Gene Cloning, Expression and Activity Analysis of Manganese Superoxide Dismutase from Two Strains of Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta) under Heat Stress
Abstract
:Abbreviations
Mn-SOD | manganese superoxide dismutase |
W | wild populations of G. lemaneiformis |
981 | cultivar 981 of G. lemaneiformis |
W-SOD | Mn-SOD of W |
981-SOD | Mn-SOD of 981 |
1. Introduction
2. Results and Discussion
2.1. Cloning and Analysis of Mn-SOD cDNA of G. lemaneiformis
2.2. Cloning of the Mn-SOD DNA Sequence
2.3. Southern Blot
2.4. Quantitative Analysis of Mn-SOD mRNA Transcription and SOD Activity Assay
3. Experimental
3.1. Materials
3.2. RNA Extraction and cDNA Synthesis
3.3. Cloning of the Full-Length Mn-SOD cDNA
Primer Name | Sequences (5'→3') |
---|---|
S1 | CCCAGACGTCCAAACCAAGGATCGGGG |
S2 5'-Oligo 3'-CDS | GGACCCTCATGGCCAAGCCCGGATCCGC AAGCAGTGGTATCAACGCAGAGTACGCGGG AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTVN |
S1F | ATGAATTTCGCCCTCCCCGCTCTC |
S1R | TTACGCGACAGGGGTGTCGAAGAC |
S2F | CATCCAGGCAAACATCCC |
S2R | GGCTTTGACGGAACCCAT |
18sF | TGGTGGAGTGATCTGTCTGGTT |
18sR | TTGGCCCGTTCAGTGTAGC |
3.4. Cloning of the Mn-SOD DNA Sequence
3.5. Genomic Southern Blot
3.6. Quantitative Analysis of Mn-SOD mRNA Transcription
3.7. SOD Activity Assay
3.8. Statistical Analysis
4. Conclusions
Acknowledgments
References and Notes
- Ren, X.Y.; Zhang, X.C. Identification of a putative tetrasporophyte-spectific gene in Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta). J. Ocean Univ. Chin. 2008, 7, 299–303. [Google Scholar] [CrossRef]
- Fei, X.G. Solving the coastal eutrophication problem by large scale seaweed cultivation. Hydrobiologia 2004, 512, 145–151. [Google Scholar]
- Yang, Y.F.; Fei, X.G.; Song, J.M.; Hu, H.Y.; Wang, G.C.; Chung, I.K. Growth of Gracilaria lemaneiformis under different cultivation conditions and its effects on nutrient removal in Chinese coastal waters. Aquaculture 2006, 254, 248–255. [Google Scholar] [CrossRef]
- Zhou, Y.; Yang, H.S.; Hu, H.Y.; Liu, Y.; Mao, Y.Z.; Zhou, H. Bioremediation potential of the macroalga Gracilaria lemaneiformis (Rhodophyta) integrated into fed fish culture in coastal waters of north China. Aquaculture 2006, 252, 264–276. [Google Scholar] [CrossRef]
- Brawley, S.H.; Fei, X.G. Ecological studies of Gracilaria asiatica and Gracilaria lemaneiformis in Zhanshan Bay, Qingdao. Chin. J. Oceanol. Limnol. 1988, 6, 20–34. [Google Scholar]
- Fei, X.G.; Zhang, X.C.; Chen, W.Z.; Pang, S.J.; Bao, Y. A fast Growing Strain of Gracilaria lemaneiformis KFGL981 and Its Cultivation in China; Kobe International Conference Center: Kobe, Japan, 2007; pp. 26–31. [Google Scholar]
- Meng, L.; XU, D.; Chen, W.Z.; Zhang, X.C. Selection and characterization of a new strain of Gracilaria lemaneiformis. J. Ocean Univ. Chin. 2009, 39, S94–S98. [Google Scholar]
- Zhang, X.Y.; Hu, C.G.; Yao, J.L. Tetraploidization of diploid Dioscorea results in activation of the antioxidant defense system and increased heat tolerance. J. Plant Physiol. 2010, 167, 88–94. [Google Scholar] [CrossRef]
- Igor, N.Z.; Thomas, J.M.; Rodney, J.F. Superoxide dismutase gene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 2002, 33, 337–349. [Google Scholar] [CrossRef]
- Cho, Y.S.; Choi, B.N.; Kin, K.H.; Kim, S.K.; Kim, D.S.; Bang, I.C. Differential expression of Cu/Zn superoxide dismutase mRNA during exposures to heavy metals in rockbream (Oplegnathus fasciatus). Aquaculture 2006, 253, 667–679. [Google Scholar] [CrossRef]
