Next Article in Journal
Free Fatty Acid Formation Points in Palm Oil Processing and the Impact on Oil Quality
Previous Article in Journal
Integrated Crop Management in Sustainable Agriculture
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 5
10.3390/agriculture13050955
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Characterization of the R2R3-MYB Gene Family in Diospyros oleifera

by
Kang Ji
1,2,
Cuiyu Liu
1,
Kaiyun Wu
1,
Zhihui Yue
1,
Yi Dong
1,
Bangchu Gong
1 and
Yang Xu
1,*
1
Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Hangzhou 311400, China
2
College of Forestry, Nanjing Forestry University, Nanjing 210000, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(5), 955; https://doi.org/10.3390/agriculture13050955
Submission received: 28 February 2023 / Revised: 10 April 2023 / Accepted: 18 April 2023 / Published: 26 April 2023
(This article belongs to the Section Genotype Evaluation and Breeding)
Browse Figures
Versions Notes

Abstract

:
The MYB gene family is one of the largest transcription factor families, which is clustered into four subfamilies according to the number of imperfect amino acid sequences repeats in their conserved MYB domain. R2R3-MYB is the largest subfamily that plays a diverse role in plant growth and development as well as adversity stresses. Diospyros has a wide range of applications in biomedical science and the food, wood, and chemical industries. Among these species, Diospyros oleifera can be used as a model plant for the Diospyros genus and the Ebenaceae family. Although the genome sequence of Diospyros oleifera was recently published in our previous work, bioinformatics and expression pattern analysis of the MYB gene family are limited. Here, we present the findings of a genome-wide analysis and the expression profiles of the R2R3-MYB transcription factor in Diospyros oleifera. A total of 129 R2R3-MYB genes were identified and classified into 28 groups (C1–C28) which had conserved motifs. The subfamily genes were unevenly distributed in 15 chromosomes; chromosome 6 and 7 have the most DoMYB genes. A total of 44 fragment replication events containing 57 DoMYB genes were identified using synteny analysis. In addition, collinear analysis revealed that 70 (54%) pairs of R2R3-MYB genes of Diospyros oleifera were collinear with Arabidopsis thaliana. Upon combining the data from RNA-seq and qRT-PCR, four key genes were screened and identified to correlate with the soluble tannin content during fruit development. DoMYB22 may be related to the synthesis of soluble tannin in persimmon. These results lay an important foundation for further studies on the R2R3-MYB gene function in persimmon fruit development.

