Phytoparasitic Nematodes of Musa spp. with Emphasis on Sources of Genetic Resistance: A Systematic Review
Abstract
:1. Introduction
2. Results
2.1. Study Screening
2.2. Bibliometric Analysis
2.3. Places of Origin
2.4. Evaluation Tools and Methods
2.5. Sources of Resistance
2.6. Gene Expression Analysis
3. Discussion
3.1. Study Screening and Places of Origin
3.2. Evaluation Tools and Methods
3.3. Sources of Resistance
3.4. Gene Expression Analysis
3.5. Final Considerations, Limitations, and Future Perspectives
4. Materials and Methods
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chabi, M.C.; Dassou, A.G.; Dossou-Aminon, I.; Ogouchoro, D.; Aman, B.O.; Dansi, A. Banana and plantain production systems in Benin: Ethnobotanical investigation, varietal diversity, pests, and implications for better production. J. Ethnobiol. Ethnomed. 2018, 14, 78. [Google Scholar] [CrossRef] [PubMed]
- Ntui, V.O.; Tripathi, J.N.; Tripathi, L. Robust CRISPR/Cas9 mediated genome editing tool for banana and plantain (Musa spp.). Curr. Plant Biol. 2020, 21, 100128. [Google Scholar] [CrossRef]
- Adeniji, T.; Tenkouano, A.; Ezurike, J.; Ariyo, C.; Vroh-Bi, I. Value-adding post harvest processing of cooking bananas (Musa spp. AAB and ABB genome groups). Afr. J. Biotechnol. 2010, 9, 9135–9141. [Google Scholar]
- Viljoen, A.; Mostert, D.; Chiconela, T.; Beukes, I.; Fraser, C.; Dwyer, J.; Murray, H.; Amisse, J.; Matabuana, E.L.; Tazan, G.; et al. Occurrence and spread of the banana fungus Fusarium oxysporum f. sp. cubense TR4 in Mozambique. S. Afr. J. Sci. 2020, 116, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Rocha, A.D.J.; Soares, J.M.D.S.; Nascimento, F.D.S.; Santos, A.S.; Amorim, V.B.D.O.; Ferreira, C.F.; Haddad, F.; Santos-Serejo, J.A.D.; Amorim, E.P. Improvements in the Resistance of the Banana Species to Fusarium Wilt: A Systematic Review of Methods and Perspectives. J. Fungi 2021, 7, 249. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, L.; Ntui, V.O.; Tripathi, J.N. Application of genetic modification and genome editing for developing climate-smart banana. Food Energy Secur. 2019, 8, e00168. [Google Scholar] [CrossRef]
- FAO. Banana Market Review—Preliminary Results 2022. In Food and Agriculture Organization of the United Nations Banana Market Review Report, Rome, Italy. 2022. Available online: https://openknowledge.fao.org/server/api/core/bitstreams/3960b1b8-6cef-4ea0-b046-7b3d007bf724/content (accessed on 26 August 2022).
- Tripathi, L.; Tripathi, J.N.; Tushemereirwe, W.K. Strategies for resistance to bacterial wilt disease of bananas through genetic engineering. Afr. J. Biotechnol. 2004, 3, 688–692. [Google Scholar]
- Addy, H.S.; Azizi, N.F.; Mihardjo, P.A. Detection of Bacterial Wilt Pathogen and Isolation of Its Bacteriophage from Banana in Lumajang Area, Indonesia. Int. J. Agron. 2016, 2016, 5164846. [Google Scholar] [CrossRef]
- Studholme, D.J.; Wicker, E.; Abrare, S.M.; Aspin, A.; Bogdanove, A.; Broders, K.; Dubrow, Z.; Grant, M.; Jones, J.B.; Karamura, G.; et al. Transfer of Xanthomonas campestris pv. arecae and X. campestris pv. musacearum to X. vasicola (Vauterin) as X. vasicola pv. arecae comb. nov. and X. vasicola pv. musacearum comb. nov. and Description of X. vasicola pv. vasculorum pv. nov. Phytopathology 2020, 110, 1153–1160. [Google Scholar] [CrossRef]
- Dita, M.; Barquero, M.; Heck, D.; Mizubuti, E.S.G.; Staver, C.P. Fusarium Wilt of Banana: Current Knowledge on Epidemiology and Research Needs Toward Sustainable Disease Management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef]
- Arinaitwe, I.K.; Teo, C.H.; Kayat, F.; Tumuhimbise, R.; Uwimana, B.; Kubiriba, J.; Swennen, R.; Harikrishna, J.A.; Othman, R.Y. Evaluation of banana germplasm and genetic analysis of an F1 population for resistance to Fusarium oxysporum f. sp. cubense race 1. Euphytica 2019, 215, 175. [Google Scholar] [CrossRef] [PubMed]
- Gonçalves, Z.S.; Haddad, F.; De Oliveira Amorim, V.B.; Ferreira, C.F.; De Oliveira, S.A.S.; Amorim, E.P. Agronomic characterization and identification of banana genotypes resistant to Fusarium wilt race 1. Eur. J. Plant Pathol. 2019, 155, 1093–1103. [Google Scholar] [CrossRef]
- Sánchez Timm, E.; Hidalgo Pardo, L.; Pacheco Coello, R.; Chávez Navarrete, T.; Navarrete Villegas, O.; Santos Ordóñez, E. Identification of Differentially-Expressed Genes in Response to Mycosphaerella fijiensis in the Resistant Musa Accession ‘Calcutta-4’ Using Suppression Subtractive Hybridization. PLoS ONE 2016, 11, e0160083. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, F.D.S.; Sousa, Y.M.; Rocha, A.D.J.; Ferreira, C.F.; Haddad, F.; Amorim, E.P. Sources of black Sigatoka resistance in wild banana diploids. Rev. Bras. Frutic. 2020, 42, e-038. [Google Scholar] [CrossRef]
- Soares, J.M.S.; Rocha, A.J.; Nascimento, F.S.; Santos, A.S.; Miller, R.N.G.; Ferreira, C.F.; Haddad, F.; Amorim, V.B.O.; Amorim, E.P. Genetic Improvement for Resistance to Black Sigatoka in Bananas: A Systematic Review. Front. Plant Sci. 2021, 12, 657916. [Google Scholar] [CrossRef]
