The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm
Abstract
:1. Introduction
2. Results and Conclusions
2.1. The Gene Expression Levels of Transcription Factors after Treatment by DA and Specific siRNA
2.2. Effects of DA and Silence of BmRel/BmRelish on the Genes Expressions
2.3. Discussion
3. Materials and Methods
3.1. Cells and Culture
3.2. Destruxin A and Treatment
3.3. Gene RNAi Silence
3.4. Combination Treatment of Gene RNAi Silence and DA
3.5. Survey of Gene Expression
3.6. Data Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Kershaw, M.J.; Moorhouse, E.R.; Bateman, R.; Reynolds, S.E.; Charnley, A.K. The role of destruxins in the pathogenicity of Metarhizium anisopliae for three species of insect. J. Invertebr. Pathol. 1999, 74, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Pedras, M.S.C.; Zaharia, L.I.; Ward, D.E. The destruxins: Synthesis, biosynthesis, biotransformation, and biological activity. Phytochemistry 2002, 59, 579–596. [Google Scholar] [CrossRef]
- Liu, B.L.; Tzeng, Y.M. Development and applications of destruxins: A review. Biotechnol. Adv. 2012, 30, 1242–1254. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.R.; Hu, Q.B.; Yu, X.Q.; Ren, S.X. Effects of destruxins on free calcium and hydrogen ions in insect hemocytes. Insect Sci. 2014, 21, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Vey, A.; Matha, V.; Dumas, C. Effects of the peptide mycotoxin destruxin E on insect haemocytes and on dynamics and efficiency of the multicellular immune reaction. J. Invertebr. Pathol. 2002, 80, 177–187. [Google Scholar] [CrossRef]
- Pal, S.; Leger, R.J.S.; Wu, L.P. Fungal peptide destruxin a plays a specific role in suppressing the innate immune response in Drosophila melanogaster. J. Biol. Chem. 2007, 282, 8969–8977. [Google Scholar] [CrossRef] [PubMed]
- He, G.W.; Hu, W.N.; Hu, Q.B. Toxicity of destruxins against four insect cell lines. Chin. J. Appl. Entomol. 2015, 52, 1466–1473. [Google Scholar]
- Gong, L.; Chen, X.R.; Liu, C.L.; Hu, Q.B. Gene expression profile of Bombyx mori hemocyte under the stress of destruxin A. PLoS ONE 2014, 9, e96170. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.M.; Chu, Y.; Zhao, Z.W.; An, C.J. Progress in the mechanisms of the innate immune responses in insects. Acta Entomol. Sinica 2012, 55, 1221–1229. [Google Scholar]
- Chu, Y.; Zhou, F.; Zhang, M.M.; An, C.J. Frontiers of research on the innate immune response in insects. Chin. J. Appl. Entomol. 2013, 50, 311–320. [Google Scholar]
- Tanaka, H.; Ishibashi, J.; Fujita, K.; Nakajima, Y.; Sagisaka, A.; Tomimoto, K.; Suzuki, N.; Yoshiyama, M.; Kaneko, Y.; Iwasaki, T.; et al. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori. Insect Biochem. Mol. Biol. 2008, 38, 1087–1110. [Google Scholar] [CrossRef] [PubMed]
- Suetsugu, Y.; Futahashi, R.; Kanamori, H.; Kadono-Okuda, K.; Sasanuma, S.; Narukawa, J.; Ajimura, M.; Namiki, N.; Shimomura, M.; Sezutsu, H.; et al. Large scale full-length cDNA sequencing reveals a unique genomic landscape in a Lepidopteran model insect, Bombyx mori. G3-Genes Genoms Genet. 2013, 3, 1481–1492. [Google Scholar] [CrossRef] [PubMed]