1. Introduction

Transcription factors regulate plant development, stress response, and metabolic processes [1,2,3]. Several transcription factors including MYB, basic helix–loop–helix (bHLH), WD-repeat (WDR), and WRKY have been identified in the regulation of flavonoid biosynthesis [4,5,6]. Among them, the MYB gene family is one of the largest plant transcription factors [4]. The first MYB gene found in plants was from the C1 locus of maize (Zea mays) [7]. With the further study of the MYB gene, the gene structure is gradually becoming clear. The highly conserved MYB domain consists of 1–4 imperfect amino acid sequence repeats, which have approximately 52–53 amino acids that form three alpha helixes [8,9]. According to the number of repeats, the MYB gene family is classified into four groups: R1-MYB (1 repeat), R2R3-MYB (2 repeats), R1R2R3-MYB (3 repeats), and 4R-MYB (4 repeats) [8]. Among them, R2R3-MYB is the largest group that plays multiple roles in plant physiological processes [10,11].
Today, several R2R3-MYB genes have been identified and functionally analyzed in a wide range of plants, including Arabidopsis [8], Pyrus bretschneideri Rehd [12], Prunus salicina [11], Cucumis sativus [13], Glycine max [14], etc., and the number of R2R3-MYB genes in these plants ranges from 55 to 244. To date, there have been many reports that the R2R3-MYB gene plays a diverse role in plant growth and development as well as the response to adversity. Transgenic tobacco plants over-expressing SpMYB increase the resistance to the necrotizing pathogens Fusarium oxysporum and Botrytis cinerea [10]. Some R2R3-MYB transcription factors are involved in cell and petal morphogenesis and flavonoid accumulation [15,16,17]. In Arabidopsis, ATMYB12, a flavonoid-specific activator for biosynthetic flavonoid, activates the phenylpropane pathway genes [18,19]. The expression of ATMYB11 in transgenic tobacco plants leads to the accumulation of most genes that affect the expression of flavonoid pathways [20,21], and MYB75 and MYB90 regulate anthocyanin production [22]. ATMYB4 and ATMYB32 act as unbranched transcriptional repressors for phenylpropane metabolism. ATMYB4 is involved in the function as a repressor of phenylpropanoid metabolism, and ATMYB32 is a repressor of lignin biosynthesis, especially in pollen [15,23]. AmMBML2, AtMYB16, and PhMYB1 are involved in regulating cell morphology and promoting the formation of exophytes [24].
Persimmon (Diospyros kaki, D. kaki) originates in China, Korea, and Japan and is now widely grown in East Asia [25]. The fruit is rich in sugar, protein, fat, vitamins, and other nutrients. The tannin, organic acid, and aromatic substances in the fruit constitute its unique flavor [26]. During growth and development, D. kaki accumulates abundant proanthocyanidins (PAs), which react with proteins to cause strong astringency [25]; therefore, it is inedible without artificial treatment to reduce its astringency [27]. However, there is a pollination constant and non-astringent (PCNA) type that reduces astringency naturally during fruit development, so artificial treatment is not necessary before marketing, and it is a popular cultivation type for fresh fruit consumption [25,27]. At present, the studies on R2R3-MYB genes of persimmon mainly focus on PAs. For example, research shows that DkMYB4 directly or indirectly acts as a regulator of PA pathway genes and controls the biosynthesis of PAs in persimmon [27]. DkMYB6 shows the ability to transactivate DKPDC2/3 and DKERF9/19, indicating that it is an important transcribed activator for persimmon fruit to lose astringency [28]. DkMYB14 is a transcription factor that acts as a repressor in PA biosynthesis to regulate the accumulation of PAs in persimmon fruit [29]. Due to the various types of persimmon with a large MYB gene family, whether there are other R2R3-MYB members related to tannin synthesis and astringency of persimmon fruit is unknown.
Although the R2R3-MYB gene family has been extensively studied, the spatiotemporal expression pattern of the main members in the R2R3-MYB gene family in persimmon has not been clarified. However, most D. kaki cultivars are hexaploid (2n = 6x = 90), so it is hard to study their progenitor, origin, and polyploidization mechanisms [30]. In Diospyros oleifera (D. oleifera), a diploid (2n = 2x = 30), the genome is simpler than D. kaki [31], and they are both important cultivars in Asia that contain abundant vitamins, sugars, nutrients, and antioxidants [30]. Fu et al. found that D. oleifera had a closer relationship with D. kaki, and Kanzaki suggested that D. oleifera may be one of the diploid ancestors of D. kaki [31,32]. Thus, D. oleifera can be used as an ideal model plant for studies of Diospyros. Whole-genome sequencing and assembly of D. oleifera were carried out in our previous studies [30], bringing significant benefits to the identification and characterization of R2R3-MYB genes on a genome-wide scale.
Due to the significant role of R2R3-MYB genes in plant development, it is significant to explore the characteristics of DoMYB genes, which have rarely been reported in D. oleifera. In this study, a comprehensive, genome-wide inventory of the R2R3-MYB gene family in D. oleifera was made. The expression profiles of four DoMYB genes involved in flavonoid biosynthesis and soluble tannin content were determined in four persimmon varieties at different stages of fruit development. This genome-wide inventory of R2R3-MYB genes is the first analysis on D. oleifera and may contribute to future research into the role of the R2R3-MYB gene family in persimmon fruit development, especially in flavonoid biosynthesis.

