependent RNA helicase 42 [Oryza sativa subsp. Japonica] | 98 | 120,162 | 2.2 | 2 | 0.325 | Nucleic acid metabolism |
sp|B6EUA9| | Pre-mRNA-processing protein 40A [Spinacia oleracea] | 242 | 83,063 | 9.7 | 5 | 0.233 | Nucleic acid metabolism |
sp|O22315| | Pre-mRNA-splicing factor SF2 [Spinacia oleracea] | 126 | 7308 | 35.7 | 2 | 0.432 | Nucleic acid metabolism |
gi|374095609| | Spliceosomal-like protein [Camellia sinensis] | 23 | 4551 | 17.1 | 1 | 0.385 | Nucleic acid metabolism |
sp|Q9S709| | Splicing factor U2af small subunit A [Spinacia oleracea] | 71 | 29,349 | 7.9 | 1 | 0.637 | Nucleic acid metabolism |
sp|P81766| | Nucleoside diphosphate kinase 3 [Spinacia oleracea] | 61 | 31,625 | 7.5 | 2 | 0.508 | Nucleic acid metabolism |
gi|224117596| | Predicted protein [Populus trichocarpa] | 368 | 54,505 | 13.4 | 5 | 0.398 | Nucleic acid metabolism |
gi|225462994| | PREDICTED: DNA replication licensing factor mcm5-A-like [Vitis vinifera] | 259 | 94,881 | 13.6 | 8 | 0.582 | Nucleic acid metabolism |
sp|O04716| | DNA mismatch repair protein MSH6 [Spinacia oleracea] | 159 | 50,441 | 4.6 | 1 | 0.276 | Nucleic acid metabolism |
gi|359386142| | RNA recognition motif protein 1 [Citrus sinensis] | 155 | 14,712 | 42.7 | 3 | 0.492 | Nucleic acid metabolism |
gi|195626496| | Glycine-rich RNA-binding protein 2 [Zea mays] | 318 | 21,175 | 33.1 | 4 | 0.435 | Nucleic acid metabolism |
sp|Q9FLH0| | PUTATIVE nuclear matrix constituent protein 1-like protein [Spinacia oleracea] | 69 | 78,347 | 5.6 | 2 | 0.66 | Nucleic acid metabolism |
gi|385213056| | 20S proteasome β2 subunit, partial [Oryza brachyantha] | 163 | 40,674 | 14.1 | 4 | 2.297 | Protein metabolism |
gi|49175785| | 26S proteasome β subunit [Pisum sativum] | 187 | 35,781 | 16 | 4 | 1.632 | Protein metabolism |
gi|16225442| | 26S proteasome regulatory subunit S12 isolog-like protein [Castanea sativa] | 144 | 38,542 | 10.6 | 3 | 2.263 | Protein metabolism |
gi|225431100| | PREDICTED: 26S proteasome non-ATPase regulatory subunit 4 [Vitis vinifera] | 73 | 8946 | 16.9 | 1 | 1.553 | Protein metabolism |
gi|24473796| | 60s acidic ribosomal protein [Prunus dulcis] | 208 | 14,983 | 15.8 | 2 | 2.924 | Protein metabolism |
gi|330318716| | 60S acidic ribosomal protein p2 [Camellia sinensis] | 156 | 15,062 | 16.2 | 2 | 4.223 | Protein metabolism |
sp|Q8LEQ0| | 60S acidic ribosomal protein P1-3 [Spinacia oleracea] | 185 | 19,758 | 10.1 | 1 | 1.928 | Protein metabolism |
sp|Q9SVZ6| | 60S acidic ribosomal protein P3-1 [Spinacia oleracea] | 666 | 15,391 | 13.7 | 1 | 1.866 | Protein metabolism |
gi|255574159| | Proteasome subunit β type 6,9, putative [Ricinus communis] | 368 | 31,544 | 22.1 | 5 | 1.644 | Protein metabolism |
gi|255564428| | Elongation factor 1-β, putative [Ricinus communis] | 62 | 33,531 | 5.7 | 1 | 1.899 | Protein metabolism |
gi|255539639| | Cucumisin precursor, putative [Ricinus communis] | 86 | 56,932 | 2.8 | 1 | 1.535 | Protein metabolism |
gi|14594919| | Putative α5 proteasome subunit [Nicotiana tabacum] | 170 | 30,889 | 13.3 | 3 | 2.021 | Protein metabolism |
gi|356549495| | PREDICTED: heat shock 70 kDa protein, mitochondrial-like [Glycine max] | 62 | 12,864 | 10.9 | 1 | 1.605 | Protein metabolism |
gi|272716096| | Disulfide isomerase-like protein [Gloeospermum blakeanum] | 87 | 43,279 | 12.1 | 2 | 1.781 | Protein metabolism |
gi|272716065| | Disulfide isomerase [Gloeospermum blakeanum] | 250 | 22,819 | 30.5 | 4 | 1.79 | Protein metabolism |
sp|Q8VX13| | Protein disulfide isomerase-like 1-3 [Spinacia oleracea] | 165 | 80,245 | 10.1 | 5 | 1.625 | Protein metabolism |
sp|O65351| | SUBTILISIN-like protease [Spinacia oleracea] | 128 | 32,198 | 16.7 | 3 | 1.556 | Protein metabolism |
gi|359473000| | PREDICTED: aspartic proteinase nepenthesin-1-like [Vitis vinifera] | 250 | 22,819 | 30.5 | 4 | 1.79 | Protein metabolism |
sp|P81898| | Peptide-N4-( N-acetyl-β-glucosaminyl)asparagine amidase A [Prunus dulcis] | 49 | 28,569 | 5.3 | 1 | 1.823 | Protein metabolism |
gi|7141245| | 26S proteasome regulatory ATPase subunit S10b [Vitis riparia] | 164 | 54,246 | 13.8 | 4 | 0.539 | Protein metabolism |
gi|56481167| | 40S ribosomal protein S3a [Pseudotsuga menziesii var. menziesii] | 119 | 40,753 | 17.6 | 3 | 0.437 | Protein metabolism |
sp|Q9SCM3| | 40S ribosomal protein S2-4 [Spinacia oleracea] | 253 | 38,711 | 12.9 | 3 | 0.548 | Protein metabolism |
