Tissue engineering has become a promising strategy to overcome the limitations of autologous transplants for therapeutical applications and has grown exponentially in the last two decades. The usual approaches propose to transplant active elements such as cells for gene-therapy, stem cells or proteins within a porous degradable material known as a scaffold. Since stem cells are naturally engrafted in active 3D microenvironments in vivo, current tissue engineering approaches often try to mimic the stem cells niche. Many proposed methods for engineering replacement tissues accurately mimic these microenvironments by culturing stem cells in 3D biomaterial scaffolds. In general, 3D scaffolds provide an appropriate establishment of cell polarity in the environment and possess biochemical and mechanical properties similar to the damaged tissue. Here we obtained cASC under aseptic conditions to be amplified following GMP criteria compatible for clinical use. cASCs were obtained from five different dogs after inguinal fat biopsy. Twenty grams of subcutaneous fat were processed enzymatically (collagenase) washed and centrifuged several times until obtaining a cell concentrate in sterilized conditions. cASC enrichment and expansion, containing autologous serum in the growth medium, was achieved by the use of a Bioreactor with temperature, oxygen and CO₂ controlled (Soluciones Bioregenerativas-Proteal, Barcelona, Spain). A minimum of 30 million cells are delivered within 2 weeks providing a rapid and aseptic method for stem cells production and further use in clinical applications. Two weeks after fat biopsy the concentrated cell suspension was further characterized by using CD90 as a stem cell marker. Flow cytometry analysis showed that half of the population at passage 0 positively reacts to CD90 hybridization (Figure 1a). CD34 (hematopoietic cell marker) hybridized with almost 40% of the remaining cell population (data not shown). Subsequently passages of cASCs in adherent conditions significantly enriched the CD90 positive population up to P5 (Figure 1a). Morphological analysis of cASC after three consecutive passages showed feature correlation and resemblance to mesenchymal stem cells (Figure 1b, upper panels). cASCs obtained from five different dogs were seeded (5 × 10⁵ cells) and counted after three consecutive passages. A consistent and exponentially growing proliferative curve was found for all tested samples in growth medium containing 10% fetal bovine serum (Figure 1b).

The use of PRGF constitutes a source of cell signaling molecules and can contribute to tissue regeneration [11,12], also in combination with stem cells to reduce the time of consolidation in distraction osteogenesis [19]. Since PRGF represents a source of growth factors, it can favor the adhesion and proliferation of mesenchymal stem cells on 3D ceramic scaffolds [20]. However, the benefits of PRGF are still under evaluation since inconsistent results have been reported. This controversy may be caused by individual variation in growth factor concentration in PRGF [21]. We determined the effects of increasing concentrations (1%, 5% and 10%) of PRGF in cASCs proliferation. Confluent cultures were reached when cASCs were treated with 5% PRGF for 24 hours (Figure 2a). Untreated cells and those treated with PRGF (5%) were stained with Giemsa to improve visualization (Figure 2a). Significantly increased proliferation (P ≤ 0.05) of cASCs after treatment with 1%, 5% and 10% PRGF was quantified by MTS assay (Promega, USA) (Figure 2b). Transcriptional expression of the pluripotent markers Nanog, Sox2 and Oct4 was evaluated by semi-quantitative PCR. We detected higher presence of transcripts for all three pluripotent markers when cASCs where treated with 5% PRGF for 24 hours that suggests a higher self-renewal of cASCs (Figure 2c). A cultured supplement composed of 3% human platelet-poor plasma (hPPP) with a cytokine cocktail formed by epidermal growth factor (EGF), basic fibroblast growth factor (bFGF) and platelet-derived growth factor-bb (PDGFbb) improves ASC proliferation more than FBS. The addition of hPRGF to the described supplement or hPRGF alone also increases ASC expansion [10]. In line with these results, we observed that treatment of cASCs with a combination of FBS with PRGF does not change cell viability rates in comparison to those obtained with PRGF alone (Figure 2d). Therefore, our results suggest that growth factors contained in PRGF might be sufficient to improve the yield of cASCs.

