Maternal Daidzein Supplementation during Lactation Promotes Growth Performance, Immunity, and Intestinal Health in Neonatal Rabbits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Housing, and Diets
2.2. Sample Collection
2.3. Serum Hormones and Metabolite Level Analysis
2.4. Serum Immunity and Antioxidant Indices Analysis
2.5. Intestinal Morphology Analysis
2.6. RNA Isolation, cDNA Synthesis, and q-PCR
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Parameters (Hormones, Immunity, Metabolites, and Antioxidants)
3.3. Intestinal Morphology
3.4. Intestinal Barrier Functions’ Gene Expressions
3.5. Intestinal Inflammatory Responses’ Gene Expressions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Castellini, C.; Bosco, A.D.; Arias-Álvarez, M.; Lorenzo, P.L.; Cardinali, R.; Rebollar, P.G. The main factors affecting the reproductive performance of rabbit does: A review. Anim. Reprod. Sci. 2010, 122, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Andoni, E.; Curone, G.; Agradi, S.; Barbato, O.; Menchetti, L.; Vigo, D.; Zelli, R.; Cotozzolo, E.; Ceccarini, M.R.; Faustini, M.; et al. Effect of goji berry (lycium barbarum) supplementation on reproductive performance of rabbit does. Animals 2021, 11, 1672. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, A.; Aponte-Mellado, A.; Premkumar, B.J.; Shaman, A.; Gupta, S. The effects of oxidative stress on female reproduction: A review. Reprod. Biol. Endocrinol. 2012, 10, 49. [Google Scholar] [CrossRef]
- Jabbour, H.N.; Sales, K.J.; Catalano, R.D.; Norman, J.E. Inflammatory pathways in female reproductive health and disease. Reproduction 2009, 138, 903–919. [Google Scholar] [CrossRef]
- Campbell, J.M.; Crenshaw, J.D.; Polo, J. The biological stress of early weaned piglets. J. Anim. Sci. Biotechnol. 2013, 4, 19. [Google Scholar] [CrossRef] [PubMed]
- Archana, V.; Shoshana, Y.; Derek, L.R. The intricate role of growth hormone in metabolism. Front. Endocrinol. 2011, 2, 32. [Google Scholar] [CrossRef]
- Kubota, K.; Cui, W.; Dhakal, P.; Wolfe, M.W.; Rumi, M.A.; Vivian, J.L.; Roby, K.F.; Soares, M.J. Rethinking progesterone regulation of female reproductive cyclicity. Proc. Natl. Acad. Sci. USA 2016, 113, 4212–4217. [Google Scholar] [CrossRef]
- Knight, C.H. Overview of prolactin’s role in farm animal lactation. Livest. Prod. Sci. 2001, 70, 87–93. [Google Scholar] [CrossRef]
- LeRoith, D.; Yakar, S. Mechanisms of disease: Metabolic effects of growth hormone and insulin-like growth factor 1. Nat. Rev. Nephrol. 2007, 3, 302–310. [Google Scholar] [CrossRef]
- Akers, R.M. Major advances associated with hormone and growth factor regulation of mammary growth and lactation in dairy cows. J. Dairy Sci. 2006, 89, 1222–1234. [Google Scholar] [CrossRef]
- Farmer, C. The role of prolactin for mammogenesis and galactopoiesis in swine. Livest. Prod. Sci. 2001, 70, 105–113. [Google Scholar] [CrossRef]