- Seenivasan, N. Identification of burrowing nematode (Radopholus similis) resistance in banana (Musa spp.) genotypes for natural and challenge inoculated populations. Arch. Phytopathol. Plant Prot. 2017, 50, 415–437. [Google Scholar] [CrossRef]
- Monteiro, J.D.M.S.; Santos, J.R.P.; Cares, J.E.; Marchão, R.L.; Amorim, E.P.; Costa, D.D.C. Identification of plant parasitic nematodes in triploid and tetraploid bananas in Brazil. Rev. Caatinga 2020, 33, 865–877. [Google Scholar] [CrossRef]
- Famina, C.C.; Usman, A.; Nasser, M.K.M. Prevalence and densities of banana nematodes in Kondotty-local Government Area, Kerala State, India. Pak. J. Nematol. 2017, 35, 175–182. [Google Scholar] [CrossRef]
- Luquini, L.; Barbosa, D.; Haddad, F.; Ferreira, C.F.; Amorim, E.P. Nematode survey and biochemical characterization of Meloidogyne spp. in a main banana production area in Brazil. Crop Prot. 2019, 117, 94–99. [Google Scholar] [CrossRef]
- Das, S.C.; Balamohan, T.N.; Poornima, K.; Velalazan, R.; Seenivasan, N. Breeding and evaluation of Musa hybrids to the spiral nematode, Helicotylenchus multicinctus. Indian J. Genet. 2014, 74, 56–63. [Google Scholar] [CrossRef]
- Sankar, C.; Soorianathasundaram, K.; Kumar, N.; Sivakumar, M. Identification of resistance and biochemical changes against Radopholus similis in banana hybrids under pot culture conditions. Bioscan 2017, 12, 331–340. [Google Scholar]
- Tripathi, L.; Babirye, A.; Roderick, H.; Tripathi, J.N.; Changa, C.; Urwin, P.E.; Tushemereirwe, W.K.; Coyne, D.; Atkinson, H.J. Field resistance of transgenic plantain to nematodes has potential for future African food security. Sci. Rep. 2015, 5, 8127. [Google Scholar] [CrossRef]
- Speijer, P.R.; De Waele, D.; Fogain, R. Screening of Musa Germoplasm for Resistance and Tolerance to Nematodes, 2nd ed.; IPGRI: Rome, Italy, 1997; p. 47. [Google Scholar]
- Backiyarani, S.; Uma, S.; Arunkumar, G.; Saraswathi, M.S.; Sundararaju, P. Differentially expressed genes in incompatible interactions of Pratylenchus coffeae with Musa using suppression subtractive hybridization. Physiol. Mol. Plant Pathol. 2014, 86, 11–18. [Google Scholar] [CrossRef]
- Rocha, A.D.J.; Ferreira, M.D.S.; Rocha, L.D.S.; Oliveira, S.A.S.; Amorim, E.P.; Mizubuti, E.S.G.; Haddad, F. Interaction between Fusarium oxysporum f. sp. cubense and Radopholus similis can lead to changes in the resistance of banana cultivars to Fusarium wilt. Eur. J. Plant Pathol. 2020, 158, 403–417. [Google Scholar] [CrossRef]
- Das, S.C.; Balamohan, T.; Poornima, K.; Seenivasan, N. Screening of Musa hybrids for resistance to Pratylenchus coffeae. Indian J. Horticuture 2013, 70, 350–356. [Google Scholar]
- Santos, J.R.P.; Teixeira, M.A.; Costa, D.C.; Silva, S.O.; Faleiro, F.G.; Cares, J.E. Selection of Musa genotypes for resistance to Radopholus similis cobb. Nematropica 2013, 43, 1–8. [Google Scholar]
- Sankar, C.; Soorianathasundaram, K.; Kumar, N.; Karunakaran, G.; Sivakumar, M. Evaluation of Host Plant Resistance to Meloidogyne incognita in Banana Hybrids. IRJPAC 2020, 21, 221–228. [Google Scholar] [CrossRef]
- Speijer, P.R.; Ssango, F. Evaluation of Musa host plant response using nematode densities and damage indices. Nematropica 1999, 29, 185–192. [Google Scholar]
- Seenivasan, N. Phytochemical profiling of burrowing nematode (Radopholus similis) resistant and susceptible banana (Musa spp.) genotypes for detection of marker compounds. Fruits 2018, 73, 48–59. [Google Scholar] [CrossRef]
- Forghani, F.; Hajihassani, A. Recent Advances in the Development of Environmentally Benign Treatments to Control Root-Knot Nematodes. Front. Plant Sci. 2020, 11, 1125. [Google Scholar] [CrossRef]
- De Waele, D. Plant resistance to nematodes in other crops: Relevant research that may be applicable to Musa. In New Frontiers in Resistance Breeding for Nematodes, Fusarium and Sigatoka; Frison, E., Horry, J.P., De Waele, D., Eds.; INIBAP: Montpellier, France, 1996; pp. 108–115. [Google Scholar]
- Quénéhervé, P.; Salmon, F.; Topart, P.; Horry, J.P. Nematode resistance in bananas: Screening results on some new Mycosphaerella resistant banana hybrids. Euphytica 2009, 165, 137–143. [Google Scholar] [CrossRef]
- Heslop-Harrison, J.S.; Schwarzacher, T. Domestication, Genomics and the Future for Banana. Ann. Bot. 2007, 100, 1073–1084. [Google Scholar] [CrossRef] [PubMed]
- Backiyarani, S.; Chandrasekar, A.; Uma, S.; Saraswathi, M.S. MusatransSSRDB (a transcriptome derived SSR database)—An advanced tool for banana improvement. J. Biosci. 2019, 44, 4. [Google Scholar] [CrossRef]
- Angelotti-Mendonça, J.; Koltun, A.; de Oliveira, F.F.; Volpi, N. Genome editing: Propelling the next generation of crop improvement. Colloq. Agrar. 2021, 17, 83–101. [Google Scholar] [CrossRef]
- Pinochet, J. Nematode problems in Musa spp. Pathotypes of Radopholus similis and breeding for resistance. In Proceedings of the A Workshop on Nematodes and Borer Weevil in Banana, Bujumbura, Burundi, 7–11 December 1988; INIBAP: Montypellier, France, 1988; pp. 66–70. [Google Scholar]