2. Materials and Methods

2.1. Plant Material

We collected the fruits of D. oleifera and three D. kaki cultivars (‘Taishuu’ (pollination constant and non-astringent, PCNA), ‘Luotian’ (PCNA), and ‘Fangshanshi’ (pollination constant and astringent, PCA)) at six growth stages: three weeks after bloom (3 WAB), five weeks after bloom (5 WAB), nine weeks after bloom (9 WAB), 13 weeks after bloom (13 WAB), 17 weeks after bloom (17 WAB), and 21 weeks after bloom (21 WAB). One persimmon fruit of basically the same size and growth stage was collected from each persimmon tree in the east, south, west, and north (four fruits per tree). We removed the top, proximal pedicle, and middle pith of these fruits and retained the equatorial flesh. After liquid nitrogen quick-freezing, the sample was ground, placed in a plastic tube, and stored in a −80 °C refrigerator for testing.

2.2. Determination of Soluble Tannins in Fruits

The tannic content was determined by titration “spectrophotometry”. A measure of 80 mL of water was added, and the homogenate suspension (5.0 g) was heated in a boiling water bath for 30 min. The extracted solution was mixed with water to a total volume of 100 mL. Then, 2 mL of solution was centrifuged at 8000 r/min for 4 min. We removed 1 mL of supernatant to 5 mL of water, 1 mL mixed solution of sodium tungstate and sodium molybdate, and 3 mL of sodium carbonate solution (75 g/L); the absorbance was measured at 765 nm after 2 h, and then the tannin content was calculated.

2.3. DoMYB Gene Identification

Genome sequences of D. oleifera were downloaded from the persimmon genome website (http://www.kakiwi.zju.edu.cn (accessed on 12 August 2020)). The R2R3-MYB genes in D. oleifera (DoMYB) were obtained via two BLASTP methods. First, a hidden Markov model (HMM) profile for the MYB domain (PF00249) downloaded from Pfam (http://pfam.janelia.org (accessed on 28 May 2022)) was used to search the D. oleifera proteome sequence database by HMMER (version 3.1) with the cutoff E-value of ≤ 1 × 10−10 [12,33]. Second, the identified AtMYBs were downloaded from NCBI. AtMYBs were used as queries to identify candidates of DoMYBs via local BLASTP with a thread of E-values ≤ 1 × 10−10 [11,34]. Subsequently, the alignment results were manually curated, and the redundant sequences were removed. DoMYB candidates were further analyzed using SMART programs (http://smart.embl-heidelberg.de/ (accessed on 17 June 2022)) to confirm the presence of the R2R3-MYB domain.

2.4. Analysis of DoMYB Protein Properties and Conserved Motifs

The MEME program (http://meme-suite.org/tools/MEME (accessed on 28 June 2022)) was used to define the conserved motif of R2R3-MYB proteins. The width ranged from 6 to 30. TBTOOLS was used to visualize the results of motifs. We used the online Expasy tool (http://expasy.org/ (accessed on 28 June 2022)) to analyze the physiological and biochemical characteristics of R2R3-MYB proteins. Secondary structure analysis was performed by an online analysis program, and subcellular localization was predicted by using PSORT Prediction online analysis software (https://psaprabi.ibcp.fr/CGI-bin/npsa_automat.pl/page=npSA_sopma.html (accessed on 29 June 2022)).

2.5. Phylogenetic Tree and Gene Structure Analysis

In this study, the R2R3-MYB phylogenetic tree was constructed with the aligned R2R3-MYB proteins (129 of D. oleifera and 126 of Arabidopsis) using IQ-tree (JTTDCMut + F+I + G4 models: auto; 1000 bootstraps, the Shimodaira-Hasegawa-like aLRT test) [35]. We used MAFFT to align the MYB protein sequences [36]. The exon–intron structure of the D. oleifera R2R3-MYB gene was visualized by TBtools [37].