- Morris, D.; Diskin, M. Effect of progesterone on embryo survival. Animal 2008, 2, 1112–1119. [Google Scholar] [CrossRef]
- McGuffey, R.K. A 100-Year Review: Metabolic modifiers in dairy cattle nutrition. J. Dairy Sci. 2017, 100, 10113–10142. [Google Scholar] [CrossRef] [PubMed]
- Conneely, O.M.; Mulac-Jericevic, B.; Arnett-Mansfield, R. Progesterone signaling in mammary gland development. In Progestins and the Mammary Gland; Ernst Schering Foundation Symposium Proceedings book series; Springer: Berlin/Heidelberg, Germany, 2008; pp. 175–185. [Google Scholar] [CrossRef]
- Leung, K.C.; Johannsson, G.; Leong, G.M.; Ho, K.K. Estrogen regulation of growth hormone action. Endoc Rev. 2004, 25, 693–721. [Google Scholar] [CrossRef] [PubMed]
- Findlay, J.K.; Liew, S.H.; Simpson, E.R.; Korach, K.S. Estrogen signaling in the regulation of female reproductive Functions. Handb. Exp. Pharmacol. 2010, 198, 29–35. [Google Scholar] [CrossRef]
- Rietjens, I.; Sotoca, A.M.; Vervoort, J.; Louisse, J. Mechanisms underlying the dualistic mode of action of major soy isoflavones in relation to cell proliferation and cancer risks. Mol. Nutr. Food Res. 2013, 57, 100–113. [Google Scholar] [CrossRef]
- Desmawati, D.; Sulastri, D. Phytoestrogens and their health effects. J. Med. Sci. 2019, 7, 495–499. [Google Scholar] [CrossRef]
- Paterni, I.; Granchi, C.; Katzenellenbogen, J.A.; Minutolo, F. Estrogen receptors alpha (ERα) and beta (ERβ): Subtype-selective ligands and clinical potential. Steroids 2014, 90, 13–29. [Google Scholar] [CrossRef]
- Xie, H.M.; Yu, E.; Wen, H.M.; Jiang, B.Y.; Fu, G.H.; Sun, H.T.; He, J. Effects of dietary daidzein supplementation on reproductive performance, immunity, and antioxidative capacity of New Zealand White does. Anim. Feed Sci. Technol. 2022, 292, 115431. [Google Scholar] [CrossRef]
- Cai, J.; Gu, H.; Shi, S.R.; Tong, H.B. Effects of high-dose daidzein on laying performance, egg quality and antioxidation in laying hens. J. Poult. Sci. 2013, 50, 237–241. [Google Scholar] [CrossRef]
- Kładna, A.; Berczyński, P.; Kruk, I.; Piechowska, T.; Aboul-Enein, H.Y. Studies on the antioxidant properties of some phytoestrogens. Luminescence 2016, 31, 1201–1206. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.Y.; He, S.J.; Jin, E.H.; Liu, S.Q.; Zhong, L.T. Effect of daidzein on production performance and serum antioxidative function in late lactation cows under heat stress. Livest. Sci. 2013, 152, 16–20. [Google Scholar] [CrossRef]
- Xiao, Y.; Mao, X.B.; Yu, B.; He, J.; Yu, J.; Zheng, P.; Huang, Z.Q.; Chen, D.W. Potential risk of isoflavones: Toxicological study of daidzein supplementation in piglets. J. Agric. Food Chem. 2015, 63, 4228–4235. [Google Scholar] [CrossRef] [PubMed]