- Das, S.C.; Balamohan, T.N.; Poornima, K.; Seenivasan, N.; Seenivasan, R.; Van den Bergh, I.; De Waele, D. Screening of banana hybrids (phase II hybrids) for resistance to Helicotylenchus multicinctus. India J. Nematol. 2014, 44, 9–16. [Google Scholar] [CrossRef]
- Seenivasan, N. Nematostatic activity of root extracts of banana (Musa spp.) genotypes as pre-infectional resistance mechanism against the burrowing nematode, Radopholus similis. J. Hortic. Sci. Biotechnol. 2019, 94, 49–62. [Google Scholar] [CrossRef]
- Araya, M.; De Waele, D. Reaction of six Musa genotypes to root-parasitic nematodes. Int. J. Pest Manag. 2011, 57, 229–238. [Google Scholar] [CrossRef]
- Sankar, C.; Soorianathasundaram, K.; Kumar, N.; Karunakaran, G.; Sivakumar, M. Evaluation of Banana Hybrids Against Burrowing Nematodes, Radopholus similis. Indian J. Nematol. 2017, 47, 209–221. [Google Scholar]
- Roderick, H.; Tripathi, L.; Babirye, A.; Wang, D.; Tripathi, J.; Urwin, P.E.; Atkinson, H.J. Generation of transgenic plantain ( Musa spp.) with resistance to plant pathogenic nematodes. Mol. Plant Pathol. 2012, 13, 842–851. [Google Scholar] [CrossRef]
- Onyango, S.O.; Roderick, H.; Tripathi, J.N.; Collins, R.; Atkinson, H.J.; Oduor, R.O.; Tripathi, L. The ZmRCP-1 promoter of maize provides root tip specific expression of transgenes in plantain. J. Biol. Res.-Thessalon. 2016, 23, 4. [Google Scholar] [CrossRef]
- Das, S.C.; Balamohan, T.N.; Poornima, K.; Velalaza, R.; Seenivasan, N. Screening of banana hybrids for resistance to Meloidogyne incognita. India J. Nematol. 2011, 41, 189–196. [Google Scholar]
- Das, S.C.; Balamohan, T.N.; Poornima, K.; Velalazan, R.; Seenivasan, N.; Van Den Bergh, I. Reaction of Banana Hybrids (Phase-II) for Resistance to Meloidogyne incognita. Int. J. Agric. Environ. Biotechnol. 2013, 6, 563. [Google Scholar] [CrossRef]
- Das, S.C.; Balamohan, T.N.; Poornima, K.; Seenivasan, N.; Velalazan, R.; Van Den Bergh, I.; De Waele, D. Screening of banana hybrids (phase II hybrids) for resistance to Meloidogyne Incognita. Acta Hortic. 2014, 41, 29–36. [Google Scholar] [CrossRef]
- Afifi, E.H.; Zawam, H.S. In vitro mutation for resistance to nematode in banana plants. Egypt. J. Plant Breed. 2019, 23, 103–113. [Google Scholar]
- Peraza-Padilla, W.; Artavia-Carmona, R.; Arboleda-Julio, E.; Rodríguez-Porras, R.; Orozco-Cayasso, S. Plant-parasitic nematodes associated with plantain (Musa paradisiaca) in Talamanca, Limón, Costa Rica. Nematropica 2020, 50, 151–159. [Google Scholar]
- Dhakshinamoorthy, S.; Mariama, K.; Elsen, A.; De Waele, D. Phenols and lignin are involved in the defence response of banana (Musa) plants to Radopholus similis infection. Nematology 2014, 16, 565–576. [Google Scholar] [CrossRef]
- Roderick, H.; Mbiru, E.; Coyne, D.; Tripathi, L.; Atkinson, H.J. Quantitative Digital Imaging of Banana Growth Suppression by Plant Parasitic Nematodes. PLoS ONE 2012, 7, e53355. [Google Scholar] [CrossRef] [PubMed]
- Vásquez Tirado, E.; Cabrales Herrera, E. Identification and Economic Importance of Banana Phytoparasitic Nematodes in Antioquia Uraba, Colombia. Athens J. Sci. 2020, 7, 77–88. [Google Scholar] [CrossRef]
- Mostafa, R.G.; El-Zawahry, A.M.; Khalil, A.E.M.; Elfarash, A.E.; Allam, A.D.A. Community Analysis of Nematodes Associated with Banana, Identification of root knot nematode and Evaluation the Susceptibility of Some Cultivars to Infection. Res. Sq. 2021; preprint. [Google Scholar] [CrossRef]
- Lara-Posadas, S.V.; Núñez-Sánchez, Á.E.; López-Lima, D.; Carrión, G. Nematodos fitoparásitos asociados a raíces de plátano (Musa acuminata AA) en el centro de Veracruz, México. Rev. Mex. Fitopatol. 2016, 34, 116–130. [Google Scholar] [CrossRef]
- Nimisha, A.M.; Nisha, M.S. Community analysis of nematodes associated with different varieties of Banana in Kerala, India. Indian J. Nematol. 2019, 49, 165–172. [Google Scholar]
- Roy, K.; Roy, S.; Sarkar, S.; Rathod, A.; Pramanik, A. Diversity of migratory nematode endoparasites of banana. J. Crop Weed 2014, 10, 375–391. [Google Scholar]
- Luambano, N.D.; Kashando, B.E.; Masunga, M.M.; Mwenisongole, A.E.; Mziray, M.F.; Mbaga, J.E.; Polini, R.M.; Mgonja, D.M. Status of Pratylenchus coffeae in banana-growing areas of Tanzania. Physiol. Mol. Plant Pathol. 2019, 105, 102–109. [Google Scholar] [CrossRef] [PubMed]
- Plowright, R.; Dusabe, J.; Coyne, D.; Speijer, P. Analysis of the pathogenic variability and genetic diversity of the plant-parasitic nematode Radopholus similis on bananas. Nematology 2013, 15, 41–56. [Google Scholar] [CrossRef]
- Mwaka, H.S.; Bauters, L.; Namaganda, J.; Marcou, S.; Bwesigye, P.N.; Kubiriba, J.; Smagghe, G.; Tushemereirwe, W.K.; Gheysen, G. Transgenic East African Highland Banana Plants Are Protected against Radopholus similis through Host-Delivered RNAi. Int. J. Mol. Sci. 2023, 24, 12126. [Google Scholar] [CrossRef] [PubMed]
- Hölscher, D.; Dhakshinamoorthy, S.; Alexandrov, T.; Becker, M.; Bretschneider, T.; Buerkert, A.; Crecelius, A.C.; De Waele, D.; Elsen, A.; Heckel, D.G.; et al. Phenalenone-type phytoalexins mediate resistance of banana plants (Musa spp.) to the burrowing nematode Radopholus similis. Proc. Natl. Acad. Sci. USA 2014, 111, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Herradura, L.E.; Adelfa, M.; Lobres, N.; De Waele, D.; Davide, R.G.; Van Den Bergh, I. Host response of Southeast Asian Musa genotypes to Radopholus similis. Int. J. Nematol. 2011, 21, 225–234. [Google Scholar]