gi|241865275| | 40S RPS3B [Sonneratia alba] | 150 | 30,886 | 27.4 | 5 | 0.536 | Protein metabolism |
gi|255569736| | 40S ribosomal protein S6, putative [Ricinus communis] | 88 | 41,992 | 8.8 | 2 | 0.574 | Protein metabolism |
gi|330318726| | 40S ribosomal protein s9 [Camellia sinensis] | 126 | 28,301 | 14 | 3 | 0.513 | Protein metabolism |
gi|357444481| | 40S ribosomal protein S18 [Medicago truncatula] | 223 | 25,387 | 24.2 | 3 | 0.414 | Protein metabolism |
gi|255544840| | 40S ribosomal protein S2, putative [Ricinus communis] | 202 | 35,538 | 13.4 | 3 | 0.64 | Protein metabolism |
gi|255549228| | 40S ribosomal protein S4, putative [Ricinus communis] | 277 | 39,687 | 25.6 | 6 | 0.415 | Protein metabolism |
gi|241865275| | 40S RPS3B [Sonneratia alba] | 209 | 31,709 | 27.4 | 5 | 0.538 | Protein metabolism |
sp|Q9ZNS1| | 40S ribosomal protein S7 [Avicennia marina] | 58 | 32,180 | 12.8 | 3 | 0.61 | Protein metabolism |
sp|O80360| | 50S ribosomal protein L3, chloroplastic (Fragment) [Nicotiana tabacum] | 179 | 36,343 | 19.5 | 4 | 0.591 | Protein metabolism |
gi|255551787| | 60S ribosomal protein L22, putative [Ricinus communis] | 119 | 22,528 | 22.1 | 3 | 0.615 | Protein metabolism |
gi|148466442| | 60S ribosomal protein L21 [Paeonia suffruticosa] | 56 | 26,661 | 9.8 | 2 | 0.467 | Protein metabolism |
sp|P51413| | 60S ribosomal protein L17-2 [Spinacia oleracea] | 48 | 28,359 | 5.1 | 1 | 0.525 | Protein metabolism |
sp|Q6UNT2| | 60S ribosomal protein L5 [Cucumis sativus] | 90 | 44,735 | 6.7 | 2 | 0.661 | Protein metabolism |
sp|Q9SPB3| | 60S ribosomal protein L10 [Vitis riparia] | 189 | 33,718 | 12.9 | 3 | 0.532 | Protein metabolism |
sp|P30707| | 60S ribosomal protein L9 [Pisum sativum] | 184 | 33,248 | 26.4 | 4 | 0.641 | Protein metabolism |
gi|225427377| | PREDICTED: 60S ribosomal protein L37a-like [Vitis vinifera] | 93 | 15,986 | 16.3 | 1 | 0.64 | Protein metabolism |
gi|330318574| | Ribosomal petrp-like protein [Camellia sinensis] | 48 | 28,359 | 5.1 | 1 | 0.525 | Protein metabolism |
gi|3885519| | Similar to ribosomal protein L32 [Medicago sativa] | 86 | 23,581 | 13.9 | 2 | 0.363 | Protein metabolism |
gi|209922600| | Elongation factor 1-α [Prunus persica] | 351 | 80,605 | 24.2 | 11 | 0.624 | Protein metabolism |
gi|225452282| | PREDICTED: elongation factor Tu, chloroplastic-like isoform 1 [Vitis vinifera] | 313 | 57,834 | 26.6 | 8 | 0.593 | Protein metabolism |
gi|356524672| | PREDICTED: eukaryotic translation initiation factor 3 subunit C-like [Glycine max] | 58 | 6862 | 27.3 | 1 | 0.545 | Protein metabolism |
gi|71534902| | Histidyl-tRNA synthetase [Medicago sativa] | 71 | 41,277 | 10.8 | 2 | 0.603 | Protein metabolism |
sp|P31542| | ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplastic [Solanum lycopersicum] | 497 | 55,091 | 24.1 | 8 | 0.562 | Protein metabolism |
gi|356516495| | PREDICTED: chaperone protein ClpC, chloroplastic-like [Glycine max] | 497 | 55,091 | 24.1 | 8 | 0.562 | Protein metabolism |
gi|52075839| | Putative chloroplast protease [Oryza sativa Japonica Group] | 340 | 85,534 | 15.4 | 8 | 0.523 | Protein metabolism |
sp|Q8VY06| | Presequence protease 2, chloroplastic/mitochondrial [Spinacia oleracea] | 85 | 35,368 | 13.8 | 3 | 0.622 | Protein metabolism |
sp|Q75GT3| | Chaperone protein ClpB2, chloroplastic [Oryza sativa subsp. Japonica] | 385 | 130,278 | 16.2 | 11 | 0.504 | Protein metabolism |
gi|225431090| | PREDICTED: proteasome subunit α type-7 [Vitis vinifera] | 292 | 35,407 | 21.6 | 4 | 0.646 | Protein metabolism |
gi|225457058| | PREDICTED: T-complex protein 1 subunit gamma [Vitis vinifera] | 354 | 76,271 | 13.4 | 6 | 0.552 | Protein metabolism |
gi|225459806| | PREDICTED: T-complex protein 1 subunit β [Vitis vinifera] | 975 | 60,327 | 38.8 | 11 | 0.482 | Protein metabolism |
gi|255567297| | chaperonin containing t-complex protein 1, α subunit, tcpa, putative [Ricinus communis] | 84 | 28,459 | 18.8 | 3 | 0.622 | Protein metabolism |
sp|P32955| | Cysteine proteinase 2 (Fragment) [Carica candamarcensis] | 385 | 130,278 | 16.2 | 11 | 0.504 | Protein metabolism |
sp|P35016| | Endoplasmin homolog [Catharanthus roseus] | 416 | 123,589 | 18.5 | 13 | 0.657 | Protein metabolism |
sp|P38661| | Probable protein disulfide-isomerase A6 [Medicago sativa] | 213 | 54,232 | 24.9 | 8 | 0.665 | Protein metabolism |