- Fan, H.; Lv, Z.P.; Gan, L.P.; Guo, Y.M. Transcriptomics-related mechanisms of supplementing laying broiler breeder hens with dietary daidzein to improve the immune function and growth performance of offspring. J. Agric. Food Chem. 2018, 66, 2049–2060. [Google Scholar] [CrossRef]
- Wang, G.L.; Zhang, X.Y.; Han, Z.Y.; Liu, Z.B.; Li, W.R. Effects of daidzein on body weight gain, serum IGF-I level and cellular immune function in intact male piglets. Asian Australas. J. Anim. Sci. 2002, 15, 1066–1070. [Google Scholar] [CrossRef]
- Zhang, Q.Q.; Chen, D.W.; Yu, B.; Mao, X.B.; Huang, Z.Q.; Yu, J.; Luo, J.Q.; Zheng, P.; Luo, Y.; He, J. Effects of Dietary daidzein supplementation on reproductive performance, serum hormones, and reproductive-related genes in rats. Nutrients 2018, 10, 766. [Google Scholar] [CrossRef]
- Li, Y.P.; Jiang, X.R.; Cai, L.; Zhang, Y.L.; Ding, H.B.; Yin, J.D.; Li, X.L. Dietary daidzein supplementeation improved growth performance and antioxidant properties in weaned and growing pigs. Res. Sq. 2021, 1–25. [Google Scholar] [CrossRef]
- Sun, M.Y.; Ye, Y.; Xiao, L.; Rahman, K.; Xia, W.; Zhang, H. Daidzein: A review of pharmacological effects. Afr. J. Tradit. Complement. Altern. Med. 2016, 13, 117–132. [Google Scholar] [CrossRef]
- De Blas, C.; Mateos, G.G. Feed formulation. In Nutrition of the Rabbit; De Blas, J.C., Wiseman, J., Eds.; CAB International: Oxfordshire, UK, 2010; pp. 222–232. ISBN 9781845936693. [Google Scholar]
- Yu, E.; Chen, D.W.; Yu, B.; Huang, Z.Q.; Mao, X.B.; Zheng, P.; Luo, Y.H.; Yin, H.; Yu, J.; Luo, J.Q.; et al. Manno-oligosaccharide attenuates inflammation and intestinal epithelium injury in weaned pigs upon Enterotoxigenic Escherichia Coli K88 challenge. Br. J. Nutr. 2020, 126, 993–1002. [Google Scholar] [CrossRef]
- Wan, J.; Zhang, J.; Chen, D.W.; Yu, B.; Mao, X.B.; Zheng, P.; Yu, J.; Luo, J.Q.; He, J. Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs. J. Anim. Sci. Biotechnol. 2018, 9, 58. [Google Scholar] [CrossRef]
- Fleige, S.; Walf, V.; Huch, S.; Prgomet, C.; Sehm, J.; Pfaffl, M.W. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol. Lett. 2006, 28, 1601–1613. [Google Scholar] [CrossRef] [PubMed]
- Mattsson, C.; Olsson, T. Estrogens and glucocorticoid hormones in adipose tissue metabolism. Curr. Med. Chem. 2007, 14, 1918–2924. [Google Scholar] [CrossRef] [PubMed]
- Homma, H. Estrogen suppresses transcription of lipoprotein lipase gene. Existence of a unique estrogen response element on the lipoprotein lipase promoter. J. Biol. Chem. 2000, 275, 11404. [Google Scholar] [CrossRef] [PubMed]
- Xie, K.H.; Li, Y.; Chen, D.W.; Yu, B.; Luo, Y.H.; Mao, X.B.; Huang, Z.Q.; Yu, J.; Luo, J.Q.; Zheng, P.; et al. Daidzein supplementation enhances embryo survival by improving hormones, antioxidant capacity, and metabolic profiles of amniotic fluid in sows. Food Func. 2020, 11, 10588–10600. [Google Scholar] [CrossRef]
