Detection of Pathogenic Escherichia coli in Samples Collected at an Abattoir in Zaria, Nigeria and at Different Points in the Surrounding Environment
Abstract
:1. Introduction
2. Results
2.1. E. coli Isolation and Characterization Using the Ridascreen Verotoxin Immuno Assay
Sampling Point | No. of Samples | No. of Colonies | ||
---|---|---|---|---|
Collected | Producing Typical Colonies on EMB (%) | Biochemically Confirmed as E. coli (%) | Positive to EIA (%) | |
Faecal | 200 | 183 (91.5) | 152 (76) | 25 (12.5) |
E-1 | 60 | 53 (88.3) | 48 (80) | 4 (6.7) |
E-2 | 60 | 48 (80) | 42 (70) | 1(1.7) |
E-3 | 60 | 52 (86.7) | 45 (75) | 0 (0) |
Carrot | 100 | 79 (79) | 68 (68) | 6 (6) |
Cabbage | 100 | 75 (75) | 66 (66) | 4 (4) |
Lettuce | 100 | 78 (78) | 70 (70) | 2 (2) |
S-1 | 20 | 17 (85) | 15 (75) | 1 (5) |
S-2 | 20 | 10 (50) | 7 (35) | 0 (0) |
S-3 | 20 | 12 (60) | 9 (45) | 0 (0) |
2.2. Characterization of the Ridascreen Verotoxin Immunoassay-Positive Colonies by Vero Cell Assay
2.3. Characterisation of the Isolates by PCR Amplification of Virulence Genes
Source | Presence of | ||||||||
---|---|---|---|---|---|---|---|---|---|
VCA | stx1 | stx2 | eaeA | aggR | aaic | aat | ipaH | subAB | |
Faecal | + | + | + | - | - | - | - | - | - |
Faecal | + | + | + | - | - | - | - | - | - |
Faecal | + | - | - | - | - | - | - | - | - |
Faecal | + | - | - | - | - | - | - | - | - |
Effluent | - | - | - | - | + | - | + | - | - |
Effluent | + | - | - | - | - | - | - | - | + |
Carrot | + | - | - | - | - | - | - | - | + |
Cabbage | + | + | + | - | - | - | - | - | - |
Cabbage | + | - | - | - | - | - | - | - | - |
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. Sampling Strategy
4.3. Laboratory Procedure for Isolation and Identification of E. coli
4.4. Screening for STEC Using a Commercial Enzyme Immunoassay (EIA)
4.5. Characterization of E. coli Isolates by Vero Cell Assay and PCR
Primer Name | Sequence (5'- 3' ) | Amplicon Size (bp) | Reference |
---|---|---|---|
stx1F | ATAAATCGCCATTCGTTGACTAC | 180 | [42] |
stx1R | AGAACGCCCACTGAGATCATC | ||
stx2F | GGCACTGTCTGAAACTGCTCC | 255 | [42] |
stx2R | TCGCCAGTTATCTGACATTCTG | ||
eaeAF | GACCCGGACAAGCATAAGC | 384 | [42] |
eaeAR | CCACCTGCAGCAACAAGAGG | ||
aggRF | GCAATCAGATTAARCAGCGATACA | 426 | [30] |
aggRR | CATTCTTGATTGCATAAGGATCTGG | ||
aaiCF | TGGTGACTACTTTGATGGACATTGT | 313 | [30] |
aaiCR | GACACTCTCTTCTGGGGTAAACGA | ||
pCVD432/start (aat) | CTGGCGAAAGACTGTATCAT | 630 | [43] |
pCVD432/stop (aat) | CAATGTATAGAAATCGCCTGTT | ||
Shig-1 | TGGAAAAACTCAGTGCCTCT | 423 | [45] |
Shig-2 | CCAGTCCGTAAATTCATTCT | ||
RTSubABF | GCAGATAAATACCCTTCACTTG | 232 | [44] |
RTSubABR | ATCACCAGTCCACTCAGCC |
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Nataro, J.P.; Bopp, C.A.; Fields, P.I.; Kaper, J.B.; Strockbine, N.A. Escherichia, shigella, and salmonella. In Manual of Clinical Microbiology; Versalovic, J., Carroll, K.C., Funke, G., Jorgensen, J.H., Landry, M.L., Warnock, D.W., Eds.; ASM Press: Washington, DC, USA, 2011; pp. 603–626. [Google Scholar]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; FitzPatrick, E.S.; Fanning, S.; Hartigan, P.J. Enterobacteriaceae. In Veterinary Microbiology and Microbial Diseases, 2nd ed.; Wiley & Blackwell: Hoboken, NJ, USA, 2011; pp. 263–286. [Google Scholar]