- Dochez, C.; Dusabe, J.; Tenkouano, A.; Ortiz, R.; Whyte, J.; De Waele, D. Screening Musa germplasm for resistance to burrowing nematode populations from Uganda. Genet. Resour. Crop Evol. 2013, 60, 367–375. [Google Scholar] [CrossRef]
- Santos, J.R.P.; Faleiro, F.G.; Costa, D.D.C.; Amorim, E.P.; Silva, S.D.O.E.; Cares, J.E. Banana horizontal and vertical resistance to the burrowing nematode depends on the level of aggressiveness or virulence of the nematode population. Rev. Bras. Frutic. 2023, 45, e-070. [Google Scholar] [CrossRef]
- Mayil Vaganan, M.; Ravi, I.; Nandakumar, A.; Sarumathi, S.; Sundararaju, P.; Mustaffa, M.M. Phenylpropanoid enzymes, phenolic polymers and metabolites as chemical defenses to infection of Pratylenchus coffeae in roots of resistant and susceptible bananas (Musa spp.). Indian J. Exp. Biol. 2014, 52, 252–260. [Google Scholar]
- Ramesh Kumar, A.; Kumar, N.; Poornima, K.; Soorianathasundaram, K. Screening of in vitro derived mutants of banana against nematodes. Afr. J. Biotechnol. 2012, 11, 15451–15456. [Google Scholar] [CrossRef]
- Quénéhervé, P.; Godefroid, M.; Topart, P.; Marie-Luce, S.; Salmon, F.; Marie, P.; Chabrier, C. Differential responses to plant-feeding nematodes among sibling cultivars of dessert bananas (Cavendish subgroup) and a synthetic hybrid. Crop Prot. 2012, 42, 30–35. [Google Scholar] [CrossRef]
- Backiyarani, S.; Uma, S.; Arunkumar, G.; Saraswathi, M.S.; Sundararaju, P. Cloning and characterization of NBS-LRR resistance gene analogues of Musa spp. and their expression profiling studies against Pratylenchus coffeae. Afr. J. Biotechnol. 2013, 12, 4256–4268. [Google Scholar] [CrossRef]
- Vawa, O.S.T.; Otchoumou, A.; Adiko, A.; Gnonhouri, G.P. Host Status of Plantain Hybrids FHIA 21 and PITA 3 for Populations of Radopholus similis and Pratylenchus coffeae in Côte D’ivoire. Greener J. Agric. Sci. 2016, 6, 262–271. [Google Scholar] [CrossRef]
- Herradura, L.E.; Lobres, M.A.N.; De Waele, D.; Davide, R.G.; Van Den Bergh, I. Yield response of four popular banana varieties from southeast Asia to infection with a population of Radopholus similis from Davao, Philippines. Nematology 2012, 14, 889–897. [Google Scholar] [CrossRef]
- Backiyarani, S.; Uma, S.; Sundararaju, P.; Mayilvaganan, M.; Saraswathi, M.S.; Arunkumar, G. Time course expression studies during Musa—Pratylenchus coffeae interaction. Indian J. Hortic. 2013, 70, 217–222. [Google Scholar]
- Backiyarani, S.; Uma, S.; Nithya, S.; Chandrasekar, A.; Saraswathi, M.S.; Thangavelu, R.; Mayilvaganan, M.; Sundararaju, P.; Singh, N.K. Genome-Wide Analysis and Differential Expression of Chitinases in Banana Against Root Lesion Nematode (Pratylenchus coffeae) and Eumusa Leaf Spot (Mycosphaerella eumusae) Pathogens. Appl. Biochem. Biotechnol. 2015, 175, 3585–3598. [Google Scholar] [CrossRef]
- Kaliyappan, R.; Viswanathan, S.; Suthanthiram, B.; Subbaraya, U.; Marimuthu Somasundram, S.; Muthu, M. Evolutionary Expansion of WRKY Gene Family in Banana and Its Expression Profile during the Infection of Root Lesion Nematode, Pratylenchus coffeae. PLoS ONE 2016, 11, e0162013. [Google Scholar] [CrossRef]
- Muthusamy, M.; Uma, S.; Suthanthiram, B.; Saraswathi, M.S.; Chandrasekar, A. Genome-wide identification of novel, long non-coding RNAs responsive to Mycosphaerella eumusae and Pratylenchus coffeae infections and their differential expression patterns in disease-resistant and sensitive banana cultivars. Plant Biotechnol. 2019, 13, 73–83. [Google Scholar] [CrossRef]
- Rocha, L.D.S.; Santana, R.F.D.; Soares, A.C.F.; Haddad, F. Reaction of banana cultivars to the Meloidogyne javanica X Fusarium oxysporum f. sp. cubense complex. Rev. Caatinga 2018, 31, 572–583. [Google Scholar] [CrossRef]
- Das, S.C.; Balamohan, T.; Poornima, K.; Seenivasan, N. Reaction of Musa hybrids to Fusarium wilt and Radopholus similis, burrowing nematode complex. Indian J. Hortic. 2014, 71, 16–22. [Google Scholar]
- Castañeda, N.E.N.; Alves, G.S.C.; Almeida, R.M.; Amorim, E.P.; Fortes Ferreira, C.; Togawa, R.C.; Costa, M.M.D.C.; Grynberg, P.; Santos, J.R.P.; Cares, J.E.; et al. Gene expression analysis in Musa acuminata during compatible interactions with Meloidogyne incognita. Ann. Bot. 2017, 119, 915–930. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, G.; Khan, A.; Khan, A.A.; Ali, A.; Mohhamad, H.I. Biological control: A novel strategy for the control of the plant parasitic nematodes. Antonie Van Leeuwenhoek 2021, 114, 885–912. [Google Scholar] [CrossRef] [PubMed]
- Odala, A.A.; Ramanathan, R.A.; Arerath, U. Plant parasitic nematode communities associated with the crop banana (Musa spp.) at Attappady Tribal hill area, India. Not. Sci. Biol. 2020, 12, 608–618. [Google Scholar] [CrossRef]
- FAOSTAT. Food and Agriculture Organization of the United Nations. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 4 June 2022).