- Liu, M.; Huang, Q.; Yi, X.; Zhang, Y.; Lu, L.; Yun, L.; Geratology, D.O. Effects of estrogen on glucolipid metabolism and cardiac structure of female rats. J. Nanjing Med. Univ. (Nat. Sci.) 2014, 7, 894–897. [Google Scholar]
- Ren, M.Q.; Kuhn, G.; Wegner, J.; Nürnberg, G.; Chen, J.; Ender, K. Feeding daidzein to late pregnant sows influences the estrogen receptor beta and type 1 insulin-like growth factor receptor mRNA expression in newborn piglets. J. Endocrinol. 2001, 170, 129–135. [Google Scholar] [CrossRef]
- Connor, E.E.; Wood, D.L.; Sonstegard, T.S.; da Mota, A.F.; Bennett, G.L.; Williams, J.L.; Capuco, A.V. Chromosomal mapping and quantitative analysis of estrogen-related receptor alpha-1, estrogen receptors alpha and beta and progesterone receptor in the bovine mammary gland. J. Endocrinol. 2005, 185, 593–603. [Google Scholar] [CrossRef]
- Wadhera, R.K.; Steen, D.L.; Khan, I.; Giugliano, R.P.; Foody, J.M. A review of low-density lipoprotein cholesterol, treatment strategies, and its impact on cardiovascular disease morbidity and mortality. J. Clin. Lipidol. 2016, 10, 472–489. [Google Scholar] [CrossRef]
- Schroeder, H.W., Jr.; Cavacini, L. Structure and function of immunoglobulins. J. Allergy Clin. Immunol. 2010, 125, S41–S52. [Google Scholar] [CrossRef]
- Liu, D.Y.; He, S.J.; Liu, S.Q.; Tang, Y.G.; Jin, E.H.; Chen, H.L.; Li, S.H.; Zhong, L.T. Daidzein enhances immune function in late lactation cows under heat stress. Anim. Sci. J. 2014, 85, 85–89. [Google Scholar] [CrossRef]
- Zhao, M.M.; Yao, B.; Wang, J.S.; Liu, Y.; Yu, L.M.; Jiang, Y.M. Immunomodulatory and anticancer activities of flavonoids extracted from litchi (Litchi chinensis Sonn) pericarp. Int. Immunopharmacol. 2007, 7, 162–166. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; He, G.R.; Chen, D.W.; Yu, B.; Yu, J.; Zheng, P.; Huang, Z.Q.; Luo, Y.H.; Luo, J.Q.; Mao, X.B.; et al. Supplementing daidzein in diets improves the reproductive performance, endocrine hormones and antioxidant capacity of multiparous sows. Anim. Nutr. 2021, 7, 1052–1060. [Google Scholar] [CrossRef] [PubMed]
- Yum, M.K.; Jung, M.Y.; Cho, D.; Kim, T.S. Suppression of dendritic cells’ maturation and functions by daidzein, a phytoestrogen. Toxicol. Appl. Pharmacol. 2011, 257, 174–181. [Google Scholar] [CrossRef]
- Yu, E.; Chen, D.W.; Yu, B.; Luo, Y.H.; Zheng, P.; Yin, H.; Mao, X.B.; Huang, Z.Q.; Yu, J.; Luo, J.Q.; et al. Amelioration of enterotoxigenic Escherichia coli-induced disruption of intestinal epithelium by manno-oligosaccharide in weaned pigs. J. Funct. Foods 2021, 82, 104492. [Google Scholar] [CrossRef]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal. Res. 2004, 36, 1–9. [Google Scholar] [CrossRef]