2.6. Chromosome Distribution and Collinearity Analysis

The gene locations of D. oleifera were obtained from genome chromosome information. After screening, the relevant information on the R2R3-MYB gene was obtained and used to map R2R3-MYB genes on the chromosome by Tbtools [37].

2.7. Expression Analysis of MYB Genes and RT-PCR Analysis

From the transcriptome data of six D. oleifera developmental stages, 129 R2R3-MYB genes were expressed. The cluster heat map was made with TBtools [37]. We used the Vazyme kit to extract the total RNA from samples. The quality of RNA was examined by NanoDrop 2000 ultramicro ultraviolet spectrophotometer. Each group of RNA was reverse-transcribed into cDNA following the instructions of the Vazyme reverse transcription kit. The amplification reaction was carried out by CFX96TM real-time quantitative fluorescence PCR instrument. The amplification conditions were 40 cycles of: 95 °C, 30 s; 95 °C, 5 s; 60 °C, 30 s; 65 °C, 5 s. The 2 − ΔΔ method was used to calculate the relative expression levels of each gene. The 10 μL PCR reaction system is shown in Table 1, and the primer sequences are shown in Table 2.

3. Results

3.1. Identification of R2R3-MYB Genes in D. oleifera

In this study, 129 R2R3-MYB genes in D. oleifera were identified. We analyzed the physicochemical properties of 129 R2R3-MYB proteins in D. oleifera. The results showed that the protein length ranged from 135 to 745 amino acids, the MW ranged from 15.8 to 80.0 kDa, and the theoretical pI ranged from 4.84 to 9.96. Most of the DoMYBs have about 200–400 amino acids and a molecular weight of about 20–40 kDa. Among these, there are 55 acidic proteins (PI < 6.5), 14 neutral proteins (6.5 < PI < 7.5), and 60 basic proteins (PI > 7.5) (Table 3).
The primary secondary structure of 121 DoMYBs are random coil, and the other 6 proteins are alpha helix. The least predicted secondary structure of 97 DoMYBs is β-turn, and the other proteins are extending strands. In addition, 6 encoded proteins have the same minimum number of extended strands and β-turn predictions of secondary structures. Moreover, DoMYB64 and DoMYB73 have the same number of alpha helix and random coil predicted structures.

3.2. Phylogenetic Tree of R2R3-MYB Genes in D. oleifera

We constructed the R2R3-MYB phylogenetic tree with the 129 R2R3-MYB proteins of D. oleifera and 126 R2R3-ATMYBs. We divided DoMYBs into groups C1–C28 (Figure 1).

3.3. Gene Structure and Protein Motifs of DoMYB

Commonly, gene structures of homologous genes are highly conserved and can be used to reveal their evolutionary relationship. In D. oleifera, except for DoMYB28, DoMYB31, DoMYB81, and DoMYB128 having no introns, the number of introns in other members ranges from 1 to 11. The 93 members contain 3 exons and 2 introns, where the exons mostly include 2 short exons and 1 long exon (Figure 2). Moreover, genes with similar structures cluster together, and their classification corresponds to the group in Figure 1. For example, the 7 members of DoMYB in C26 (DoMYB82, DoMYB123, DoMYB83, DoMYB93, DoMYB110, DoMYB1, and DoMYB122) all contain 3 exons and 2 introns (Figure 2).
To further explore the conserved domains of the R2R3-MYB gene subfamily in D. oleifera, we used MEME to analyze the distribution of 129 DoMYB protein domains in D. oleifera. The result shows that 92 DoMYB proteins have 4 highly conserved motifs (motifs 3, motif 6, motif 2, motif 5, and motif 1). Motif 3, motif 6, and a part of motif 4 constitute the R2 repeat, which contains a highly conserved tryptophan (W) separation triplet (Figure 3). The first tryptophan (W) in the R3 repeat is replaced by phenylalanine (F), brightenol hydrochloride (L) or isoleucine (I). The R2 and R3 repeat both have highly conserved EED and EEE residues groups (Figure 3). In addition, we also find that the R2 repeat of 29 DoMYB proteins and the R3 repeat of 4 DoMYB proteins are missing. DoMYB88, DoMYB89, DoMYB104, and DoMYB129 encoding proteins have an absent R3 repeat and R2 repeat (Figure 3). These results show that most DoMYBs have uniform or similar motif compositions and gene structures. Most homologous paired members have a common domain composition, suggesting that they may be functionally similar in the R2R3-MYB subfamily proteins. The others may have experienced deletions or mutations during evolution.