- Van den Beld, M.J.; Reubsaet, F.A. Differentiation between shigella, enteroinvasive Escherichia coli (EIEC) and noninvasive Escherichia coli. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 899–904. [Google Scholar]
- Tozzoli, R.; Scheutz, F. Diarrhoeagenic Escherichia coli infections in humans. In Pathogenic Escherichia coli, Molecular and Cellular Microbiology, 1st ed.; Stefano, M., Ed.; Caister Academic Press: Norfolk, UK, 2014; pp. 1–18. [Google Scholar]
- Qadri, F.; Khan, A.I.; Faruque, A.S.; Begum, Y.A.; Chowdhury, F.; Nair, G.B.; Salam, M.A.; Sack, D.A.; Svennerholm, A.M. Enterotoxigenic Escherichia coli and vibrio cholerae diarrhea, Bangladesh, 2004. Emerg. Infect. Dis. 2005, 11, 1104–1107. [Google Scholar] [CrossRef] [PubMed]
- Caprioli, A.; Morabito, S.; Brugere, H.; Oswald, E. Enterohaemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet. Res. 2005, 36, 289–311. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, A.D.; Newland, J.W.; Miller, S.F.; Holmes, R.K.; Smith, H.W.; Formal, S.B. Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea. Science 1984, 226, 694–696. [Google Scholar] [CrossRef] [PubMed]
- Koch, C.; Hertwig, S.; Lurz, R.; Appel, B.; Beutin, L. Isolation of a lysogenic bacteriophage carrying the stx(1(ox3)) gene, which is closely associated with Shiga toxin-producing Escherichia coli strains from sheep and humans. J. Clin. Microbiol. 2001, 39, 3992–3998. [Google Scholar] [CrossRef] [PubMed]
- Tarr, P.I.; Gordon, C.A.; Chandler, W.L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 2005, 365, 1073–1086. [Google Scholar] [PubMed]
- Faith, N.G.; Shere, J.A.; Brosch, R.; Arnold, K.W.; Ansay, S.E.; Lee, M.S.; Luchansky, J.B.; Kaspar, C.W. Prevalence and clonal nature of Escherichia coli O157:H7 on dairy farms in wisconsin. Appl. Environ. Microbiol. 1996, 62, 1519–1525. [Google Scholar] [PubMed]
- La Ragione, R.M.; Best, A.; Woodward, M.J.; Wales, A.D. Escherichia coli O157:H7 colonization in small domestic ruminants. FEMS Microbiol. Rev. 2009, 33, 394–410. [Google Scholar] [CrossRef] [PubMed]
- Levine, M.M. Escherichia coli that cause diarrhea: Enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 1987, 155, 377–389. [Google Scholar] [CrossRef] [PubMed]
- Feng, P.C.; Monday, S.R.; Lacher, D.W.; Allison, L.; Siitonen, A.; Keys, C.; Eklund, M.; Nagano, H.; Karch, H.; Keen, J.; et al. Genetic diversity among clonal lineages within Escherichia coli O157:H7 stepwise evolutionary model. Emerg. Infect. Dis. 2007, 13, 1701–1706. [Google Scholar] [CrossRef]
- Trabulsi, L.R.; Keller, R.; Tardelli Gomes, T.A. Typical and atypical enteropathogenic Escherichia coli. Emerg. Infect. Dis. 2002, 8, 508–513. [Google Scholar] [CrossRef] [PubMed]
- McDaniel, T.K.; Jarvis, K.G.; Donnenberg, M.S.; Kaper, J.B. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 1995, 92, 1664–1668. [Google Scholar] [CrossRef] [PubMed]