- Araya, M.; De Waele, D. Spatial distribution of nematodes in three banana (Musa AAA) root parts considering two root thickness in three farm management systems. Acta Oecologica 2004, 26, 137–148. [Google Scholar] [CrossRef]
- Famina, C.C.; Usman, A.; Mohamed Nasser, K.M. Comparative study on the host susceptibility of different banana cultivars to plant parasitic nematodes in Malappuram district of Kerala, India. Arch. Phytopathol. Plant Prot. 2019, 52, 407–416. [Google Scholar] [CrossRef]
- Rahman, S.A.; Zain, S.N.M.; Mat, M.Z.B.; Sidam, A.K.; Othman, R.Y.; Mohamed, Z. Population Distribution of Plant-parasitic Nematodes of Bananas in Peninsular Malaysia. Sains Malays. 2014, 43, 175–183. [Google Scholar]
- Demesyeux, L.; Mendes, M.L.; Crow, W.T.; Chambers, A.H. Plant-parasitic nematodes associated with banana cultivars in southern Florida. Nematropica 2020, 50, 19–28. [Google Scholar]
- Lima, R.D.S.; Muniz, M.; Castro, J.D.C.; de Oliveira, E.R.L.; de Oliveira, P.G.; de Siqueira, K.M.S.; Machado, A.C.Z.; da Costa, J.G. Frequencies and population densities of the major phytonematodes associated with banana in the state of Alagoas, Brazil. Nematropica 2013, 43, 186–193. [Google Scholar]
- Kosma, P.; Zachée, A.; Dider, B.; Martijn, H.; Jean, K.; Akoa, A. Evaluation of the sensitivity of two plantain varieties essong and big ebanga to the nematode Radopholus similis. Afr. J. Biotechnol. 2012, 11, 14755–14769. [Google Scholar] [CrossRef]
- Bridge, J. Plant nematode pests of banana in east africa with particular reference to tanzania. In Proceedings of the INIBAP 1988. Nematodes and the Borer Weevil in Bananas: Present Status of Research and Outlook, Bujumbura, Burundi, 7–11 December 1987; INBAP: Montpellier, France, 1988; pp. 35–39. [Google Scholar]
- Sundararaju, P. Nematode pests of banana and their management. Souvenir. In Proceedings of the Conference on Challenges of Banana Production and Utilization in First Century, Trichy, India, 24–25 September 1996; Volume 24, pp. 17–19. [Google Scholar]
- International Network for the Improvement of Banana and Plantain; Carlier, J.; De Waele, D.; Escalant, J.V.; Vézina, A.; Picq, C. (Eds.) Global Evaluation of Musa Germplasm for Resistance to Fusarium Wilt, Mycosphaerella Leaf Spot Diseases and Nematodes: In-Depth Evaluation; INIBAP Technical Guidelines n. 6, 64 p; The International Network for the Improvement of Banana and Plantain: Montpellier, France, 2002. [Google Scholar]
- Abd-Elgawad, M.M.M. Optimizing Sampling and Extraction Methods for Plant-Parasitic and Entomopathogenic Nematodes. Plants 2021, 10, 629. [Google Scholar] [CrossRef]
- Ortiz, R.; Swennen, R. From crossbreeding to biotechnology-facilitated improvement of banana and plantain. Biotechnol. Adv. 2014, 32, 158–169. [Google Scholar] [CrossRef] [PubMed]
- Vidhyasekaran, P. Defense genes for crop disease management. In Engineering Genetics, Tissue Culture and Molecular Biology for Pest and Disease Management; Vidhyasekaran, P., Ed.; Daya Publishing House: Nova Deli, India, 1993; pp. 17–30. [Google Scholar]
- Simmonds, N.W.; Shepherd, K. The taxonomy and origins of the cultivated bananas. J. Linn. Soc. Lond. Bot. 1955, 55, 302–312. [Google Scholar] [CrossRef]
- Zhang, J.; Sun, X. Recent advances in polyphenol oxidase-mediated plant stress responses. Phytochemistry 2021, 181, 112588. [Google Scholar] [CrossRef] [PubMed]
- Smant, G.; Jones, J. Suppression of Plant Defences by Nematodes. In Genomics and Molecular Genetics of Plant-Nematode Interactions; Jones, J., Gheysen, G., Fenoll, C., Eds.; Springer: Dordrecht, The Netherlands, 2011; pp. 273–286. [Google Scholar] [CrossRef]
- Rajendram, A.; Mostaffa, N.H.; Dumin, W.; Oke, M.A.; Simarani, K.; Somasundram, C.; Razali, Z.; Rejab, N.A.; Al-Idrus, A. Dual activity of Meloidogyne incognita-regulated Musa acuminata Pathogenesis-related-10 (MaPR-10) gene. Gene 2022, 809, 146041. [Google Scholar] [CrossRef] [PubMed]
- Al-Idrus, A.; Carpentier, S.C.; Ahmad, M.T.; Panis, B.; Mohamed, Z. Elucidation of the compatible interaction between banana and Meloidogyne incognita via high-throughput proteome profiling. PLoS ONE 2017, 12, e0178438. [Google Scholar] [CrossRef] [PubMed]
- Santos, C.M.D.C.; Pimenta, C.A.D.M.; Nobre, M.R.C. The PICO strategy for the research question construction and evidence search. Rev. Lat. Am. Enferm. 2007, 15, 508–511. [Google Scholar] [CrossRef] [PubMed]