3.4. Genome Distribution and Gene Duplication of DoMYBs

In order to explain the possible mechanism of the evolutionary expansion of DoMYB, the locations of 129 DoMYBs were marked on the D. oleifera chromosome. The results showed that D. oleifera had 15 chromosomes (Chromosome 1 to Chromosome 15). As shown in Figure 4, 118 MYB genes (9, 10, 6, 11,4, 12, 12, 7, 5, 4, 8, 10, 8, 6, 6) were unevenly distributed in Chromosomes 1 to 15 of the persimmon genome, while the remaining 11 genes could not be localized on a specific chromosome. Chromosome 1 is the longest of the 15 chromosomes, while Chromosomes 6 and 7 have the most DoMYB genes. The DoMYB genes on most chromosomes are more densely distributed at both ends.
The amplification mechanism in the evolution of the R2R3-MYB gene family is mainly completed by gene replication events including tandem duplication and segmental duplication [38]. In this study, the collinearity relationship of the R2R3-MYB gene family in the D. oleifera genome was studied, and a total of 44 fragment replication events containing 57 DoMYB genes were identified. Some genes, such as DoMYB124 and DoMYB29, participated in multiple duplication events. Two tandem DoMYB genes were found on Chromosomes 8 and 15, and three tandem genes were found on Chromosome 1, indicating that they originated from tandem repeats. These results showed that the expansion of the DoMYB genes mainly occurred through the segmental duplication events.
To further intuitively display the syntenic relationship of the D. oleifera R2R3-MYB family, we constructed a syntenic map between D. oleifera and Arabidopsis (Figure 5). We identified 70 (54%) pairs of R2R3-MYB genes of D. oleifera that were collinear with Arabidopsis. The orthologous gene pairs existed in most of groups, consistent with the results of the development tree. DoMYB26, DoMYB29, DoMYB103, and DoMYB124 are close to AtMYB44 and AtMYB73 in C27 (S22), which are involved in salt-stress signal transduction and regulation [39,40]. DOMYB68, DoMYB107, and DOMYB128 are clustered with AtMYB42, AtMYB43, and AtMYB85 in C3, which are related to lignin biosynthesis and biosynthesis of the aromatic amino acid Phe [41]. DoMYB92 is near AtMYB12 and AtMYB11, which control flavonoid biosynthesis [21,23]. DoMYB85, DoMYB16, and DoMYB56 are clustered with AtMYB7, AtMYB32, and AtMYB4 in C8 (S4), which are involved in regulation of flavonoid biosynthesis [15,42]. However, although DoMYB22 and DoMYB109 are clustered in C8, they have no orthologous relationship with AtMYB genes.