sp|Q5Z974| | ATP-dependent zinc metalloprotease FTSH 1, chloroplastic [Oryza sativa subsp. Japonica] | 281 | 42,007 | 19.7 | 4 | 0.427 | Protein metabolism |
gi|147766666| | Hypothetical protein VITISV_035841 [Vitis vinifera] | 177 | 44,924 | 17.6 | 4 | 0.557 | Protein metabolism |
gi|224141163| | Predicted protein [Populus trichocarpa] | 60 | 36,379 | 10.7 | 2 | 0.56 | Protein metabolism |
gi|59797458| | Superoxide dismutase [Lilium hybrid cultivar] | 223 | 21,087 | 29.1 | 3 | 1.849 | Stress/defense/detoxification |
sp|Q93VQ9| | Thioredoxin O2, mitochondrial [Spinacia oleracea] | 80 | 25,925 | 12 | 2 | 1.907 | Stress/defense/detoxification |
gi|536838| | NADPH thioredoxin reductase, partial [Helianthus annuus] | 207 | 45,192 | 17.4 | 4 | 1.778 | Stress/defense/detoxification |
sp|Q9LS40| | protein aspartic protease in guard cell 1 [Rabidopsis thaliana] | 193 | 48,663 | 17.6 | 5 | 1.635 | Stress/defense/detoxification |
sp|Q96520| | Peroxidase 12 [Spinacia oleracea] | 132 | 41,132 | 15.2 | 3 | 1.899 | Stress/defense/detoxification |
gi|3201547| | Endochitinase [Persea americana] | 79 | 18,633 | 4.3 | 1 | 1.971 | Stress/defense/detoxification |
sp|Q06015| | Endochitinase 3 (Fragment) [Arachis hypogaea] | 167 | 39,946 | 13.3 | 3 | 1.691 | Stress/defense/detoxification |
gi|215398978| | Dehydrin [Camellia sinensis] | 44 | 20,578 | 11 | 2 | 5.811 | Stress/defense/detoxification |
gi|15637350| | Glutaredoxin [Tilia platyphyllos] | 150 | 18,171 | 10.9 | 1 | 1.74 | Stress/defense/detoxification |
sp|P13240| | Disease resistance response protein 206 [Pisum sativum] | 167 | 39,946 | 13.3 | 3 | 1.691 | Stress/defense/detoxification |
sp|O80934| | Uncharacterized protein At2g37660, chloroplastic [rabidopsis thaliana] | 161 | 35,389 | 21.8 | 4 | 1.963 | Stress/defense/detoxification |
gi|75138338| | Peroxiredoxin Q, chloroplastic [Gentiana triflora] | 95 | 27,886 | 11.1 | 3 | 0.595 | Stress/defense/detoxification |
sp|O23044| | Peroxidase 3 [Spinacia oleracea] | 241 | 36,174 | 19.8 | 5 | 0.584 | Stress/defense/detoxification |
sp|A7NY33| | Peroxidase 4 [Vitis vinifera] | 119 | 33,610 | 21.9 | 4 | 0.599 | Stress/defense/detoxification |
sp|P22242| | Desiccation-related protein PCC13-62 [Craterostigma plantagineum] | 695 | 21,349 | 33.3 | 4 | 0.615 | Stress/defense/detoxification |
gi|270064305| | Abscisic stress ripening [Musa ABB Group] | 243 | 26,152 | 15.3 | 2 | 0.265 | Stress/defense/detoxification |
sp|Q41328| | Pto-interacting protein 1 [Solanum lycopersicum] | 52 | 42,570 | 13.3 | 3 | 0.63 | Stress/defense/detoxification |
sp|Q9FM19| | Hypersensitive-induced response protein 1 [Spinacia oleracea] | 124 | 37,917 | 9.1 | 2 | 0.517 | Stress/defense/detoxification |
sp|P85524| | kirola [Actinidia deliciosa] | 136 | 24,392 | 19.3 | 3 | 0.599 | Stress/defense/detoxification |
gi|15637165| | Voltage-dependent anion channel [β vulgaris] | 340 | 39,615 | 13.9 | 4 | 2.321 | Transport |
gi|225439482| | PREDICTED: importin subunit β-1 [Vitis vinifera] | 65 | 90,956 | 3.9 | 2 | 2.014 | Transport |
gi| 526118004| | Probable E3 ubiquitin-protein ligase HERC1 [Vitis vinifera] | 106 | 55,419 | 8 | 2 | 1.845 | Transport |
gi|147859669| | Hypothetical protein VITISV_026572 [Vitis vinifera] | 105 | 32,300 | 9.1 | 2 | 1.988 | Transport |
gi|147842983| | Hypothetical protein VITISV_024360 [Vitis vinifera] | 41 | 29,785 | 4 | 1 | 3.304 | Transport |
sp|Q41009| | Translocase of chloroplast 34 [Pisum sativum] | 42 | 12,006 | 28.9 | 2 | 0.599 | Transport |
gi|87247471| | Putative glutathione S-transferase [Populus x canadensis] | 295 | 31,506 | 16.9 | 2 | 0.577 | Transport |
gi|8896066| | FtsZ1 [Tagetes erecta] | 71 | 30,227 | 11.2 | 2 | 2.163 | Biological regulation and signal transduction |
gi|71535005| | Zinc finger Glo3-like protein [Medicago sativa] | 151 | 53,757 | 9.9 | 3 | 1.887 | Biological regulation and signal transduction |
sp|P93508| | Calreticulin [Ricinus communis] | 250 | 22,819 | 30.5 | 4 | 1.79 | Biological regulation and signal transduction |
gi|255562771| | STS14 protein precursor, putative [Ricinus communis] | 165 | 20,709 | 22.1 | 3 | 4.166 | Biological regulation and signal transduction |
gi|40807639| | Cystatin [Actinidia eriantha] | 250 | 22,819 | 30.5 | 4 | 1.79 | Biological regulation and signal transduction |