To our knowledge, there is a lack of proposals that combine stem cells, scaffolds and the PRGF, an optimal autologous source of growth factors. For instance, dental implants, using tissue engineered bone with natural fibrin scaffolds, stem cells and PRGF alone or in combination was previously proposed in dog [22]. The authors show a significant increase of bone-implant contact in dogs treated with a combination of mesenchymal stem cells, PRGF and fibrin. Fibrin has many advantages as a cell delivery vehicle in terms of biocompatibility, biodegradation and hemostasis [23,24] and can provide a permissive environment for cell growth with increased proliferation and survival of human bone marrow stromal cells in porous scaffolds [25]. This bioactive factor/scaffold has disadvantages when used as scaffolds, such as low rigidity that can produce shrinkage of scaffols and rapid degradation that would not permit proper bone regeneration. Therefore, other proposals suggest the use of fibrin as an adjunt element for sustaining osteogenic capacity of stem cells in mineralized scaffolds [26]. PRGF has also been considered as a natural scaffold [19] with advantages such as flexibility, non toxic, no immune reaction, complete resorption [27,28]. However, the use of PRGF as a gel can present similar disadvantages to fibrin.

A more consistent material such as those formed by synthetic materials might be required for bone regeneration. Pieri and colleagues propose the use of mesenchymal stem cells, platelet-rich plasma and fluorohydroxyapatite (FH) scaffold [29]. In general, FH is a main component of bone mineral and accepted as a bioactive material with biocompatibility with hard tissues [30], despite its low degradation rate, mechanical strength and osteoinductive potential [7,8]. Autologous mesenchymal stem cells loaded onto porous ceramic cylinders of hydroxyaparite (65%) and p-tricalcium phosphate ceramic (35%) promoted faster consolidation of the fracture [31]. No additional growth factor enrichment was performed in this work and the observed high fold increase in the number of mesenchymal stem cells was explained through the culture expansion process. However, this is a time consuming process and porous ceramic presents a load-bearing capacity for stem cells and tends to fracture affected bones in dogs. Adequate cell adhesion to biomaterial implants is critical for a proper cell supply into the hosted tissue. Although porous scaffolds for bone tissue engineering present good biocompatibility and can be integrated with biological cells or molecules to regenerate tissues [32], some synthetic biomaterials need a previous additional modification to allow cell-surface interactions and improve adhesion properties of cells.

Caprolactone 2-(methacryloyloxy) ethyl ester (CLMA), has previously allowed enhanced cellular adhesion and proliferation [17]. CLMA generates scaffolds with controlled porosity for tissue engineering [18] that may favor the integration of stem cells in the damaged tissue that would allow bone regeneration after differentiation. In fact, cASCs are able to adhere to CLMA (Figure 3a–c) without additional modifications of CMLA. cASCs cultured in CMLA were distributed throughout the scaffold and showed positive proliferative activity when treated with PRGF (Figure 3d–f).

cASCs seeded on CMLA and treated with 1% PRGF showed higher yield in comparison to cells cultured on scaffolds without PRGF (Figure 3d,e). Cell proliferation was quantified by counting Phospho-Histone H3 positive cells (mitotic marker) by immunocytochemistry. There were significantly more phospho-histone H3-positive cells in cultures treated with 1% PRGF (Figure 3f).

A biopsy of 20 g of inguinal subcutaneous fat from five owner dogs with EPA (Early Psoriatic Arthritis) and 120 ml of blood were isolated in sterilized conditions and processed by using the kit DogStem^® distributed by Soluciones Bioregenerativas-Proteal (Barcelona, Spain) following its manufacturer instructions. Immediately after sample collection, fat biopsy and blood (in anti-coagulant container) were sent at 4 °C for cell isolation and amplification in GMP conditions. Two weeks after biopsy, we analyzed the isolated and concentrated cells. The cells were maintained in growth medium: DMEM (Life Technologies S.A., Alcobendas, Spain) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/mL penicillin and 100 µg/mL streptomycin at 37 °C, 20% O₂ and 5% CO_2. All cell analysis was performed up to passage 8. All the sample collection was approved and certified by the dog owners with an informed consent.