- Van Eck, N.J.; Waltman, L. Software survey: VOSviewer, a computer program for bibliometric mapping. Scientometrics 2010, 84, 523–538. [Google Scholar] [CrossRef]
- Moher, D.; Liberati, A.; Tetzlaff, J.; Altman, D.G. The PRISMA Group. Preferred Reporting Items for Systematic Reviews and Meta-Analyses: The PRISMA Statement. PLoS Med. 2009, 6, e1000097. [Google Scholar] [CrossRef]
Plant Response | Root Lesion Index (%) | Corm Grade |
---|---|---|
Immune | 0 | 0 |
Resistance | <10 | <1 |
Tolerant | 10–20 | 1–2 |
Susceptible | 20–40 | 2–4 |
Highly susceptible | >40 | >4 |
Root Extration Method | Article | Nematode |
---|---|---|
Macerated roots in a blender followed by sieving | [17,40] | Radopholus similis |
[41] | Radopholus similis, Helicotylenchus spp., Meloidogyne spp., Pratilenchus spp. | |
[49] | Pratylenchus spp., Helicotylenchus spp., Meloidogyne spp., Radopholus spp. | |
[21,39] | Helicotylenchus multicinctus | |
[27] | Pratilenchus coffeae | |
Counting of females and juveniles after staining the roots with acid lactophenol fuchsin | [29,45,46,47] | Meloidogyne incognita |
Manual dissection of the lesioned roots | [50] | Radopholus similis |
Roots in polypropylene bags submerged in 1% H2O2 | [44] | Radopholus similis and mixed population (R. similis, H. multicinctus, M. incognita) |
[43] | Radopholus similis | |
Macerated roots in a blender and extraction using the Baermann technique | [23,42] | Radopholus similis and mixed population (H. multicinctus; Meloidogyne spp.) |
[51] | Radopholus similis, Helicotylenchus multicinctus, Meloidogyne spp. | |
Sifting and centrifugation with sucrose solution | [52] | Radopholus spp., Helicotylenchus spp., Meloidogyne spp. |
Modified Baermann method and staining with acid fuchsin | [53] | Meloidogyne javanica, Rotylenchulus reniformis, Helicotylenchus spp.; Pratylenchus spp. |
Maceration, flotation and centrifugation technique. And Maceration in sodium hypochlorite (NaOCL), flotation and centrifugation technique | [54] | Helicotylenchus multicinctus, Meloidogyne spp., Pratylenchus goodeyi, Radopholus similis |
Modified Baermann technique | [55] | Radopholus similis, Pratylenchus coffeae, Meloidogyne incognita, Rotylenchus reniformis, Helicotylenchus dihystera and others |
[56] | Radopholus similis, Pratylenchus spp., Helicotylenchus multicinctus | |
[57] | Pratylenchus coffeae | |
[58] | Helicotylenchus multicintus, Pratylenchus goodeyi, Radopholus similis, Meloidogyne spp. | |
[59] | Radopholus similis |
Musa Germoplasm | Musa Genome | Level of Tolerance or Resistence | Nematode | Article |
---|---|---|---|---|
Yangambi Km5 | AAA | PR | Radopholus similis | [28] |
Yangambi Km5 | AAA | R | Radopholus similis | [17,22,29,31,40,41,42,50,60,61,62,63] |
Yangambi Km5 | AAA | T | Pratylenchus coffeae | [64] |
Yangambi Km5 | AAA | T | Meloidogyne incognita | [29] |
Pisang Lilin | AA | R | Radopholus similis | [17,22,31,40,65] |
Pisang Lilin | AA | R | Pratylenchus coffeae | [27,55] |
Pisang Lilin | AA | R | Helicotylenchus multicinctus | [21,39] |
Pisang Lilin | AA | R | Meloidogyne incognita | [45,46,47] |
Ro Im V4 6-1-1 | AAA | R | Radopholus similis, Pratylenchus coffeae | [55] |
Si Im V4 10-5-3 | AAA | R | Radopholus similis, Pratylenchus coffeae | [55] |
Anaikomban | AA | T | Radopholus similis, Pratylenchus coffeae | [55] |
Anaikomban | AA | R | Pratylenchus coffeae | [64] |
Anaikomban | AA | R | Radopholus similis | [17,22,40] |
FB920 | AAA | T | Radopholus similis, Pratylenchus coffeae | [66] |
MA13 | AAA | T | Radopholus similis, Pratylenchus coffeae | [66] |
Pisang Jari Buaya | AA | R | Radopholus similis | [17,40,41] |
Pisang Jari Buaya | AA | R | Helicotylenchus spp. | [41] |
FHIA-23 | AAA | R | Radopholus similis | [41] |
Valery | AAA | R | Helicotylenchus spp. | [41] |
Manoranjitham | AAA | R | Radopholus similis | [17,40] |
Rose | AA | R | Radopholus similis | [17,22,40,67] |
Matti | AA | R | Radopholus similis | [17,40] |
Hatitat | ||||
Pisang Mas | AB | T | Radopholus similis | [17,40] |
Veneettu Kunnan | AB | R | Radopholus similis | [17,40] |
Then Kunnan | AB | T | Radopholus similis | [17,40] |
Gros Michel | AAA | T | Radopholus similis | [17,40] |
Williams | ||||
Red Banana (Mutant) | ||||
Green Red | ||||
Agneeswar | ||||