gi|359497545| | PREDICTED: leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1-like [Vitis vinifera] | 250 | 22,819 | 30.5 | 4 | 1.79 | Biological regulation and signal transduction |
sp|Q8H100| | Probable ADP-ribosylation factor GTPase-activating protein AGD8 [Spinacia oleracea] | 382 | 58,424 | 15.4 | 5 | 2.137 | Biological regulation and signal transduction |
gi|359495838| | PREDICTED: uncharacterized protein LOC100264206 [Vitis vinifera] | 58 | 30,115 | 10.4 | 2 | 3.438 | Biological regulation and signal transduction |
sp|O23193| | CBS domain-containing protein CBSX1, chloroplastic [Spinacia oleracea] | 138 | 27,995 | 20.6 | 3 | 1.672 | Biological regulation and signal transduction |
sp|P93654| | Syntaxin-22 [Spinacia oleracea] | 35 | 30,780 | 8.7 | 2 | 0.522 | Biological regulation and signal transduction |
gi|350534900| | 14-3-3 protein 3 [Solanum lycopersicum] | 368 | 38,590 | 27.9 | 7 | 0.599 | Biological regulation and signal transduction |
gi|359492889| | PREDICTED: 14-3-3 protein [Vitis vinifera] | 244 | 40,230 | 20.7 | 6 | 0.525 | Biological regulation and signal transduction |
sp|Q9FM65| | Fasciclin-like arabinogalactan protein 1 [Spinacia oleracea] | 247 | 36,736 | 18.8 | 3 | 0.559 | Biological regulation and signal transduction |
gi|95116526| | Ethylene inducible protein hever [Theobroma cacao] | 131 | 37,972 | 15.2 | 4 | 0.619 | Biological regulation and signal transduction |
sp|A1Y2B7| | Protein suppressor of gene SILENCING 3 homolog [Zea mays] | 86 | 51,127 | 7.8 | 2 | 0.602 | Biological regulation and signal transduction |
gi|255587170| | Minichromosome maintenance protein, putative [Ricinus communis] | 63 | 16,167 | 7.5 | 1 | 0.547 | Biological regulation and signal transduction |
gi|255571471| | Systemin receptor SR160 precursor, putative [Ricinus communis] | 200 | 108,992 | 6.6 | 5 | 0.483 | Biological regulation and signal transduction |
gi|359494860| | PREDICTED: protein MOR1-like, partial [Vitis vinifera] | 102 | 17,742 | 8.8 | 1 | 0.603 | Biological regulation and signal transduction |
gi|359495954| | PREDICTED: syntaxin-51-like [Vitis vinifera] | 318 | 19,583 | 10.5 | 1 | 0.243 | Biological regulation and signal transduction |
sp|Q94KK7| | Syntaxin-52 [Spinacia oleracea] | 40 | 31,732 | 6.3 | 1 | 0.594 | Biological regulation and signal transduction |
gi|359493650| | PREDICTED: early nodulin-like protein 2-like [Vitis vinifera] | 214 | 26,770 | 23 | 4 | 0.538 | Biological regulation and signal transduction |
gi|225456479| | PREDICTED: signal recognition particle 68 kDa protein [Vitis vinifera] | 52 | 30,059 | 4.6 | 1 | 0.623 | Biological regulation and signal transduction |
sp|O22126| | Fasciclin-like arabinogalactan protein 8 [Spinacia oleracea] | 256 | 45,342 | 16.4 | 5 | 0.51 | Biological regulation and signal transduction |
gi|388491766| | Unknown [Lotus japonicus] | 171 | 15,992 | 18.3 | 1 | 0.538 | Biological regulation and signal transduction |
gi|255545216| | Conserved hypothetical protein [Ricinus communis] | 85 | 37,085 | 13 | 3 | 2.209 | Unknown biological processes |
gi|255547524| | Conserved hypothetical protein [Ricinus communis] | 50 | 41,524 | 3.3 | 1 | 2.09 | Unknown biological processes |
sp|Q6YYB0| | UNCHARACTERIZED protein Os08g0359500 [Oryza sativa subsp. Japonica] | 56 | 15,660 | 12.7 | 1 | 1.541 | Unknown biological processes |
gi|225423539| | PREDICTED: uncharacterized protein LOC100262861 [Vitis vinifera] | 152 | 24,072 | 16 | 2 | 2.042 | Unknown biological processes |
gi|330318602| | Hypothetical protein [Camellia sinensis] | 40 | 19,541 | 6 | 1 | 1.809 | Unknown biological processes |
gi|224070853| | Predicted protein [Populus trichocarpa] | 104 | 23,465 | 22.3 | 3 | 1.788 | Unknown biological processes |
gi|224144195| | Predicted protein [Populus trichocarpa] | 93 | 28,934 | 6.2 | 1 | 1.668 | Unknown biological processes |
gi|147818671| | Hypothetical protein VITISV_014852 [Vitis vinifera] | 43 | 14,360 | 10.5 | 1 | 1.715 | Unknown biological processes |
gi|359488537| | PREDICTED: uncharacterized protein LOC100853981 [Vitis vinifera] | 71 | 21,254 | 8.3 | 1 | 1.921 | Unknown biological processes |
gi|147818796| | Hypothetical protein VITISV_021596 [Vitis vinifera] | 625 | 66,920 | 20.2 | 9 | 1.795 | Unknown biological processes |
