Adult samples were collected in infested counties in Georgia and South Carolina and placed in 95%–100% EtOH. Each collection was labeled as to the date, location, and the collector's name.

DNA was extracted from individual bugs preserved in 95%–100% EtOH with the DNeasy Blood & Tissue Kit (QIAGEN Inc., Valencia, CA). Extractions were performed in accordance with the protocols included with the kit.

A mitochondrial DNA (mtDNA) fragment (2336 bp) was amplified and sequenced in both directions from each of 83 samples collected from 36 counties in Georgia and two counties in South Carolina using two pairs of primers. This fragment consisted of the tyrosine tRNA, the cytochrome c oxidase subunit I gene (COI), the leucine tRNA, and the cytochrome c oxidase subunit II gene (COII). The 5′ end of the fragment was amplified and sequenced with primer MC-COI-Fwd (5′– ATGCCCAACTTCAGAATTGC–3′) as the forward primer and primer MC-COI-Rev (5′– ACTGCTCCTATGGATAATACG–3′) as the reverse primer. The 3′ end of the fragment was amplified and sequenced with primer MC-CO2-Fwd (5′–CTATTCACAATCGGAGGACTAA–3′) as the forward primer and primer MC-CO2-3700 (5′–GGTTTAAGAGACCAATGCT–3′) as the reverse primer.

In addition, two genes from the bacterial genome of the gammaproteobacteria were also partially amplified and sequenced with forward and reverse primers: 16S rRNA (1420 bp from 43 individuals), and groEL (1554 bp from 35 individuals). The 16S rRNA gene primers were forward, 16SA1 (5′– AGAGTTTGATCMTGGCTCAG–3′) and reverse, 16SB1 (5′–TACGGYTACCTTGTTACGACTT– 3′) [3]. The groEL chaperone gene was amplified and sequenced with primer Gro-F1 (5′–ATGGCAGCWAAAGACGTAAATTYGG–3′) as the forward primer and primer Gro-R1 (5′–TTACATCATKCCGCCCATGC–3′) as the reverse primer [11]. Lastly, the outer surface protein gene, wsp, of Wolbachia strains (552 bp from 35 individuals) were amplified and sequenced with primer MC-wsp-Fwd (5′–CAACGGTGAATTTTTACCTCT–3′) as the forward primer and MC-wsp- Rev (5′– GCTGTAAAGAACTTTGTATGCG–3′) as the reverse primer.

PCR was performed with a standard 25 μL reaction containing 5–20 ng of total genomic DNA. The reactions for each of the five amplifications had 1 pmol of each primer, 2.0 mM MgCl₂, 1.0 mM dNTPs, and 0.06 U/μL Taq DNA polymerase. DNA was amplified in a Perkin-Elmer Gene Amp PCR system 9600 or 9700 (Applied Biosystems, Foster City, CA). The procedure included a pre-cycle denaturation at 94 °C for 2 min., a post-cycle extension at 72 °C for 7 min, and 35 cycles of a standard three-step PCR. The first and third steps were the same for each primer pair (94 °C for 1 min and 72 °C for 2 min). The second step varied for each primer pair: 53 °C for 1 min for the two mitochondrial primer pairs, 54 °C for 1 min for the 16SrRNA primer pair, 57 °C for 1 min for the groEL primer pair, and 51 °C for 1 min for the wsp primer pair. PCR products were further purified using the QIAquick PCR Purification Kit (QIAGEN Inc., Valencia, CA) in accordance with the included protocol. All PCR samples were then sent to Eurofins MWG Operon (2211 Seminole Drive, Huntsville, Alabama 35805) for direct sequencing in both directions.

To further confirm maternal haplotype data, the entire mitochondrial genome (15,647 bp) was sequenced from five randomly chosen individuals collected from each of four counties where M. cribraria was first identified: one from Clark, one from Oconee, two from Hall and one from Jackson (Figure 1).

All sequences were analyzed and initially aligned using Sequencher 4.0.1 software (Gene Codes Corp., Ann Arbor, MI, USA) according to established protocol [16]. Sequences were then aligned using CLUSTALW 1.83 [17]. A GenBank BLASTn search was also done on sequences to determine similarity to sequences in the sequence databases under the auspices of the International Nucleotide Sequence Database Collaboration (INSDC).

The 2336 bp mtDNA fragment which was sequenced from 83 individuals collected randomly from 36 counties in Georgia and two counties in South Carolina was the same for all individuals. The haplotype was designated GA1 (GenBank HQ444175). The mitochondrial genome sequences (15, 647 bp), which included the GA1 haplotype, from each of five individuals collected in four of the counties where the stink bug was initially identified (Figure 1) was the same for all five (GenBank No. JF288758).