4279-06 | AA | R | Radopholus similis | [28] |
0323-03 | ||||
0337-02 | ||||
4249-05 | AA | HR | Radopholus similis | [28] |
Pisang Pipit | AA | PR | Radopholus similis | [28] |
5854-03 | ||||
1318-01 | ||||
4285-02 | ||||
N118 | ||||
Tjau Lagada | ||||
Calcutá 4 | ||||
1319-01 | ||||
Pa Rayong | ||||
Birmanie | ||||
Vitória | ||||
Thap Maeo | ||||
4223-06 | ||||
Pisang Jaran | ||||
Pisang Nangka | AAAB | PR | Radopholus similis | [28] |
FHIA-21 | AAAB | R | Radopholus similis | [68] |
Kluai Pa 26 | AA | R | Radopholus similis | [61,69] |
K. Nang Nuan | AAB | R | Radopholus similis | [61,69] |
Pisang Papan | AAA | R | Radopholus similis | [61,69] |
Tongat | AA | R | Radopholus similis | [22] |
Tongat | AA | T | Radopholus similis | [17,40] |
TMB2x 9128-3 | AA | R | Radopholus similis | [62] |
Karthobiumtham | AAB | R | Pratylenchus coffeae | [25,36,67,70,71,72,73] |
Long Tavoy | AA | R | Radopholus similis | [50] |
Saba | AAB | R | Radopholus similis | [50] |
Prata-Anã | AAB | MR | Meloidogyne javanica | [74] |
BRS Princesa | AAAB | MR | Meloidogyne javanica | [74] |
BRS Princesa | AAAB | R | Radopholus similis | [26] |
BRS Japira | AAAB | R | Radopholus similis | [26] |
BRS Platina | ||||
Latundan | AAB | PR | Radopholus similis | [69] |
4349-05 | _ | R | Radopholus similis | [63] |
H-11-08 | _ | R | Radopholus similis | [22] |
H-11-21 | ||||
H-11-23 | ||||
H-11-25 | ||||
H-11-36 | ||||
H-11-69 | ||||
H-11- 70 | ||||
H-11-71 | ||||
H-11-76 | ||||
H-11-02 | _ | T | Radopholus similis | [22] |
H-11-03 | ||||
H-11-06 | ||||
H-11-12 | ||||
H-11-18 | ||||
H-11-24 | ||||
H-11-37 | ||||
H-11-49 | ||||
H-11-65 | ||||
H-11-78 | ||||
H201 | ||||
H912 | _ | R | Radophous similis | [42] |
H914 | ||||
H916 | ||||
H926 | ||||
H943 | ||||
H 903 | _ | T | Radophous similis | [42] |
H 906 | ||||
H 913 | ||||
H 915 | ||||
H923 | ||||
H934 | ||||
H939 | ||||
H 904 | _ | T | Radophous similis | [42] |
Meloidogyne incognita | [29] | |||
H 911 | T | Radophous similis | [42] | |
Meloidogyne incognita | [29] | |||
H 952 | T | Radophous similis | [42] | |
Meloidogyne incognita | [29] | |||
H 921 | _ | T | Meloidogyne incognita | [29] |
H 924 | ||||
H 926 | ||||
H 943 | ||||
H516 | AAA | R | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H531 | AAB | R | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H511 | AABB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H534 | AAB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H537 | AABB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H571 | AABB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H572 | AAB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H589 | AABB | T | Meloidogyne incognita | [45] |
Pratylenchus coffeae | [27] | |||
Helicotylenchus multicinctus | [21] | |||
Radophous similis | [75] | |||
H-02-34 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H-02-34 | AABB | T | Helicotylenchus multicinctus | [39] |
H-02-34 | AABB | T | Radophous similis | [75] |
H-03-05 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H-03-05 | AABB | T | Helicotylenchus multicinctus | [39] |
H-03-05 | AABB | T | Radophous similis | [75] |
H-03-13 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H-03-13 | AABB | T | Helicotylenchus multicinctus | [39] |
H-03-13 | AABB | T | Radophous similis | [75] |
H-03-17 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H-03-17 | AABB | T | Helicotylenchus multicinctus | [39] |
H-03-17 | AABB | T | Radophous similis | [75] |
H 04-12 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H 04-12 | AABB | T | Helicotylenchus multicinctus | [39] |
H 04-12 | AABB | T | Radophous similis | [75] |
H- 04-24 | AABB | T | Meloidogyne incognita | [46] |
[47] | ||||
H- 04-24 | AABB | T | Helicotylenchus multicinctus | [39] |
H- 04-24 | AABB | T | Radophous similis | [75] |
NPH-02-01 | AAB | T | Meloidogyne incognita | [46] |
[47] | ||||
NPH-02-01 | AAB | T | Helicotylenchus multicinctus | [39] |
NPH-02-01 | AAB | T | Radophous similis | [75] |
H 510 | AABB | T | Helicotylenchus multicinctus | [39] |
Meloidogyne incognita | [47] |
Tested Genotype | Genes | Sequences of Specific Primer | Nematode | Article | |
---|---|---|---|---|---|
Forward Primer (5′-3′) | Reverse Primer (5′-3′) | ||||
Karthombiumtham and Nendran | AY427192.1 | TGATGTGTGGAATGAGAACGA | CAAGAGCCAGCAATGTTCAA | Pratylenchus coffeae | [67] |