gi|225452887| | PREDICTED: uncharacterized protein At5g39570 [Vitis vinifera] | 141 | 28,611 | 31.3 | 4 | 1.902 | Unknown biological processes |
gi|359491847| | PREDICTED: uncharacterized protein LOC100240982 [Vitis vinifera] | 78 | 22,451 | 15.1 | 2 | 1.893 | Unknown biological processes |
gi|225463725| | PREDICTED: uncharacterized protein LOC100261025 [Vitis vinifera] | 79 | 82,239 | 7.5 | 3 | 1.632 | Unknown biological processes |
gi|147818796| | Hypothetical protein VITISV_021596 [Vitis vinifera] | 625 | 66,920 | 20.2 | 9 | 1.795 | Unknown biological processes |
gi|356551464| | PREDICTED: uncharacterized protein LOC100807412 [Glycine max] | 53 | 57,807 | 3 | 1 | 2.315 | Unknown biological processes |
gi|298205066| | Unnamed protein product [Vitis vinifera] | 293 | 59,849 | 8 | 3 | 1.506 | Unknown biological processes |
gi|358249210| | Uncharacterized protein LOC100818758 [Glycine max] | 74 | 26,221 | 15.1 | 2 | 2.26 | Unknown biological processes |
gi|224089721| | Predicted protein [Populus trichocarpa] | 64 | 16,865 | 21 | 2 | 1.824 | Unknown biological processes |
gi|225443833| | PREDICTED: uncharacterized protein LOC100253185 [Vitis vinifera] | 155 | 13,410 | 33 | 3 | 1.815 | Unknown biological processes |
gi|297743302| | Unnamed protein product [Vitis vinifera] | 269 | 40,524 | 24.2 | 5 | 1.913 | Unknown biological processes |
gi|296081618| | Unnamed protein product [Vitis vinifera] | 280 | 16,151 | 51.6 | 4 | 2.009 | Unknown biological processes |
gi|225459322| | PREDICTED: uncharacterized protein LOC100260886 isoform 2 [Vitis vinifera] | 80 | 43,415 | 11.6 | 3 | 1.733 | Unknown biological processes |
sp|Q6ID70| | Uncharacterized protein At3g03773 [Spinacia oleracea] | 189 | 28,352 | 12.6 | 2 | 1.772 | Unknown biological processes |
gi|225451915| | PREDICTED: uncharacterized protein LOC100244706 [Vitis vinifera] | 181 | 28,654 | 12.2 | 2 | 2.492 | Unknown biological processes |
gi|297738842| | Unnamed protein product [Vitis vinifera] | 68 | 67,341 | 4.9 | 2 | 0.657 | Unknown biological processes |
gi|359489218| | PREDICTED: uncharacterized protein LOC100232913 [Vitis vinifera] | 95 | 31,024 | 10.9 | 2 | 0.565 | Unknown biological processes |
gi|17863981| | Unknown [Davidia involucrata] | 150 | 95,611 | 9.6 | 6 | 0.598 | Unknown biological processes |
gi|224056457| | Predicted protein [Populus trichocarpa] | 43 | 32,607 | 7.2 | 1 | 0.25 | Unknown biological processes |
gi|359488731| | PREDICTED: uncharacterized protein LOC100264617 [Vitis vinifera] | 111 | 34,149 | 5.2 | 1 | 0.446 | Unknown biological processes |
gi|359476152| | PREDICTED: uncharacterized protein LOC100260975 [Vitis vinifera] | 142 | 40,178 | 10.4 | 3 | 0.374 | Unknown biological processes |
gi|297742161| | Unnamed protein product [Vitis vinifera] | 141 | 34,984 | 19.3 | 3 | 0.436 | Unknown biological processes |
gi|225449483| | PREDICTED: uncharacterized protein LOC100244410 [Vitis vinifera] | 73 | 23,689 | 7.1 | 1 | 0.65 | Unknown biological processes |
gi|225463406| | PREDICTED: uncharacterized protein LOC100250442 [Vitis vinifera] | 85 | 20,570 | 7.9 | 1 | 0.631 | Unknown biological processes |
gi|351722061| | Uncharacterized protein LOC100305495 precursor [Glycine max] | 236 | 23,212 | 10.4 | 1 | 0.52 | Unknown biological processes |
gi|224141949| | Predicted protein [Populus trichocarpa] | 101 | 18,222 | 19 | 1 | 0.514 | Unknown biological processes |
2.4. RT-qPCR Analysis and Enzyme Activity Assay
3. Discussion
3.1. Changes in Secondary Metabolites
3.2. Proteins Involved in Carbohydrate and Energy Metabolism
3.3. Proteins Related to Secondary Metabolism
3.4. Photosynthetic Proteins
3.5. Defense-Related Proteins
4. Experimental Section
4.1. Plant Materials
4.2. Metabolic Analysis of Tea Samples
4.3. Protein Extraction
4.4. iTRAQ Analysis
4.5. Data Analysis
4.6. Bioinformatic Analysis of Proteins
4.7. Real-time Quantitative PCR Analysis
Gene Name | Accession Number | Primer Sequence (5′–3′) |
---|---|---|
Flavonol synthase | DQ198089 | Forward: ggagaacagcaaggctatcg |
Reverse: tctcctcctgtgggagctta | ||
Phenylalanine ammonia-lyase | D26596 | Forward: tccgatcatcgacaaaatca |
Reverse: agctcagagaattgggcaaa | ||
Photosystem I reaction center subunit XI | HM003371 | Forward: tcaaagaaggagagccatcg |
Reverse: gcaagaaataggcccaaatg | ||
Dehydrin | FJ436978 | Forward: gaggagaggaccaacagcag |