In order to develop a genetic baseline for this insect, the genetics of the endosymbiont had to be considered since the insect's survival depended on the bacteria [3]. To gain insight into the adaptive potential, biological history and fitness of the inherent symbiotic relationships two endosymbionts were studied: the obligate γ-proteobacterium, Candidatus Ishikawaella capsulata, necessary for Megacopta to thrive [11] and the Wolbachia α-proteobacterium, implicated in reproductive anomalies [18] as well as a mutualistic provider of essential nutrients [19].

The 2336 bp gene fragment from 83 individuals collected from 36 counties and the entire mtDNA genome (15, 647 bp) from five individuals collected from four of the original counties in which the bug was first discovered all had identical DNA sequence. These data strongly suggest that a single female lineage, GA1, has been introduced into North Georgia. The insect has been observed flying and landing on people as well as on and in their vehicles [4]. This phenomenon may have contributed to M. cribraria, GA1, rapidly dispersing throughout Georgia and into the contiguous state of South Carolina. If the insect continues to expand its range, it will likely disperse into other contiguous states (Figure 1). It has been able to overwinter in north Georgia where the temperature often fell below freezing between 2009 and 2010 [4]. Thus cold temperatures may not be a deterrent to dispersal. Megacopta cribraria was observed in June and July of 2010 feeding on kudzu vine, which was introduced into the United States from Japan in 1876 and has since spread across the southeastern United States [20]. It was also observed feeding on soybean plants at a density of ≥50 insects per plant [4].

Megacopta cribraria has shown that it is tolerant of some cold since it overwintered in north Georgia where there were days when temperatures fell below freezing between 2009 and 2010 [4]. The lack of genetic diversity observed in the mtDNA sequence is indicative of selection on this genome [21], which could be the result of multiple phenomena. The insect's ability to adapt across varied ecologies may be due to mutations in the nuclear genome resulting from the founder effect. These mutations created or exacerbated disequilibrium between the mtDNA and the nuclear genomes, which exerted strong selection pressure on a particular mtDNA sequence. A linkage disequilibrium between the mtDNA and nuclear genomes, or selection pressure from one or more of the endosymbiont genomes for a female lineage may also favor one mtDNA lineage over another. Each phenomenon could strengthen the bug's adaptive potential and facilitate expansion into novel geographies at least across the southeastern U. S.

Evidence from gene sequences amplified from individual M. cribraria of haplotype GA1 collected across counties in Georgia and South Carolina revealed two endosymbionts in the host stink bug: Candidatus Ishikawaella capsulata, a γ -proteobacterium in the order Enterobacteriales and Wolbachia, an α-proteobacterium in the order Rickettsiales.

Candidatus Ishikawaella capsulata are vertically inherited bacteria found in the midgut of Megacopta stink bugs in Japan [10]. These extracellular, primary symbionts [21] are maternally transmitted to offspring in capsules which are deposited on the underside of egg masses. When the nymphs hatch they quickly absorb the bacteria [10]. The C. I. capsulata 16S rRNA consensus sequence amplified from the GA1 samples aligned exactly with the 16S rRNA C. I. capsulata sequences amplified from M. punctatissima in Japan and recently deposited into GenBank. The groEL sequences deposited in GenBank (JR736508) showed 99% identity with C. I. capsulata amplified from both M. cribraria and M. punctatissima in Japan. This γ-proteobacterium in M. cribraria haplotype GA1, as in other hemiptera [22], keeps the insect alive and reproducing by synthesizing essential amino acids and other nutrients its food source does not provide [10]. Since the basic reproductive and nutritional needs of the stink bug are being met, female fecundity is likely to continue to be high exacerbating dispersal into new ecologies.

Although a single insect has been shown to be infected with multiple strains of Wolbachia [16], only one strain of Wolbachia was amplified from the plataspid insects in Georgia. This Wolbachia amplified from M. punctatissima collected in Japan and deposited in GenBank (AB109596) in 2003 had identical wsp sequence to those amplified from GA1 samples. It appears, therefore, that the Wolbachia bacterium found in the invasive stink bugs in Georgia is found in a different Megacopta species indigenous to Japan. This observation strongly suggest that more research needs to be done on the significance of horizontal transfer of the endosymbiont to other species within the genus, particularly since these accessory or facultative microorganisms have significant selective effects on reproduction, adaptation across environments, and dispersal [23].