- Zoladek, T.; Vaduva, G.; Hunter, L.A.; Boguta, M.; Go, B.D.; Martin, N.C.; Hopper, A.K. Mutations altering the mitochondrial-cytoplasmic distribution of Mod5p implicate the actin cytoskeleton and mRNA 3’ ends and/or protein synthesis in mitochondrial delivery. Mol. Cell. Biol. 1995, 15, 6884–6894. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.Y.; Cai, M. The EH-domain-containing protein Pan1 is required for normal organization of the actin cytoskeleton in Saccharomyces cerevisiae. Mol. Cell. Biol. 1996, 16, 4897–4914. [Google Scholar] [CrossRef] [PubMed]
- Kaminska, J.; Wysocka, K.M.; Smaczynska-de, R.I.; Rytka, J.; Żołądek, T. Pan1p, an actin cytoskeleton-associated protein, is required for growth of yeast on oleate medium. Exp. Cell Res. 2005, 310, 482–492. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P. Serine Protease Inhibitors in the Silkworm Bombyx mori; Southwest University: Chongqing, China, 2008. [Google Scholar]
- Hedstrom, L. Serine protease mechanism and specificity. Chem. Rev. 2002, 102, 4501–4524. [Google Scholar] [CrossRef] [PubMed]
- Madala, P.K.; Tyndall, J.D.; Nall, T.; Fairlie, D.P. Update 1 of: Proteases universally recognize beta strands in their active sites. Chem. Rev. 2010, 110, PR1–PR31. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y. Construction and Analysis of Suppression Substractive Hybridization cDNA Library from Midguts of Bombyx mori Infected with Nosema bombycis; Chongqing Normal University: Chongqing, China, 2013. [Google Scholar]
- McNeil, M.; Darvill, A.G.; Fry, S.C.; Albersheim, P. Structure and function of primary cell walls of plants. Ann. Rev. Biochem. 1984, 53, 625–663. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.B.; Ren, S.X.; Wu, J.H.; Chang, J.M.; Musa, P.D. Investigation of destruxin A and B from 80 Metarhizium starins in China, and the optimization of cultural conditions for the strain MaQ10. Toxicon 2006, 48, 491–498. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DELTADELTACT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 2002–2007. [Google Scholar] [CrossRef]
- Sample Availability: Samples of the compound, destruxin A is available from the authors.
Target Gene | siRNA Sequence |
---|---|
BmRel | 5’-GCAAACGAGACGAGACCUUTT-3’ |
3’-TTCGUUUGCUCUGCUCUGGAA-5’ | |
BmRelish1 | 5’-GCAGUUCCCGAAUCUGCAATT-3’ |
3’-TTCGUCAAGGGCUUAGACGUU-5’ | |
BmRelish2 | 5’-CCCAUUGAAAUGACUUGAATT-3’ |
3’-TTGGGUAACUUUACUGAACUU-5’ |
Gene | Primer (5’→3’) |
---|---|
BmRelish1 | F: CCTGGAAAATGTCTGCCGATAA |
R: ATGCCGTCTAGTGCCGTGCT | |
BmRelish2 | F: AGCAGTTATGCGTTTCGGTTTG |
R: AATGCTGCCACCCACCTTG | |
BmRel | F: AATGACCCCAATCAACCTAACG |
R: CGGAATCTGAGGGCTTTGC | |
Bm_nscaf2838_045 (GeneBank access NO. KY379951) | F: CCTGCCATTGTTGAAGGTGC |
R: GAGGGTCTCGGGAAGAGTGA | |
Bm_nscaf2674_066 (GeneBank access NO. KY379952) | F: GTGTATCTGACGGCAACCTC |
R: ATGTCATTGGCATTGCTCTT | |
Bm_nscaf2767_133 (GeneBank access NO. KY379953) | F: GTTGAGGACATTGCCGAAGA |
R: ACCAACAATTACGGGCTTGA | |
GAPDH (reference gene) | F: ATGTTTGTTGTGGGTGTTA |
R:GTAGAGGCAGGAATGATT |
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, W.; He, G.; Wang, J.; Hu, Q. The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm. Molecules 2017, 22, 41. https://doi.org/10.3390/molecules22010041
Hu W, He G, Wang J, Hu Q. The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm. Molecules. 2017; 22(1):41. https://doi.org/10.3390/molecules22010041
Chicago/Turabian StyleHu, Weina, Guangwei He, Jingjing Wang, and Qiongbo Hu. 2017. "The Effects of Destruxin A on Relish and Rel Gene Regulation to the Suspected Immune-Related Genes of Silkworm" Molecules 22, no. 1: 41. https://doi.org/10.3390/molecules22010041