Reverse: acgacaccgacacacacatt | ||
60S acidic ribosomal protein p2 | HM003314 | Forward: gggtgctattgcagtgacct |
Reverse: attgggggagaaagaaggaa |
4.8. PAL Extraction and Enzyme Assays
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Khan, N.; Mukhtar, H. Tea and health: Studies in humans. Curr. Pharm. Des. 2013, 19, 6141–6147. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Kim, J.B.; Hahn, B.S.; Kim, K.H.; Ha, S.H.; Kim, Y.H. EST analysis of genes involved in secondary metabolism in Camellia sinensis (tea), using suppression subtractive hybridization. Plant Sci. 2004, 166, 953–961. [Google Scholar] [CrossRef]
- Shan, Y.; Li, W.; Wang, Y.; Liu, Y.; Wang, H.; Wang, X.; Lu, Z.; Tian, Y.; Gao, L.; Xia, T. Catechin synthesis and accumulation in tea seedlings at different development stages. J. Anhui Agr. Univ. 2011, 38, 600–605. (In Chinese) [Google Scholar]
- Li, J.; Zhao, M.; Zhang, G.; Ding, X.; Hu, Y.; Shen, X.; Shao, W. HPLC analysis of myricetin, quercetin and kaempferol in fresh shoots of “Zijuan” tea, a new cultivar of Camellia sinensis var. Assamica. J. Yunnan Agri. Univ. 2012, 27, 235–240. (In Chinese) [Google Scholar]
- Singh, K.; Rani, A.; Kumar, S.; Sood, P.; Mahajan, M.; Yadav, S.K.; Singh, B.; Ahuja, P.S. An early gene of the flavonoid pathway, flavanone 3-hydroxylase, exhibits a positive relationship with the concentration of catechins in tea (Camellia sinensis). Tree Physiol. 2008, 28, 1349–1356. [Google Scholar] [CrossRef] [PubMed]
- Eungwanichayapant, P.D.; Popluechai, S. Accumulation of catechins in tea in relation to accumulation of mRNA from genes involved in catechin biosynthesis. Plant Physiol. Biochem. 2009, 47, 94–97. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Gao, L.; Xia, T.; Liu, Y.; Gao, K. Study on the changes of non-galloylated catechins and relative enzymes in tea shoots. J. Tea Sci. 2009, 29, 365–371. [Google Scholar]
- Suzuki, T.; Ashihara, H.; Waller, G.R. Purine and purine alkaloid metabolism in Camellia and Coffea plants. Phytochemistry 1992, 31, 2575–2584. [Google Scholar] [CrossRef]
- Kato, M.; Kitao, N.; Ishida, M.; Morimoto, H.; Irino, F.; Mizuno, K. Expression for caffeine biosynthesis and related enzymes in Camellia sinensis. Z. Naturforsch C 2010, 65, 245–256. [Google Scholar] [CrossRef] [PubMed]
- Yan, S.P.; Zhang, Q.Y.; Tang, Z.C.; Su, W.A.; Sun, W.N. Comparative proteomic analysis provides new insights into chilling stress responses in rice. Mol. Cell. Proteomics 2006, 5, 484–496. [Google Scholar] [CrossRef] [PubMed]
- Mamati, G.E.; Liang, Y.; Lu, J. Expression of basic genes involved in tea polyphenol synthesis in relation to accumulation of catechins and total tea polyphenols. J. Sci. Food Agric. 2006, 86, 459–464. [Google Scholar] [CrossRef]
- Ashihara, H.; Deng, W.W.; Mullen, W.; Crozier, A. Distribution and biosynthesis of flavan-3-ols in Camellia sinensis seedlings and expression of genes encoding biosynthetic enzymes. Phytochemistry 2010, 71, 559–566. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.R.; Liu, Z.S.; Xu, Y.R.; Hu, Y.L. A study on chemical composition of two special green teas (Camellia sinensis). J. Sci. Food Agric. 1990, 53, 541–548. [Google Scholar] [CrossRef]
- Harbowy, M.E.; Balentine, D.A.; Davies, A.P.; Cai, Y. Tea chemistry. Crit. Rev. Plant Sci. 1997, 16, 415–480. [Google Scholar] [CrossRef]
- Ashihara, H.; Kubota, H. Patterns of adenine metabolism and caffeine biosynthesis in different parts of tea seedlings. Physiol. Plant. 1986, 68, 275–281. [Google Scholar] [CrossRef]
- Deng, W.-W.; Li, Y.; Ogita, S.; Ashihara, H. Fine control of caffeine biosynthesis in tissue cultures of Camellia sinensis. Phytochem. Lett. 2008, 1, 195–198. [Google Scholar] [CrossRef]
- Ashihara, H.; Sano, H.; Crozier, A. Caffeine and related purine alkaloids: Biosynthesis, catabolism, function and genetic engineering. Phytochemistry 2008, 69, 841–856. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez, L.; van Wuytswinkel, O.; Castelain, M.; Bellini, C. Combined networks regulating seed maturation. Trends Plant Sci. 2007, 12, 294–300. [Google Scholar] [CrossRef] [PubMed]
- Ge, P.; Ma, C.; Wang, S.; Gao, L.; Li, X.; Guo, G.; Ma, W.; Yan, Y. Comparative proteomic analysis of grain development in two spring wheat varieties under drought stress. Anal. Bioanal. Chem. 2012, 402, 1297–1313. [Google Scholar] [CrossRef] [PubMed]