- Beutin, L.; Hammerl, J.A.; Reetz, J.; Strauch, E. Shiga toxin-producing Escherichia coli strains from cattle as a source of the stx2a bacteriophages present in enteroaggregative Escherichia coli O104:H4 strains. Int. J. Med. Microbiol. 2013, 303, 595–602. [Google Scholar] [CrossRef] [PubMed]
- Bielaszewska, M.; Mellmann, A.; Zhang, W.; Kock, R.; Fruth, A.; Bauwens, A.; Peters, G.; Karch, H. Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in germany, 2011: A microbiological study. Lancet Infect. Dis. 2011, 11, 671–676. [Google Scholar] [CrossRef] [PubMed]
- Tracing Seeds, in Particular Fenugreek (Trigonella Foenum-Graecum) Seeds, in Relation to the Shiga Toxin-Producing E. coli (stec) O104: H4 2011 Outbreaks in Germany and France; European Food Safety Authority: Parma, Italy, 2011.
- Morabito, S.; Karch, H.; Mariani-Kurkdjian, P.; Schmidt, H.; Minelli, F.; Bingen, E.; Caprioli, A. Enteroaggregative, Shiga toxin-producing Escherichia coli o111:H2 associated with an outbreak of hemolytic-uremic syndrome. J. Clin. Microbiol. 1998, 36, 840–842. [Google Scholar] [PubMed]
- Tozzoli, R.; Grande, L.; Michelacci, V.; Ranieri, P.; Maugliani, A.; Caprioli, A.; Morabito, S. Shiga toxin-converting phages and the emergence of new pathogenic Escherichia coli: A world in motion. Front. Cell. Infect. Microbiol. 2014, 4. [Google Scholar] [CrossRef]
- Dopfer, D.; Sekse, C.; Beutin, L.; Solheim, H.; van der Wal, F.J.; de Boer, A.; Slettemeas, J.S.; Wasteson, Y.; Urdahl, A.M. Pathogenic potential and horizontal gene transfer in ovine gastrointestinal Escherichia coli. J. Appl. Microbiol. 2010, 108, 1552–1562. [Google Scholar] [CrossRef] [PubMed]
- Imamovic, L.; Jofre, J.; Schmidt, H.; Serra-Moreno, R.; Muniesa, M. Phage-mediated Shiga toxin 2 gene transfer in food and water. Appl. Environ. Microbiol. 2009, 75, 1764–1768. [Google Scholar] [CrossRef] [PubMed]
- Sekse, C.; Solheim, H.; Urdahl, A.M.; Wasteson, Y. Is lack of susceptible recipients in the intestinal environment the limiting factor for transduction of Shiga toxin-encoding phages? J. Appl. Microbiol. 2008, 105, 1114–1120. [Google Scholar] [CrossRef] [PubMed]
- Loukiadis, E.; Kerouredan, M.; Beutin, L.; Oswald, E.; Brugere, H. Characterization of Shiga toxin gene (stx)-positive and intimin gene (eae)-positive Escherichia coli isolates from wastewater of slaughterhouses in France. Appl. Environ. microbiol. 2006, 72, 3245–3251. [Google Scholar] [CrossRef] [PubMed]
- Bonardi, S.; Foni, E.; Maggi, E. Comparison of vero cell assay, polymerase chain reaction and an enzyme immunoassay for identification of verocytotoxin-producing Escherichia coli O157:H7. New Microbiol. 2000, 23, 47–53. [Google Scholar] [PubMed]
- Beutin, L.; Steinruck, H.; Krause, G.; Steege, K.; Haby, S.; Hultsch, G.; Appel, B. Comparative evaluation of the ridascreen verotoxin enzyme immunoassay for detection of Shiga-toxin producing strains of Escherichia coli (STEC) from food and other sources. J. Appl. Microbiol. 2007, 102, 630–639. [Google Scholar] [CrossRef] [PubMed]