ASC suspension was assayed for cell surface protein expression by flow cytometry (FC500, Cultek, Madrid, Spain). Cells at passage 0, 1, 3 and 5 were pelleted, resuspended in PBS at a concentration of 10⁵ cells/µL, and stained with 1:50 dilution of CD90 antibody conjugated with PE (BD Pharmigen, New Jersey, USA). Cells were incubated in the dark for 45 min at room temperature and then washed three times with PBS and resuspended in 0.3 mL of cold PBS for FACS analysis. The mean ± S.D. of the 5 different tested samples were determined.

The PRGF, isolated from three different dogs, were prepared following the standardized method previously described by Anitua and collegues [33]. The cell viability and proliferative activity was determined by The CellTiter 96^® AQueous Non-Radioactive Cell Proliferation Assay (Promega Co., Madison, WI, USA) following the manufacturer´s instructions. Briefly, 10⁵ ASC at passages 2–5 were seeded onto 96 well plates and were allowed to grow for 24 hours in growth medium. After removing the growth medium the cells were treated with different concentrations of PRGF: 0%, 1%, 5% or 10% in the presence or absence of 10% FBS and 2 Units/ml of heparin for 24 hours. Every condition was assayed in quadruplicate in three different experiments. The viability of cells at each assayed condition was expressed as the percentage ratio of the mean ± S.D. of colorimetric signal from treated cells in the presence of PRGF in comparison with cells in the absence of PRGF.

The proliferative curves were assayed in growth medium (in the presence of 10% FBS). ASCs (5 × 10⁵) were seeded in 100 cm² petri dishes and every third day trypan blue exclusion cell counting in a neubauer^® chamber was performed up to passage 5. The mean ± S.D. of absolute numbers of viable cells of the 5 different samples was determined.

Total RNA was extracted by using the RNeasy Mini-kit (Qiagen, Germany) according to the manufacturer’s instructions. One µg of total RNA was reverse-transcribed in a total reaction volume of 50 µL at 42 °C for 30 min using random hexamer primers. The semi-quantitative PCR amplification was performed on a thermal cycler (Eppendorf, Germany) by using the following program, 3 min of denaturation at 95 °C followed by 30 cycles of 30 seconds at 95 °C, 15 seconds at 60 °C, 60 second at 72 °C and a final extension step at 72 °C for 4 minutes. The following primer sequences were used sequences: Sox2-Fw_5' AGTCTCCAAGCGACGAAA AA; Sox2-Rv_5': GCAAGAAGCCTCTCC TTGAA; Nanog-Fw_5': GAATAACCCGAATTGGAGCAG; Nanog-Rv_5': AGC GAT TCC TCT TCA CAG TTG; Oct4-Fw_5': GAGTGAGAGGCAACCTGGAG; Oct4-Rv_5´: GTGAAGTGAGGG CTCCCATA;GAPDH-Fw_5':CCATCTTCCAGGAGCGAGAT; GAPDH-Rv_5': TTCTCCATGGTG GTGAAGAC. The target gene value was normalized to the expression of the endogenous reference (GAPDH). A negative (without a prior reverse transcription reaction) control was always included. After amplification, 25 µL of each PCR mix was electrophoresed through a 2% (w/v) agarose gel with ethidium bromide (0.1 µg/mL) and visualized under an ultraviolet trans-illuminator (BioRad). The specific bands were analyzed by densitometry and the ratio with GAPDH expression was determined (all PCR amplifications were performed from 4 different experiments).