- McKay, D.L.; Blumberg, J.B. The role of tea in human health: An update. J. Am. Coll. Nutr. 2002, 21, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Cabrera, C.; Artacho, R.; Gimenez, R. Beneficial effects of green tea--a review. J. Am. Coll. Nutr. 2006, 25, 79–99. [Google Scholar] [CrossRef] [PubMed]
- Kao, Y.-H.; Chang, H.-H.; Lee, M.-J.; Chen, C.-L. Tea, obesity, and diabetes. Mol. Nutr. Food Res. 2006, 50, 188–210. [Google Scholar] [CrossRef] [PubMed]
- Boon, N. Health potential for functional green teas? Int. J. Vitam. Nutr. Res. 2008, 78, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Beecher, G.R.; Warden, B.A.; Merken, H. Analysis of tea polyphenols. Proc. Soc. Exp. Biol. Med. 1999, 220, 267–270. [Google Scholar] [CrossRef] [PubMed]
- Balentine, D.A.; Wiseman, S.A.; Bouwens, L.C.M. The chemistry of tea flavonoids. Crit. Rev. Food Sci. Nutr. 1997, 37, 693–704. [Google Scholar] [CrossRef] [PubMed]
- Lin, G.-Z.; Lian, Y.-J.; Ryu, J.-H.; Sung, M.-K.; Park, J.-S.; Park, H.-J.; Park, B.K.; Shin, J.-S.; Lee, M.-S.; Cheon, C.-I. Expression and purification of His-tagged flavonol synthase of Camellia sinensis from Escherichia coli. Protein Expr. Purif. 2007, 55, 287–292. [Google Scholar] [CrossRef] [PubMed]
- Mahajan, M.; Ahuja, P.S.; Yadav, S.K. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set. PLoS ONE 2011, 6, e28315. [Google Scholar] [CrossRef] [PubMed]
- Mahajan, M.; Joshi, R.; Gulati, A.; Yadav, S.K. Increase in flavan-3-ols by silencing flavonol synthase mRNA affects the transcript expression and activity levels of antioxidant enzymes in tobacco. Plant Biol. 2012, 14, 725–733. [Google Scholar] [CrossRef] [PubMed]
- Xiong, L.; Li, J.; Li, Y.; Yuan, L.; Liu, S.; Huang, J.A.; Liu, Z. Dynamic changes in catechin levels and catechin biosynthesis-related gene expression in albino tea plants (Camellia sinensis L.). Plant Physiol. Biochem. 2013, 71, 132–143. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; He, X.; Lin, J.; Shao, H.; Chang, Z.; Dixon, R.A. Crystal structure of isoflavone reductase from alfalfa (Medicago sativa L.). J. Mol. Biol. 2006, 358, 1341–1352. [Google Scholar] [CrossRef] [PubMed]
- Camm, E.L.; Towers, G.H.N. Phenylalanine ammonia lyase. Phytochemistry 1973, 12, 961–973. [Google Scholar] [CrossRef]
- Fritz, R.R.; Hodgins, D.S.; Abell, C.W. Phenylalanine ammonia-lyase. Induction and purification from yeast and clearance in mammals. J. Biol. Chem. 1976, 251, 4646–4650. [Google Scholar] [PubMed]
- Tanaka, Y.; Matsuoka, M.; Yamanoto, N.; Ohashi, Y.; Kano-Murakami, Y.; Ozeki, Y. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato. Plant Physiol. 1989, 90, 1403–1407. [Google Scholar] [CrossRef] [PubMed]
- Bate, N.J.; Orr, J.; Ni, W.; Meromi, A.; Nadler-Hassar, T.; Doerner, P.W.; Dixon, R.A.; Lamb, C.J.; Elkind, Y. Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis. Proc. Natl. Acad. Sci. USA 1994, 91, 7608–7612. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.; Kumar, S.; Rani, A.; Gulati, A.; Ahuja, P.S. Phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea. Funct. Integr. Genomics 2009, 9, 125–134. [Google Scholar] [CrossRef] [PubMed]
- Whetten, R.W.; MacKay, J.J.; Sederoff, R.R. Recent advances in understanding lignin biosynthesis. Annu. Rev. Plant Biol. 1998, 49, 585–609. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, L.; Maury, S.; Martz, F.; Geoffroy, P.; Legrand, M. Purification, cloning, and properties of an acyltransferase controlling shikimate and quinate ester intermediates in phenylpropanoid metabolism. J. Biol. Chem. 2003, 278, 95–103. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, L.; Besseau, S.; Geoffroy, P.; Ritzenthaler, C.; Meyer, D.; Lapierre, C.; Pollet, B.; Legrand, M. Silencing of hydroxycinnamoyl-coenzyme a shikimate/quinate hydroxycinnamoyltransferase affects phenylpropanoid biosynthesis. Plant Cell 2004, 16, 1446–1465. [Google Scholar] [CrossRef] [PubMed]
- Besseau, S.; Hoffmann, L.; Geoffroy, P.; Lapierre, C.; Pollet, B.; Legrand, M. Flavonoid accumulation in arabidopsis repressed in lignin synthesis affects auxin transport and plant growth. Plant Cell 2007, 19, 148–162. [Google Scholar] [CrossRef] [PubMed]