3.5. Expression Profile Analysis of DoMYB Genes and Expression of Four DoMYB Genes by RT-PCR

Based on the previous research, we screened 129 R2R3-MYB genes from transcriptome data of six different developmental stages in D. oleifera [30]. During the growth and development of fruit, most DoMYB genes had low expression in whole developmental stages, and overall, the expression in 3WAB was higher than in 21WAB. As shown in Figure 6, most of the genes in groups C11, C12, C10, C13, C8, C7, and C27 showed high expression, especially at 3–9 WAB. To further demonstrate changes in gene expression, gene expression trends of DoMYB genes at different stages were elucidated (Figure 7). There were six expression trends of DoMYB genes. Cluster 3 contained the most genes (50) and cluster 2 contained the fewest (6). Combined with the soluble tannin content in D. oleifera at different stages (Figure 8), we found that the trend of cluster 3 was similar to it. The trend in all of them decreased rapidly from 5 WAB to 9 WAB. The genes of cluster 3 may be related to the soluble tannin content in the fruit of D. oleifera. We found that DoMYB16, DoMYB22, DoMYB56, and DoMYB85 were close with S4 clustered in cluster 3. We assume that, as with the genes in S4, these four genes may be related to flavonoid biosynthesis.
To further analyze the role of these four genes in persimmon fruit development, we used them for a subsequent RT-PCR experiment (Figure 9) and measured the soluble tannin content in another three D. kaki varieties (‘Taishuu’, ’Luotian’, and ’Fangshanshi’) at five development stages (Figure 8). Due to the fruit materials collected in 3WAB having priority to meet the requirements of transcriptomic data detection, the six selected MYB genes were detected in five development stages (5 WAB, 9 WAB, 13 WAB, 17 WAB, and 21 WAB) of D. oleifera, ‘Taishuu’, ‘Luotian’, and ‘Fangshanshi’.
The experiment further verified the reliability of transcriptome data and estimated the potential role of candidate genes in soluble tannin production and accumulation in persimmon fruit. The order of the soluble tannin content in different types of fruit from high to low was D. oleifera > ‘Fangshanshi’ > ‘Luotian’ > ‘Taishuu’. The soluble tannin content of Taishuu (PCNA) decreased to a very low level during the 9WAB and was maintained. Because ‘Luotian’ is a PCNA variety, the decrease in tannin content mainly occurred in the late development stage. This was related to the different deastringency mechanisms of the two varieties [43]. The soluble tannin contents of D. oleifera and ‘Fangshanshi’ (PCA) were higher and remained at a high level after fruit ripening, which was consistent with the inability of natural deastringency.
Material expression was verified during different fruit development stages. DoMYB16, DoMYB22, DoMYB56, and DoMYB85 had the highest expression at 3 WAB of persimmon varieties. Compared with ‘Luotian’ and ‘Fangshanshi’, the expression of DoMYB16 and DoMYB56 in ‘Taishuu’ and D. oleifera decreased sharply at 9 WAB. The expression levels of DoMYB22 decreased significantly during the early development of ‘Taishuu’. The expression level of DoMYB85 was similar in ‘Taishuu’, ‘Luotian’, and D. oleifera. The results showed that the expression level of most genes in ‘Taishuu’ was relatively low. Combined with the results of the soluble tannin content and expression of RT-PCR, we found that some expression trends were the same as the soluble tannin content trend. The DoMYB16, DoMYB22, and DoMYB56 expressions of ‘Luotian’ were high at 5WAB-9WAB and decreased quickly at 13WAB, which was the same as the soluble tannin content. The trend of the DoMYB22 expression level in four varieties was similar to the trend of the soluble tannin content. We estimate that DoMYB22 may be related to soluble tannin synthesis.
The correlation analysis between the transcriptome expression and RT-PCR expression in D. oleifera illustrated the reliability of screening genes (Figure 10). The results showed that the expression of DoMYB16, DoMYB22, DoMYB56, and DoMYB85 by transcriptome and RT-PCR was significant.
Agriculture 13 00955 g008 550
Figure 8. Soluble tannin content in different varieties. TS: ‘Taishuu’, LT: ‘Luotian’, DO: D. oleifera, FS: ‘Fangshanshi’.
Figure 8. Soluble tannin content in different varieties. TS: ‘Taishuu’, LT: ‘Luotian’, DO: D. oleifera, FS: ‘Fangshanshi’.
Agriculture 13 00955 g008
Agriculture 13 00955 g009 550
Figure 9. RT-PCR expression level of the same gene in different varieties. TS: ‘Taishuu’, LT: ‘Luotian’, DO: D. oleifera, FS: ‘Fangshanshi’.
Figure 9. RT-PCR expression level of the same gene in different varieties. TS: ‘Taishuu’, LT: ‘Luotian’, DO: D. oleifera, FS: ‘Fangshanshi’.
Agriculture 13 00955 g009
Agriculture 13 00955 g010 550
Figure 10. Correlations between the expression levels of six DoMYB genes by transcriptome and RT-PCR. “-PCR”: DoMYB expression level by transcriptome, “-Seq”: DoMYB expression level by RT-PCR. The blue pie indicates a positive correlation. The darker the color, the more significant the correlation.
Figure 10. Correlations between the expression levels of six DoMYB genes by transcriptome and RT-PCR. “-PCR”: DoMYB expression level by transcriptome, “-Seq”: DoMYB expression level by RT-PCR. The blue pie indicates a positive correlation. The darker the color, the more significant the correlation.
Agriculture 13 00955 g010