- Rimbach, G.; De Pascual-Teresa, S.; Ewins, B.A.; Matsugo, S.; Uchida, Y.; Minihane, A.M.; Turner, R.; VafeiAdou, K.; Weinberg, P.D. Antioxidant and free radical scavenging activity of isoflavone metabolites. Xenobiotica 2003, 33, 913–925. [Google Scholar] [CrossRef]
- Sun, Z.W.; Li, D.F.; Li, Y.; Chen, D.W.; Yu, J.; Mao, X.B.; Zheng, P.; Luo, Y.H.; Luo, J.Q.; He, J. Effects of dietary daidzein supplementation on growth performance, carcass characteristics, and meat quality in growing-finishing pigs. Anim. Feed. Sci. Technol. 2020, 268, 114591. [Google Scholar] [CrossRef]
- King, M.R.; Morel, P.C.H.; Revell, D.K.; Pluske, J.R.; Birtles, M.J. Dietary bovine colostrum increases villus height and decreases small intestine weight in early-weaned pigs. Asian Australas. J. Anim. Sci. 2008, 21, 567–573. [Google Scholar] [CrossRef]
- Skrzypek, T.; Piedra, J.L.V.; Skrzypek, H.; Kazimierczak, W.; Szymańczyk, S.; Pawlowska, M.; Zabielski, R. Intestinal villi structure during the development of pig and wild boar crossbreed neonates. Livest. Sci. 2007, 109, 38–41. [Google Scholar] [CrossRef]
- Ou, W.H.; Hu, H.B.; Yang, P.; Dai, J.H.; Ai, Q.H.; Zhang, W.B.; Zhang, Y.J.; Mai, K.S. Dietary daidzein improved intestinal health of juvenile turbot in terms of intestinal mucosal barrier function and intestinal microbiota. Fish Shellfish Immunol. 2019, 94, 132–141. [Google Scholar] [CrossRef]
- Kuemmerle, J.F. Insulin-like growth factors in the gastrointestinal tract and liver. Endocrinol. Metab. Clin. N. Am. 2012, 41, 409–423. [Google Scholar] [CrossRef] [PubMed]
- Himpe, E.; Kooijman, R. Insulin-like growth factor-I receptor signal transduction and the janus kinase/signal transducer and activator of transcription (JAK-STAT) pathway. Biofactors 2009, 35, 76–81. [Google Scholar] [CrossRef] [PubMed]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef]
- Kuligowski, M.; Sobkowiak, D.; Polanowska, K.; Jasińska-Kuligowska, I. Effect of different processing methods on isoflavone content in soybeans and soy products. J. Food Compost. Anal. 2022, 110, 104535. [Google Scholar] [CrossRef]
- Akao, Y.; Kuranaga, Y.; Heishima, K.; Sugito, N.; Morikawa, K.; Ito, Y.; Soga, T.; Ito, T. Plant hvu-MIR168-3p enhances expression of glucose transporter 1 (SLC2A1) in human cells by silencing genes related to mitochondrial electron transport chain complex I. J. Nutr. Biochem. 2022, 101, 108922. [Google Scholar] [CrossRef]
- Tazawa, S.; Yamato, T.; Fujikura, H.; Hiratochi, M.; Itoh, F.; Tomae, M.; Takemura, Y.; Maruyama, H.; Sugiyama, T.; Wakamatsu, A. SLC5A9/SGLT4, a new Na+-dependent glucose transporter, is an essential transporter for mannose, 1,5-anhydro-D-glucitol, and fructose. Life Sci. 2005, 76, 1039–1050. [Google Scholar] [CrossRef]