AM931368.1 | CGTGGAGAGGCTTACCAAAG | GCCAACCATTTCTGCAATCT | |||
AM931420.1 | CCTGGAGAGCCTTACGAAAG | GTACTGCGGACCTCAATGGT | |||
AM931401.1 | CCTGGACAGGCTTACCATAC | AACCATGTCGGCAATCTTTC | |||
AF227002.1 | CAAGAGCCAGCAATGTTCAA | GCAGTGATTTGCAAGCCTTA | |||
AM931390.1 | CGTCGGGAGGCTAACCAAAG | CCTGGTTCTCCGTACCTCAA | |||
Karthobiumtham; Nendran; FHIA-1; Anaikkomban; Kunnan; Pisang Jaribuaya; Pisang lilin; Calcutta-4; Yankambi KM-5; Rasthali | poly phenol oxidase (PPO) | GACCGCATGTGGTACTTGTG | GGATCTCGACGTCTTGGTA | Pratylenchus coffeae | [70] |
Karthobiumtham and Nendran | Metallothionein | GGTCAACTCTGAGACCTGA | CCGAGGTACAGGTA GAACAT | Pratylenchus coffeae | [25] |
1,3 Glucanase | GGATGAGACTCTACGATCC | GCCTGATCAAGTTCTGGTTG | |||
Chitinase | AGTCAAGGTGATGCTCTCCATC | TCCGGCGATGTTGAAGTCTATG | |||
Lipoxygenase | TCCACCAGCTCATCAACCAC | TCAGCAGCTTGAAGATGGGG | |||
Cytochrome p450 | AGAGCGACTCACAGACTCGAC | CCGGGCAGGTACTTGTAGG | |||
Peroxidase | TATGCTCACCATTGCTGCTC | TGATTACCATTGCGAGGACA | |||
25S rRNA | ACATTGTCAGGTGGGGAGTT | CCTTTTGTTCCACACGA GATT | |||
Karthobiumtham and Nendran | WRKY52 | TAAGGCGAAGAGGAAGGTGA | TCTCCTGTGTGCATCGGTAG | Pratylenchus coffeae | [72] |
WRKY92 | AAAGCATCAACCCAGCAAAC | ACGGTGCATCGATAATAGGC | |||
WRKY69 | GAACCGGATCTGGATCTCAA | CGTTCTTCCCTTCCTCATCA | |||
WRKY19 | CCAGCTGAATGATCTGACGA | TTGCAATCCTGTCTGACTCG | |||
WRKY41 | ACGCGAATGTTAGCGTCAAT | CGTGAAGGAAGGAACGATGT | |||
WRKY81 | AGACAATCCATGCCCAAGAG | TGACTTGAGGTCAGGTGCTG | |||
Musa acuminata 4297-06 and Grad Naine | CALS7 | CACCCAGAACATGGTATACTTGAAA | GGTCTCAGGCCTCGTCTTTATG | Meloidogyne incognita | [76] |
EXPB11 | TAGCAGCAGGAAGTCCTTCGA | GTCGTTCGTCGTGCACAGAA | |||
ARR18 | CGGATGACGACTCTAGATGCAA | TCGGAGAGGAACACGGAAAA | |||
FBXL13 | TGGAGTACCTCGGCAAGTTTG | GATGAGATCGTCCTCGCTGATAC | |||
EXPA26 | CACCTGGGTGCCGATGAC | AAGGCTCTGCCCCACCAT | |||
TIFY6B | CAACCGATAGAGTCATCCCTGC | AGTGATCGCTTCATCGAGAGCT | |||
ERF4 | CCCAAATGTTGGTCCGTTTC | TCGCTGTCTTCCACGATTCA | |||
BETV1J | CAGCACTACCATTCGGCTACG | CGAAGAGGGTCTGCTTGCAC | |||
APS1 | AAGGTCAAGAAGATTGATAGGATATGTG | GTCTTCTGGGAGGTGACAACAAG | |||
PER68 | CCAAGAAACCACGTAGCAATCA | CAAAATGTGTATGACGTTGGATTCA |
Description | Abbrevion | Question Components |
---|---|---|
Population | P | Phytoparasitic nematodes of banana plants (Musa spp.) |
Interest/Intervention | I | Genetic improvement strategies for nematode resistance |
Comparison | C | Cultural control methods and chemical or other management strategies |
Outcome | O | Tolerance or resistance of banana plants to phytoparasitic Nematodes |
Study design | S | Scientific articles |
Research Questions |
---|
Q1: What are the main nematode species that affect banana and plantain crops? |
Q2: Which cultivars are recognized as resistant to nematodes? |
Q3: Which banana breeding programs are focused on nematode resistance or cross-breeding for the purpose of developing resistant cultivars? |
Q4: Are there any known sources of nematode resistance? |
Q5: Which genes have been reported to be related to nematode resistance? |
Q6: How is germplasm selected? |
Q7: What are the most used methodologies for extracting nematodes from roots? |
Q8: What are the methods for assessing symptoms? |
Q9: What existing tools are used to characterize nematode-resistant plants? Are there any molecular markers? |
Q10: Are there any studies on the topics of gene editing, cisgenics, and transgenics? |
Q11: How often is the banana genome used? |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sousa, A.B.P.; Rocha, A.d.J.; Oliveira, W.D.d.S.; Rocha, L.d.S.; Amorim, E.P. Phytoparasitic Nematodes of Musa spp. with Emphasis on Sources of Genetic Resistance: A Systematic Review. Plants 2024, 13, 1299. https://doi.org/10.3390/plants13101299
Sousa ABP, Rocha AdJ, Oliveira WDdS, Rocha LdS, Amorim EP. Phytoparasitic Nematodes of Musa spp. with Emphasis on Sources of Genetic Resistance: A Systematic Review. Plants. 2024; 13(10):1299. https://doi.org/10.3390/plants13101299
Chicago/Turabian StyleSousa, Amanda Bahiano Passos, Anelita de Jesus Rocha, Wanderley Diaciso dos Santos Oliveira, Leandro de Souza Rocha, and Edson Perito Amorim. 2024. "Phytoparasitic Nematodes of Musa spp. with Emphasis on Sources of Genetic Resistance: A Systematic Review" Plants 13, no. 10: 1299. https://doi.org/10.3390/plants13101299