4. Discussion

Systematic evaluation of the MYB gene family can facilitate the study of critical regulatory mechanisms regarding D. oleifera genomes. In this study, a total of 129 R2R3-MYB genes were identified, which is similar in other plants, such as peach (Prunus persica) and tomato [44,45]. The topological structure of the phylogenetic tree in the referenced studies on other species, for example, Glycyrrhiza uralensis [46], bamboo (Phyllostachys edulis) [47], and sesame (Sesamum indicum L.) [48], was used. The R2R3-MYB proteins in D. oleifera were grouped into 28 groups. Most of the groups contain different numbers of AtMYB, suggesting conservation between the R2R23-MYB gene family of D. oleifera and Arabidopsis. Compared with other species, there were fewer groups of D. oleifera. Like sesame and bamboo, the R2R3-MYB subfamily was divided into 30 and 36 groups, respectively [47,48]. In addition, no R2R3-MYB protein is divided into the S12 and S23 groups, which might be caused by the lack of function in the evolutionary process of D. oleifera. In these proteins, the amount of basic protein was higher than acidic protein.
Consistent with the previous results, the R2 repeat sequence in D. oleifera includes a highly conserved Tryptophan (W) separation triad, and the third helix is more conserved than the other two helixes. Generally, the second half of each R structure is conserved [11,14,49], and in D. oleifera, this situation also shows in the R3 repetitive sequence. The conserved sequence in the third helical structure of R2 and R3 is basically the same as in most plants, such as peach [44] and sesame [48]. Additionally, whether the residues in the third helix of R2 and R3 repeats are replaced affects the DNA-binding activity [50]. Therefore, the highly conserved amino acids in the third helix may represent the stability of this motif part, which may be related to the functional stability during the evolution of species [47]. In previous studies, the first Trp (W) residue of R3 repeats is variable and usually replaced by phenylalanine (F) and isoleucine (I) [4]. The replacement of the first Trp (W) residue may be used to identify new target genes or may result in the loss of DNA-binding activity of target genes [50]. In D. oleifera, the first tryptophan (W) is found to be replaced by phenylalanine (F), isoleucine (I), or bright white phenolic acid (L). These changes in key amino acids might lead to a specific function of the gene. R2 and R3 repeats also have highly conserved EED and EEE residue groups (Figure 3); the results are consistent with those for other species [45,51].
The MYB gene family widely exhibits low tandem and high segment duplication in plants [52]. In this study, three pairs of tandem replicated DoMYBs and 44 pairs of segmental replicated DoMYBs were identified. Segmental replication events accounted for a large proportion, indicating that segmental replication seemed to play a crucial role in the expansion of the R2R3-MYB gene family of the D. oleifera genome, which was also consistent with the evolutionary model of the MYB gene [38]. In our study, most members of the R2R3-MYB gene family were shown to have similar exon and intron structures. The same has been indicated with most of the SIMYB introns in tomato [53] and half of R2R3-MYB genes with two introns in D. oleifera, with the introns of the remaining genes having an irregular distribution. Although these genes clustered together with Arabidopsis R2R3-MYB in phylogenetic trees, they formed their own unique intron–exon structure, and their functions might have specific differences, which need to be discovered by further studies.