- Guo, S.M.; Wang, Y.; Li, Y.M.; Li, Y.J.; Feng, C.J.; Li, Z.H. Daidzein-rich isoflavones aglycone inhibits lung cancer growth through inhibition of NF-κB signaling pathway. Immunol. Lett. 2020, 222, 67–72. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. Signaling to NF-kB by toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef]
- Xie, K.H.; Li, Y.; He, G.R.; Zhao, X.F.; Chen, D.W.; Yu, B.; Luo, Y.H.; Mao, X.B.; Huang, Z.Q.; Yu, J.; et al. Daidzein supplementation improved fecundity in sows via modulation of ovarian oxidative stress and inflammation. J. Nutr. Biochem. 2022, 110, 109145. [Google Scholar] [CrossRef]
- Soumyakrishnan, S.; Sudhandiran, G. Daidzein attenuates inflammation and exhibits antifibrotic effect against Bleomycin-induced pulmonary fibrosis in Wistar rats. Biomed. Prev. Nutr. 2011, 1, 236–244. [Google Scholar] [CrossRef]
- Takaoka, O.; Mori, T.; Ito, F.; Okimura, H.; Kataoka, H.; Tanaka, Y.; Koshiba, A.; Kusuki, I.; Shigehiro, S.; Amami, T. Daidzein-rich isoflavone aglycones inhibit cell growth and inflammation in endometriosis. J. Steroid Biochem. Mol. Biol. 2018, 181, 125–132. [Google Scholar] [CrossRef] [PubMed]
Item | %, as Fed |
---|---|
Alfalfa meal | 32.00 |
Corn | 30.00 |
Wheat bran | 20.00 |
Rice bran | 9.81 |
Soybean meal | 6.00 |
Calcium bicarbonate | 1.00 |
L−Lysine | 0.30 |
L−Threonine | 0.10 |
Tryptophan | 0.01 |
Choline chloride | 0.15 |
DL-methionine | 0.08 |
Sodium chloride | 0.20 |
Mineral-vitamin premix 1 | 0.35 |
Chemical composition | |
Digestible energy (MJ/kg) | 11.17 |
Dry matter, % | 84.91 |
Crude protein, % | 15.94 |
Ether extract, % | 4.23 |
Ash, % | 4.88 |
Ca, % | 0.89 |
Total phosphorus, % | 0.83 |
Item | Primer Sequence (5′–3′) | Annealing Temperature (°C) | Product Size (bp) | Gene Bank ID |
---|---|---|---|---|
β-actin | F: atgcagaaggagatcaccgc | 60.18 | 154 | NM_001101683.1 |
R: cgtcatactcctgcttgctga | 60.13 | |||
Zonula occludens-1, ZO-1 | F: tgcaaaaagtgaaccgcgag | 59.97 | 405 | XM_051822263.1 |
R: tccgcctttccctcagaaac | 59.96 | |||
Insulin-like growth factor-1, IGF-1 | F: catcctgtcctcctcgcatc | 59.97 | 165 | NM_001082026.1 |
R: ccgtatcctgtgggcttgtt | 60.00 | |||
Occludin | F: gcggcgtcggcagatt | 60.57 | 179 | XM_008262318.3 |
R: gtgcatctcaccaccgtaca | 60.04 | |||
Claudin-1 | F: aaagatgcggatggctgtca | 60.04 | 207 | NM_001089316.1 |
R: caaagtagggcacctcccag | 60.04 | |||
Tumor necrosis factor, TNF-α | F: ggccctcaggaggaagagt | 60.31 | 124 | NM_001082263.1 |
R: ggtttgctactacgtgggct | 60.04 | |||
Interleukin, IL-1β | F: gacctgttctttgaggccga | 59.97 | 158 | NM_001082201.1 |
R: ttctccagagccacaacgac | 59.97 | |||
Interleukin, IL-10 | F: catcagggagcacgtgaact | 60.04 | 160 | NM_001082045.1 |
R: ggctttgtagacgccttcct | 60.04 | |||
Nuclear factor-κB, NF-KB | F: atttgcagacagaaggcgga | 59.96 | 207 | XM_051819545.1 |
R: tgggggctttgctgtcatag | 60.03 | |||
Toll-like receptor 4, TLR4 | F: gccttctcagcaggaacact | 59.96 | 87 | XM_008273277.3 |
R: gtagggcttttctgagccgt | 60.04 | |||