ASCs were fixed in 4% paraformaldehyde at room temperature for 10 min and washed with PBS before incubating in Giemsa solution (Sigma, St. Louis, MO, USA) for 30 min. The excess stain was removed by subsequent washes with distilled water. The cells were allowed to air dry and then visualized under the microscope.

Poly(methyl methacrylate) (PMMA) microspheres with a diameterof 90 ± 10 mm (Colacryl dp 300) were used as porogens by introducing them between two plates (of a self-built device whose distance could be controlled) and heating at 180 °C for 30 minutes to obtain the first template. This template shows the highest porosity attainable (that will yield the lowest porosity of the scaffold) with classical compaction values of 60%–65% for random mono-sized spherical particles. To obtain scaffolds with controlled porosity, the thickness of the obtained disk was first measured; then the disk was replaced in the mould and compressed at 180 °C for 30 min. The degree of compression was quantified by measuring the reduction in thickness. After cooling the template at room temperature, a mixture of caprolactone 2-(methacryloyloxy) ethyl ester (CLMA, as monomer), benzoin (1 wt %, as initiator) and ethylene glycol dimethacrylate (1 wt %, EGDMA) was introduced in the empty space between the PMMA spheres. The polymerization was carried out up to limiting conversion under a UV radiation source at room temperature. After polymerization took place, the porogen template was removed by Soxhlet extraction with acetone for 48 hours. The porous sample was maintained in Soxhlet with ethanol in order to extract low molecular weight substances for an additional 24 hours. Samples were dried in a vacuum to constant weight before characterization.

Morphological analysis of CLMA scaffolds were examined in a scanning electron microscope Jeol JSM-5410, SEM. All specimens were coated with a conductive layer of sputtered gold. The micrographs were taken at an accelerating voltage of 20 kV in order to ensure a suitable image resolution. When cells were seeded onto CLMA scaffolds before SEM analysis a previous fixation with 2.5% PFA plus 2% glutaraldehyde for 10 min at RT was performed and then dehydrated in graded ethanol concentrations. Critical point dryer (CPD) was performed on an Autosambri 814 instruments (Rockville, MD, USA) followed by sputter coated with gold before observation.

Single cells (5 × 10⁵) were distributed in 2 µL per 2 mm² CLMA scaffold (previously re-hydrated by overnight incubation in cell culture medium at 37 °C) or alone (without scaffold) individually set into 96 well plates, and incubated for 24 hours. Then ASCs were treated with 0 or 5% PRGF for an additional 24 hours in growth medium in the absence of FBS and with 2 Units/ml of heparin. Subsequently, the cells were fixed with 4% paraformaldehyde at room temperature for 10 min and washed with PBS, permeabilized with a PBS solution containing 0.1% Triton X-100 and blocked with 5% goat serum in PBS for 1 h. The following primary antibodies were diluted in blocking solution and incubated overnight at 4 °C. Vimentin (α-mouse, clone V9 Cat. MAB3400; Millipore, Billerica, MA, USA (1:200)) and P-Histone3-Alexa 647 (α-rabbit, Cat. 9716S; Cell Signaling, Boston, USA (1:100)). After being rinsed three times with PBS, the cells were incubated with Oregon Green-Alexa647 dye conjugated goat anti-mouse IgG 1:400 (Life Technologies S.A., Alcobendas, Spain) secondary antibodies for 1 hour at room temperature. All cells were counterstained by incubation with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) from Molecular Probes (Invitrogen, Carlsbad, CA, USA) for 3 min at room temperature followed by washing steps. Samples were mounting using FluorSave Reagent (Calbiochem, Darmstadt, Germany). Signals were visualized by Confocal Microscopy (Leica Microsistemas, Barcelona, Spain). Four different assays were performed and at least 6 different fields per condition and assay were analyzed.

Statistical comparisons were assessed by Student’s t-test. All P values were derived from a two-tailed statistical test using the SPSS 11.5 Software. A P-value < 0.05 was considered statistically significant.