Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Data Analysis
4. Conclusions
Acknowledgments
References
- George, M.J.; Muthu, M.S. On the occurrence of Metapenaeopsis barbata (De Haan) (Decapoda: Penaeidae) in Indian Waters with taxonomic notes on the genus. J. Mar. Boil. Ass. Inida 1968, 10, 286–291. [Google Scholar]
- Wu, C.C. Survey of shrimp in Taiwan Strait and biological studies of thick shell shrimp (Metapenaeopsis barbata). Bull. Taiwan Fish. Res. Inst 1984, 37, 67–82. [Google Scholar]
- Chan, T.Y. Shrimps and Prawns. FAO Species Identification Guide for Fishery Purposes. In The Living Marine Resources of the Western-Central Pacific; Carpenter, K.E., Niem, V.H., Eds.; Food and Agriculture Organization of the United Nations: Rome, Italy, 1998; Volume 2, pp. 851–971. [Google Scholar]
- Wu, C.C. Studies on the shrimp fishery and their fishing ground in Taiwan. Bull. Taiwan Fish. Res. Inst 1985, 39, 169–197. [Google Scholar]
- Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Growth and mortality of the red-spot prawn (Metapenaeopsis barbata) in the northeastern coast off Taiwan. J. Fish. Soc. Taiwan 2005, 32, 229–238. [Google Scholar]
- Fisheries Agency Council of Agriculture, Executive Yuan, Taiwan. 2010 Annual Report. Available online: http://www.fa.gov.tw accessed on 24 February 2012.
- Dall, W.; Hill, J.; Rothlisberg, P.C.; Staples, D.J. The Biology of Penaeidae. In Advances in Marine Biology; Blaxter, J.H.S., Southward, A.J., Eds.; Academic: New York, NY, USA, 1990; Volume 27. [Google Scholar]
- Tzeng, T.D.; Yeh, S.Y. Growth parameters of red-spot shrimp, Metapenaeopsis barbata, from the adjacent waters off Taichung harbor. J. Fish. Soc. Taiwan 1995, 22, 53–68. [Google Scholar]
- Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Comparison of multivariate allometric coefficients in red-spot prawn (Metapenaeopsis barbata) from adjacent waters off Taiwan. J. Fish. Soc. Taiwan 1998, 25, 85–92. [Google Scholar]
- Tzeng, T.D.; Chiu, C.S.; Yeh, S.Y. Morphometric variation in red-spot prawn (Metapenaeopsis barbata) in different geographic waters off Taiwan. Fish. Res 2001, 53, 211–217. [Google Scholar]
- Chu, T.J.; Wang, D.; Haung, H.L.; Lin, F.J.; Tzeng, T.D. Genetic variations and expansion of whiskered velvet shrimp (Metapenaeopsis barbata) off China and Taiwan inferred from intron sequence. Biochem. Syst. Ecol 2011, 39, 520–525. [Google Scholar]
- Chu, T.J.; Wang, D.; Haung, H.L.; Lin, F.J.; Tzeng, T.D. Population structure and historical demography of the whiskered velvet shrimp (Metapenaeopsis barbata) off China and Taiwan inferred from the mitochondrial control region. Zool. Stud 2012, 51, 99–107. [Google Scholar]
- Pettay, D.T.; LaJeunesse, T.C. Microsatellite loci for assessing genetic diversity, dispersal and clonality of coral symbionts in “stress-tolerant” Clade D Symbiodinium. Mol. Ecol. Resour 2009, 9, 1022–1025. [Google Scholar]
- Ma, H.Y.; Bi, J.Z.; Shao, C.W.; Chen, Y.; Miao, G.D.; Chen, S.L. Development of 40 microsatellite markers in spotted halibut (Verasper variegatus) and the cross-species amplification in barfin flounder (Verasper moseri). Anim. Genet 2009, 40, 576–578. [Google Scholar]
- Guyomard, R.; Mauger, S.; Tabet-Canale, K.; Martineau, S.; Genet, C.; Krieg, F.; Quillet, E. A Type I and Type II microsatellite linkage map of Rainbow trout (Oncorhynchus mykiss) with presumptive coverage of all chromosome arms. BMC Genomics 2006, 7. [Google Scholar] [CrossRef]
- Zhang, T.; Kong, J.; Wang, W.; Wang, Q. Genetic variability assessed by microsatellites in the breeding populations of the shrimp Penaeus (Fenneropenaeus) chinensis in China. Aquaculture 2010, 310, 229–233. [Google Scholar]
- McDonald, G.J.; Danzmann, R.G.; Ferguson, M.M. Relatedness determination in the absence of pedigree information in three cultured strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 2004, 233, 65–78. [Google Scholar]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed; ColdSpring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Lunt, D.H.; Hutchinson, W.F.; Carvalho, G.R. An efficient method for PCR-based isolation of microsatellite arrays (PIMA). Mol. Ecol 1999, 8, 891–893. [Google Scholar]