Myeloid differentiation factor 88, MYD88 | F: ctgcagagcaaggagtgtga | 59.97 | 181 | XM_002723869.4 |
R: gggtccagaaccaggacttg | 59.96 | |||
Solute carrier family 5, member 9, SLC5A9 | F: ttcctgctggccatcttctg | 60.03 | 166 | NM_001105687.1 |
R: agtggaagtccttcagcacg | 59.97 | |||
Solute carrier family 2, member 1, SLC2A1 | F: gctgccctggatgtcctatc | 59.96 | 162 | NM_001105687.1 |
R: gaggtccagttggagaagcc | 60.04 |
Item | Treatments | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
CON 2 | DA85 3 | DA170 4 | DA340 5 | ANOVA | Linear | Quadratic | ||
Litter size at 21 d (n) | 8.03 | 9.22 | 9.50 | 8.26 | 0.34 | 0.31 | Ns | Ns |
Individual body weight at 21 d (g) | 353.98 c | 386.28 bc | 404.68 a | 402.63 a | 8.56 | 0.03 | <0.01 | <0.05 |
Average daily gain during 0–21 d (g/d) | 16.08 | 18.47 | 19.18 | 19.11 | 0.33 | 0.17 | <0.05 | <0.05 |
Litter size at 31 d (n) | 7.77 | 8.42 | 9.00 | 8.02 | 0.28 | 0.15 | Ns | Ns |
Individual body weight at 31 d (g) | 589.61 b | 674.82 a | 699.02 a | 671.88 a | 18.25 | <0.01 | <0.05 | <0.01 |
Average daily gain during 21–31 d (g/d) | 24.03 | 28.97 | 29.69 | 27.53 | 0.75 | 0.07 | Ns | <0.01 |
Item | Treatments | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
CON 2 | DA85 3 | DA170 4 | DA340 5 | ANOVA | Linear | Quadratic | ||
Progesterone (nmol/L) | 0.89 b | 1.20 a | 1.19 a | 1.43 a | 0.05 | <0.01 | <0.01 | 0.01 |
Estrogen (pmol/L) | 155.82 | 235.95 | 214.50 | 197.00 | 8.80 | <0.01 | Ns | <0.05 |
LDL-C (mmol/L) | 1.15 a | 0.22 b | 0.34 b | 0.18 b | 0.14 | 0.04 | <0.05 | <0.05 |
HDL-C (mmol/L) | 0.33 c | 0.50 bc | 0.81 a | 0.49 bc | 0.05 | <0.01 | Ns | <0.05 |
Immunoglobulins (μg/mL) | 86.65 c | 118.15 bc | 122.54 a | 134.13 a | 6.32 | 0.04 | <0.01 | <0.05 |
Immunoglobulins (μg/mL) | 36.73 | 57.44 | 58.61 | 46.97 | 3.45 | 0.06 | Ns | <0.05 |
Immunoglobulins (μg/mL) | 647.60 | 678.06 | 737.72 | 811.34 | 28.00 | 0.18 | <0.05 | Ns |
TNF-α (pg/mL) | 882.35 | 838.31 | 743.17 | 786.66 | 27.65 | 0.31 | Ns | Ns |
Interleukin-1β (ng/L) | 76.78 | 66.52 | 61.03 | 71.19 | 2.26 | 0.05 | Ns | <0.05 |
Interleukin-10 (ng/L) | 20.84 c | 25.26 bc | 41.43 a | 30.31 ab | 2.17 | <0.01 | <0.01 | <0.01 |
Catalase (U/mL) | 15.66 | 21.09 | 28.30 | 25.07 | 3.49 | 0.62 | Ns | Ns |
Malonic dialdehyde (nmol/mL) | 78.78 a | 63.24 ab | 49.44 c | 44.26 c | 4.04 | 0.01 | <0.01 | 0.01 |
Glutathione peroxidase (U/mL) | 35.30 | 48.71 | 52.44 | 53.97 | 2.33 | 0.01 | <0.01 | <0.01 |
T-AOC (U/mL) | 13.54 | 26.93 | 28.86 | 21.84 | 2.49 | 0.10 | Ns | Ns |
Item | Treatments | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
CON 2 | DA85 3 | DA170 4 | DA340 5 | ANOVA | Linear | Quadratic | ||
IGF-I (μg/L) | 129.94 b | 184.87 a | 173.77 a | 188.31 a | 6.48 | <0.01 | <0.01 | <0.01 |
Leptin (μg/L) | 32.97 | 35.64 | 33.11 | 33.11 | 0.69 | 0.50 | Ns | Ns |