- Wang, B.Q. The research progress of the plant SOD. J. Hebei Agric. Sci. 2008, 12, 6–9. [Google Scholar]
- Leland, S.J.; Andrea, L.W. Long-term hyposaline and hypersaline stresses produce distinct antioxidant responses in the marine alga Dunaliella tertiolecta. J. Plant Physiol. 2003, 160, 1193–1202. [Google Scholar] [CrossRef]
- Tian, J.Y.; Yu, J. Changes in ultrastructure and responses of antioxidant systems of algae (Dunaliella salina) during acclimation to enhanced ultraviolet-B radiation. J. Photochem. Photobiol. B Biol. 2009, 97, 152–160. [Google Scholar] [CrossRef]
- Andrzej, B. An enhancing effect of exogenous brassinolide on the growth and antioxidant activity in Chlorella vulgaris cultures under heavy metals stress. Environ. Exp. Bot. 2010, 68, 175–179. [Google Scholar] [CrossRef]
- Manoj, K.; Puja, K.; Vishal, G. Biochemical responses of red alga Gracilaria corticata (Gracilariales, Rhodophyta) to salinity induced oxidative stress. J. Exp. Mar. Biol. Ecol. 1016, 2–8. [Google Scholar]
- Guo, J.J.; Gong, X.G.; Lu, Y.W. Cloning and sequence analyse of a superoxide dismutase gene from Spirulina platensis. J. Zhejiang Univ. (Sci. Ed.) 2004, 31, 674–678. [Google Scholar]
- Wang, R.; Liu, T.; Zhou, X.J.; Zhuang, Y.Y.; Mao, Y.X. Cloning and sequence analysing of Mn-SOD Gene from Porphyra yezoensis Udea. Chin. High Technol. Lett. 2006, 16, 522–528. [Google Scholar]
- Smith, M.W.; Doolittle, R.F. A comparison of evolutionary rates of the two major kinds of superoxide dismutase. J. Mol. Evol. 1992, 34, 175–184. [Google Scholar]
- BLAST program. Available online: http://www.ncbi.nlm.nih.gov/BLAST/ (accessed on 22 March 2012).
- Altschul, S.; Gish, W.; Miller, W.; Myers, E.; Lipman, D. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar]
- Wan, X.S.; Devalaraja, M.N.; Clair, D. Molecular structure and organization of superoxide dismutase gene. DNA Cell Biol. 1994, 13, 1127–1129. [Google Scholar]
- Wei, Z.B.; Miao, X.Y.; Yang, M.Q.; Luo, X.G. Advances in the expression and regulation of Mn-SOD gene. Hereditas 2008, 30, 831–837. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar]
- Sample Availability: The two strains of G. lemaneiformis and all the primers used in this research are available from the authors.
© 2012 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Lu, N.; Zang, X.; Zhang, X.; Chen, H.; Feng, X.; Zhang, L. Gene Cloning, Expression and Activity Analysis of Manganese Superoxide Dismutase from Two Strains of Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta) under Heat Stress. Molecules 2012, 17, 4522-4532. https://doi.org/10.3390/molecules17044522
Lu N, Zang X, Zhang X, Chen H, Feng X, Zhang L. Gene Cloning, Expression and Activity Analysis of Manganese Superoxide Dismutase from Two Strains of Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta) under Heat Stress. Molecules. 2012; 17(4):4522-4532. https://doi.org/10.3390/molecules17044522
Chicago/Turabian StyleLu, Ning, Xiaonan Zang, Xuecheng Zhang, Hao Chen, Xiaoting Feng, and Lu Zhang. 2012. "Gene Cloning, Expression and Activity Analysis of Manganese Superoxide Dismutase from Two Strains of Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta) under Heat Stress" Molecules 17, no. 4: 4522-4532. https://doi.org/10.3390/molecules17044522