- Michelacci, V.; Tozzoli, R.; Caprioli, A.; Martinez, R.; Scheutz, F.; Grande, L.; Sanchez, S.; Morabito, S. A new pathogenicity island carrying an allelic variant of the subtilase cytotoxin is common among Shiga toxin producing Escherichia coli of human and ovine origin. Clin. Microbiol. Infect. 2013, 19, 149–156. [Google Scholar] [CrossRef]
- Chigor, V.N.; Umoh, V.J.; Smith, S.I. Occurrence of Escherichia coli O157 in river used for fresh produce irrigation in nigeria. Afr. J. Biotechnol. 2010, 9, 178–182. [Google Scholar]
- Nafarnda, W.D.; Ajayi, I.E.; Shawulu, J.C.; Kawe, M.S.; Omeiza, G.K.; Sani, N.A.; Tenuche, O.Z.; Dantong, D.D.; Tags, S.Z. Bacteriological quality of abattoir effluents discharged into water bodies in Abuja, Nigeria. ISRN Vet. Sci. 2012. [Google Scholar] [CrossRef]
- Boisen, N.; Scheutz, F.; Rasko, D.A.; Redman, J.C.; Persson, S.; Simon, J.; Kotloff, K.L.; Levine, M.M.; Sow, S.; Tamboura, B.; et al. Genomic characterization of enteroaggregative Escherichia coli from children in Mali. J. Infect. Dis. 2012, 205, 431–444. [Google Scholar] [CrossRef]
- Harrington, S.M.; Dudley, E.G.; Nataro, J.P. Pathogenesis of enteroaggregative Escherichia coli infection. FEMS Microbiol. Lett. 2006, 254, 12–18. [Google Scholar] [CrossRef] [PubMed]
- Uber, A.P.; Trabulsi, L.R.; Irino, K.; Beutin, L.; Ghilardi, A.C.; Gomes, T.A.; Liberatore, A.M.; de Castro, A.F.; Elias, W.P. Enteroaggregative Escherichia coli from humans and animals differ in major phenotypical traits and virulence genes. FEMS Microbiol. Lett. 2006, 256, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Auvray, F.; Dilasser, F.; Bibbal, D.; Kerouredan, M.; Oswald, E.; Brugere, H. French cattle is not a reservoir of the highly virulent enteroaggregative Shiga toxin-producing Escherichia coli of serotype O104:H4. Vet. Microbiol. 2012, 158, 443–445. [Google Scholar] [CrossRef] [PubMed]
- Bibbal, D.; Kerouredan, M.; Loukiadis, E.; Scheutz, F.; Oswald, E.; Brugere, H. Slaughterhouse effluent discharges into rivers not responsible for environmental occurrence of enteroaggregative Escherichia coli. Vet. Microbiol. 2014, 168, 451–454. [Google Scholar] [CrossRef] [PubMed]
- Bello, M.; Lawan, M.K.; Kwaga, J.K.; Raji, M.A. Assessment of carcass contamination with E. coli O157 before and after washing with water at abattoirs in Nigeria. Int. J. Food Microbiol. 2011, 150, 184–186. [Google Scholar] [CrossRef] [PubMed]
- Brzuszkiewicz, E.; Thurmer, A.; Schuldes, J.; Leimbach, A.; Liesegang, H.; Meyer, F.D.; Boelter, J.; Petersen, H.; Gottschalk, G.; Daniel, R. Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in germany reveal the emergence of a new pathotype: Entero-aggregative-haemorrhagic Escherichia coli (EAHEC). Arch. Microbiol. 2011, 193, 883–891. [Google Scholar] [CrossRef] [PubMed]
- Mortimore, M.J. Zaria and its regions. Ann. Assoc. Am. Geogr. 1970, 60, 73–80. [Google Scholar]
- Useh, N.M.; Ibrahim, N.D.; Nok, A.J.; Esievo, K.A. Relationship between outbreaks of blackleg in cattle and annual rainfall in Zaria, Nigeria. Vet. Record 2006, 158, 100–101. [Google Scholar] [CrossRef]