LDL-C (mmol/L) | 8.53 | 3.80 | 4.93 | 5.63 | 0.60 | 0.03 | Ns | Ns |
HDL-C (mmol/L) | 0.30 | 0.78 | 0.81 | 0.87 | 0.12 | 0.04 | Ns | Ns |
Immunoglobulin A (μg/mL) | 100.84 b | 128.08 a | 155.18 a | 127.23 a | 5.78 | <0.01 | <0.05 | <0.01 |
Immunoglobulin M (μg/mL) | 51.41 | 57.98 | 60.39 | 56.62 | 1.67 | 0.26 | Ns | Ns |
Immunoglobulin G (μg/mL) | 418.77 b | 522.91 a | 593.72 a | 584.41 a | 22.03 | 0.01 | <0.01 | <0.01 |
TNF-α (pg/mL) | 899.03 a | 730.48 c | 773.61 ab | 708.73 c | 25.91 | 0.03 | <0.05 | <0.05 |
Interleukin-1β (ng/L) | 88.50 | 56.81 | 69.27 | 71.03 | 3.97 | 0.03 | Ns | Ns |
Interleukin-10 (ng/L) | 12.66 | 20.41 | 27.91 | 23.19 | 2.71 | 0.28 | Ns | Ns |
Catalase (U/mL) | 17.95 c | 58.06 a | 66.37 a | 50.99 bc | 6.70 | 0.04 | <0.05 | <0.05 |
Malonic dialdehyde (nmol/mL) | 203.91 | 143.38 | 90.41 | 148.75 | 14.45 | 0.03 | Ns | <0.05 |
Glutathione peroxidase (U/mL) | 155.92 | 181.65 | 272.31 | 315.03 | 23.48 | 0.03 | <0.01 | <0.05 |
T-AOC (U/mL) | 16.66 | 24.66 | 21.78 | 18.26 | 2.047 | 0.56 | Ns | NS |
Item | Treatments | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
CON 2 | DA85 3 | DA170 4 | DA340 5 | ANOVA | Linear | Quadratic | ||
Duodenum | ||||||||
Villus height (μm) | 556.39 b | 718.74 a | 695.19 a | 695.38 a | 22.28 | 0.04 | Ns | <0.05 |
Crypt depth (μm) | 90.02 | 85.89 | 76.77 | 89.72 | 3.06 | 0.34 | Ns | Ns |
V:C | 6.18 c | 8.37 a | 9.06 a | 7.75 bc | 0.38 | 0.02 | Ns | <0.01 |
Jejunum | ||||||||
Villus height (μm) | 498.69 | 656.13 | 682.55 | 676.15 | 23.06 | <0.01 | <0.05 | <0.05 |
Crypt depth (μm) | 100.11 a | 82.47 b | 73.06 b | 77.85 b | 3.11 | <0.01 | 0.01 | <0.01 |
V:C | 4.98 b | 7.96 a | 9.21 a | 8.49 a | 0.45 | 0.01 | <0.01 | <0.01 |
Ileum | ||||||||
Villus height (μm) | 401.10 c | 471.50 bc | 535.13 a | 501.18 a | 15.73 | <0.01 | <0.01 | <0.01 |
Crypt depth (μm) | 68.00 | 64.62 | 66.84 | 63.72 | 4.21 | 0.86 | Ns | Ns |
V:C | 5.90 | 7.30 | 8.01 | 7.86 | 0.62 | 0.40 | Ns | Ns |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, H.; Yu, E.; Wen, H.; Jiang, B.; Fu, G.; Sun, H.; He, J. Maternal Daidzein Supplementation during Lactation Promotes Growth Performance, Immunity, and Intestinal Health in Neonatal Rabbits. Agriculture 2023, 13, 1654. https://doi.org/10.3390/agriculture13091654
Xie H, Yu E, Wen H, Jiang B, Fu G, Sun H, He J. Maternal Daidzein Supplementation during Lactation Promotes Growth Performance, Immunity, and Intestinal Health in Neonatal Rabbits. Agriculture. 2023; 13(9):1654. https://doi.org/10.3390/agriculture13091654
Chicago/Turabian StyleXie, Hongmei, En Yu, Huamei Wen, Bayi Jiang, Guihua Fu, Haitao Sun, and Jun He. 2023. "Maternal Daidzein Supplementation during Lactation Promotes Growth Performance, Immunity, and Intestinal Health in Neonatal Rabbits" Agriculture 13, no. 9: 1654. https://doi.org/10.3390/agriculture13091654