- Chiang, T.Y.; Lee, T.W.; Lin, F.J.; Huang, K.H.; Lin, H.D. Isolation and characterization of microsatellite loci in the endangered freshwater fish Varicorhinus alticorpus (Cyprinidae). Conserv. Genet 2008, 9, 1399–1401. [Google Scholar]
- Cifarelli, R.A.; Gallitelli, M.; Cellini, F. Random amplified hybridization microsatellites (Rahm)—Isolation of a new class of microsatellite-containing DNA clones. Nucleic Acids Res 1995, 23, 3802–3803. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ USA, 2000; pp. 365–386. [Google Scholar]
- Coombs, J.A.; Letcher, B.H.; Nislow, K.H. CREATE: A software to create input files from diploid genotype data for 52 genetic software programs. Mol. Ecol. Resour 2008, 8, 578–580. [Google Scholar]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Res 2010, 10, 564–567. [Google Scholar]
- Raymond, M.; Rousset, F. Genepop (Version-1.2) population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Weir, B.S.; Cockerham, C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar]
- Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
Locus | Primer sequence(5′ to 3′) | Repeat motif | Size range (bp) | Tm °C |
---|---|---|---|---|
MIMB01 | F: CAATCGCGCCTCTTACACTT | (CA)9 | 147~161 | 54 |
R: GGCAAAAAGAATGGTAATTGGT | ||||
MIMB02 | F: TCTATATGTGTGTCCGCGTGT | (TG)9 | 168~182 | 54 |
R: CATGTTCAGTATGATGTGTCTATCG | ||||
MIMB03 | F: AAAACAACGATTTCCAAACAGAA | (TC)12 | 204~218 | 57 |
R: TGAAAATTGCGAATTTCCTTT | ||||
MIMB04 | F: TGATTGCGAAGGTCATCAAG | (CT)15 | 180~200 | 50 |
R: TGAAAGGAAAGATTCGAGGAGA | ||||
MIMB05 | F: AGTTAACAGCCTCCGGGAACTCC | (AT)8 | 175~193 | 50 |
R: GGACAAGAGGCAGGTACATAG | ||||
MIMB06 | F: TTTAATGTGTATTGCGGTCTCC | (GT)11 | 149~155 | 60 |
R: CATACACACACGCAGGACATAG | ||||
MIMB07 | F TGCTGGACCTTTGGGTTTATAG | (GT)10 | 240~252 | 60 |
R: CATACAAGCACACGCACAAATA | ||||
MIMB08 | F TGGAGGAGATTGGGAGATTG | (GT)10 | 201~205 | 54 |
R: GAATTCGATTGACCGCTTGT |
Taichung | Fujian | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NA | AR | HO | HE | PHW | FIS | PFIS | NA | AR | HO | HE | PHW | FIS | PFIS | |
MIMB01 | 3 | 2.905 | 0.381 | 0.431 | 0.70352 | 0.118 | 0.074 | 3 | 2.860 | 0.300 | 0.303 | 1.00000 | 0.010 | 0.012 |
MIMB02 | 3 | 2.905 | 0.381 | 0.431 | 0.70033 | 0.118 | 0.074 | 3 | 2.487 | 0.205 | 0.303 | 0.07629 | 0.325 | 0.183 |
MIMB03 | 2 | 1.905 | 0.048 | 0.048 | 1.00000 | 0.000 | 0.000 | 3 | 2.929 | 0.500 | 0.482 | 0.18053 | −0.038 | 0.061 |
MIMB04 | 3 | 3.000 | 0.286 | 0.429 | 0.06301 | 0.339 | 0.345 | 3 | 2.890 | 0.324 | 0.419 | 0.17474 | 0.228 | 0.139 |
MIMB05 | 4 | 4.000 | 0.474 | 0.667 | 0.17390 | 0.296 | 0.381 | 4 | 3.998 | 0.538 | 0.654 | 0.21398 | 0.179 | 0.125 |
MIMB06 | 3 | 3.000 | 0.476 | 0.563 | 0.07654 | 0.158 | 0.358 | 3 | 2.890 | 0.324 | 0.405 | 0.35083 | 0.201 | 0.102 |
MIMB07 | 3 | 3.000 | 0.333 | 0.424 | 0.15270 | 0.218 | 0.070 | 4 | 3.510 | 0.229 | 0.283 | 0.13777 | 0.195 | 0.109 |
MIMB08 | 3 | 3.000 | 0.238 | 0.368 | 0.08563 | 0.359 | 0.408 | 3 | 2.974 | 0.225 | 0.289 | 0.05880 | 0.223 | 0.234 |
mean | 3.00 | 2.964 | 0.327 | 0.420 | 1.0000 | 0.226 | 0.0392 | 3.25 | 3.067 | 0.331 | 0.392 | 0.9966 | 0.158 | 0.0476 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Chiang, T.-Y.; Tzeng, T.-D.; Lin, H.-D.; Cho, C.-J.; Lin, F.-J. Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA). Int. J. Mol. Sci. 2012, 13, 2763-2768. https://doi.org/10.3390/ijms13032763
Chiang T-Y, Tzeng T-D, Lin H-D, Cho C-J, Lin F-J. Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA). International Journal of Molecular Sciences. 2012; 13(3):2763-2768. https://doi.org/10.3390/ijms13032763
Chicago/Turabian StyleChiang, Tzen-Yuh, Tzong-Der Tzeng, Hung-Du Lin, Ching-Ju Cho, and Feng-Jiau Lin. 2012. "Isolation and Characterization of Polymorphic Microsatellite Loci from Metapenaeopsis barbata Using PCR-Based Isolation of Microsatellite Arrays (PIMA)" International Journal of Molecular Sciences 13, no. 3: 2763-2768. https://doi.org/10.3390/ijms13032763