- Maayan, I.; Shaya, F.; Ratner, K.; Mani, Y.; Lavee, S.; Avidan, B.; Shahak, Y.; Ostersetzer-Biran, O. Photosynthetic activity during olive (Olea europaea) leaf development correlates with plastid biogenesis and Rubisco levels. Physiol. Plant. 2008, 134, 547–558. [Google Scholar] [CrossRef] [PubMed]
- Makino, A.; Mae, T.; Ohira, K. Photosynthesis and ribulose 1,5-bisphosphate carboxylase in rice leaves: Changes in photosynthesis and enzymes involved in carbon assimilation from leaf development through senescence. Plant Physiol. 1983, 73, 1002–1007. [Google Scholar] [CrossRef] [PubMed]
- Kennedy, R.; Johnson, D. Changes in photosynthetic characteristics during leaf development in apple. Photosynth. Res. 1981, 2, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Roper, T.R.; Kennedy, R.A. Photosynthetic characteristics during leaf development in bing sweet cherry. J. Am. Soc. Hortic. Sci. 1986, 111, 938–941. [Google Scholar]
- Tu, L.; Lin, Y.; Yang, Z.; Huang, Z.; Zhao, W.; Sun, P. The study of the correlation between the net photosynthetic rate and catechins components of tea plant leaves. Chin. Agric. Sci. Bull. 2012, 28, 227–233. (In Chinese) [Google Scholar]
- Ghasemzadeh, A.; Jaafar, H.Z.; Rahmat, A. Synthesis of phenolics and flavonoids in ginger (Zingiber officinale roscoe) and their effects on photosynthesis rate. Int. J. Mol. Sci. 2010, 11, 4539–4555. [Google Scholar] [CrossRef] [PubMed]
- Perl-Treves, R.; Galun, E. The tomato Cu, Zn superoxide dismutase genes are developmentally regulated and respond to light and stress. Plant Mol. Biol. 1991, 17, 745–760. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.-D.; Li, P.-M.; Gao, H.-Y.; Zou, Q.; Jiang, G.-M.; Li, L.-H. Enhanced photoprotection at the early stages of leaf expansion in field-grown soybean plants. Plant Sci. 2005, 168, 911–919. [Google Scholar] [CrossRef]
- Rodriguez, A.A.; Grunberg, K.A.; Taleisnik, E.L. Reactive oxygen species in the elongation zone of maize leaves are necessary for leaf extension. Plant Physiol. 2002, 129, 1627–1632. [Google Scholar] [CrossRef] [PubMed]
- Turkmen, N.; Sari, F.; Velioglu, Y.S. Effects of extraction solvents on concentration and antioxidant activity of black and black mate tea polyphenols determined by ferrous tartrate and folin–ciocalteu methods. Food Chem. 2006, 99, 835–841. [Google Scholar] [CrossRef]
- Meda, A.; Lamien, C.E.; Romito, M.; Millogo, J.; Nacoulma, O.G. Determination of the total phenolic, flavonoid and proline contents in Burkina Fasan honey, as well as their radical scavenging activity. Food Chem. 2005, 91, 571–577. [Google Scholar] [CrossRef]
- Wang, Z.; Tong, X.; Zhu, S. Quantitative analysis of catechins with HPLC. J. Tea Sci. 1991, 11, 93–99. (In Chinese) [Google Scholar]
- Li, Y.; Li, J.; Gong, X.; Liu, Z. Simultaneous determination of eight catechins, three purine alkaloids and gallic acid in tea by high-performance liquid chromatography. Food Sci. 2011, 32, 214–217. [Google Scholar]
- Tatusov, R.L.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Kiryutin, B.; Koonin, E.V.; Krylov, D.M.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; et al. The COG database: An updated version includes eukaryotes. BMC Bioinform. 2003, 4, 41. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S.; Sato, Y.; Furumichi, M.; Tanabe, M. Kegg for integration and interpretation of large-scale molecular data sets. Nucleic Acids Res. 2012, 40, D109–D114. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Q.; Li, J.; Liu, S.; Huang, J.; Lin, H.; Wang, K.; Cheng, X.; Liu, Z. A Comparative Proteomic Analysis of the Buds and the Young Expanding Leaves of the Tea Plant (Camellia sinensis L.). Int. J. Mol. Sci. 2015, 16, 14007-14038. https://doi.org/10.3390/ijms160614007
Li Q, Li J, Liu S, Huang J, Lin H, Wang K, Cheng X, Liu Z. A Comparative Proteomic Analysis of the Buds and the Young Expanding Leaves of the Tea Plant (Camellia sinensis L.). International Journal of Molecular Sciences. 2015; 16(6):14007-14038. https://doi.org/10.3390/ijms160614007
Chicago/Turabian StyleLi, Qin, Juan Li, Shuoqian Liu, Jianan Huang, Haiyan Lin, Kunbo Wang, Xiaomei Cheng, and Zhonghua Liu. 2015. "A Comparative Proteomic Analysis of the Buds and the Young Expanding Leaves of the Tea Plant (Camellia sinensis L.)" International Journal of Molecular Sciences 16, no. 6: 14007-14038. https://doi.org/10.3390/ijms160614007