- Jalil, K.; Vadood, R.; Abolfazi, B. Isolation of Escherichia coli O157:H7 from manure fertilized farms and raw vegetables grown on it, in Tabriz city in Iran. Afr. J. Microbiol. Res. 2010, 4, 891–895. [Google Scholar]
- Barrow, G.I.; Feltham, R.K.A. Cowan and Steel’s Manual for Identification of Medical Bacteria, 3rd ed.; Cambridge University Press: London, UK, 1993. [Google Scholar]
- Caprioli, A.; Luzzi, I.; Rosmini, F.; Resti, C.; Edefonti, A.; Perfumo, F.; Farina, C.; Goglio, A.; Gianviti, A.; Rizzoni, G. Community-wide outbreak of hemolytic-uremic syndrome associated with non-O157 verocytotoxin-producing Escherichia coli. J. Infect. Dis. 1994, 169, 208–211. [Google Scholar] [CrossRef] [PubMed]
- Paton, A.W.; Paton, J.C. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex pcr assays for stx1, stx2, EAEA, enterohemorrhagic E. coli hlya, rfbo111, and rfbo157. J. Clin. Microbiol. 1998, 36, 598–602. [Google Scholar] [PubMed]
- Schmidt, H.; Knop, C.; Franke, S.; Aleksic, S.; Heesemann, J.; Karch, H. Development of PCR for screening of enteroaggregative Escherichia coli. J. Clin. Microbiol. 1995, 33, 701–705. [Google Scholar] [PubMed]
- Paton, A.W.; Srimanote, P.; Talbot, U.M.; Wang, H.; Paton, J.C. A new family of potent ab(5) cytotoxins produced by Shiga toxigenic Escherichia coli. J. Exp. Med. 2004, 200, 35–46. [Google Scholar] [CrossRef] [PubMed]
- Luscher, D.; Altwegg, M. Detection of shigellae, enteroinvasive and enterotoxigenic Escherichia coli using the polymerase chain reaction (PCR) in patients returning from tropical countries. Mol. Cell. Probes 1994, 8, 285–290. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Gratz, J.; Amour, C.; Kibiki, G.; Becker, S.; Janaki, L.; Verweij, J.J.; Taniuchi, M.; Sobuz, S.U.; Haque, R.; et al. A laboratory-developed taqman array card for simultaneous detection of 19 enteropathogens. J. Clin. Microbiol. 2013, 51, 472–480. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kabiru, L.M.; Bello, M.; Kabir, J.; Grande, L.; Morabito, S. Detection of Pathogenic Escherichia coli in Samples Collected at an Abattoir in Zaria, Nigeria and at Different Points in the Surrounding Environment. Int. J. Environ. Res. Public Health 2015, 12, 679-691. https://doi.org/10.3390/ijerph120100679
Kabiru LM, Bello M, Kabir J, Grande L, Morabito S. Detection of Pathogenic Escherichia coli in Samples Collected at an Abattoir in Zaria, Nigeria and at Different Points in the Surrounding Environment. International Journal of Environmental Research and Public Health. 2015; 12(1):679-691. https://doi.org/10.3390/ijerph120100679
Chicago/Turabian StyleKabiru, Lawan Mohammed, Mohammed Bello, Junaid Kabir, Laura Grande, and Stefano Morabito. 2015. "Detection of Pathogenic Escherichia coli in Samples Collected at an Abattoir in Zaria, Nigeria and at Different Points in the Surrounding Environment" International Journal of Environmental Research and Public Health 12, no. 1: 679-691. https://doi.org/10.3390/ijerph120100679