The R2R3-MYB gene family plays a variety of roles in the physiological process of plants [10], affecting the growth and development of plants and their response to adversity. Many studies show that the R2R3-MYB subfamily is associated with PA synthesis. Polyphenols are the main substances that cause fruit astringency, and they are mainly synthesized through three pathways: phenylpropane, flavonoids, and phenolic acids in plants. The strength of astringency is related to tannin and proanthocyanidins, which can be synthesized through the flavonoid pathway [54]. In persimmon, DkMYB5 and DkMYB6 may be involved in the hypoxia response, and DkMYB6 is a putative transcriptional activator in persimmon fruit removal [28]. DkMYB4 is a direct regulator of the PA pathway and controls the PA pathway in persimmon; the ectopic inhibition of DkMYB4 expression in persimmon callus causes a proportional decrease in the expression levels of the same flavonoid pathway genes. DkMYB14 is a transcription factor that regulates the accumulation of PAs in fruit [29]. We selected four genes of D. oleifera: DoMYB16, DoMYB22, DoMYB56, and DoMYB85, which were close to S4. We hypothesized that these genes might functionally correspond to ATMYB genes. Previous studies have shown that the tannin accumulation in PCNA fruits stops at the early stage of growth, and the soluble tannin concentration gradually decreases with development [43,55], indicating that genes in groups C11, C12, C10, C13, C8, C7, and C27 might be related to the change in soluble tannin content in fruits. The DoMYB16, DoMYB22, DoMYB85, and DoMYB56 expression of ‘Taishuu’ all decreased during 5WAB–9WAB, which is same as the trend in soluble tannin content. However, the expression of DoMYB22 in other varieties was more consistent with the change in tannin content than in other genes. Like the expression of DoMYB22 in ‘Luotian’, it was high in early development (5WAB–9WAB) and decreased rapidly in 13WAB, which was the same as the expression of DkPA1 in ‘Luotian’. Su discovered that DkPA1 participated in the accumulation of soluble tannins in PCNA in China [43]. Although DoMYB22 was clustered with S4, it had no orthologous relationship with AtMYB genes. Therefore, we assume that DoMYB22 may be related to the synthesis of soluble tannin.

5. Conclusions

In this study, the characteristics of the R2R3-MYB gene family in D. oleifera were investigated via phylogenetic, evolutionary, and structural analysis. The DoMYB genes were clustered into 28 groups; most genes were highly conserved. In addition, collinear analysis revealed that 70 (54%) pairs of R2R3-MYB genes of D. oleifera were collinear with Arabidopsis thaliana, and the expansion of the DoMYB genes mainly occurred through the segmental duplication events. Moreover, we found that DoMYB22 may be related to the synthesis of soluble tannin. However, further studies are needed to explore the function of R2R3-MYB genes in order to reveal the molecular regulation of these genes in the development of persimmon fruit.

Author Contributions

Author Contributions: Conceptualization, B.G., Y.X. and K.J.; methodology, K.J., B.G., Y.X. and C.L.; formal analysis, K.J., K.W., Z.Y., Y.X., and Y.D.; investigation, K.J., C.L. and K.W.; writing original draft preparation, K.J. and B.G.; writing—review and editing, K.J., B.G. and Y.X.; funding acquisition, B.G. and Y.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China: (grant No. 32101569); The Key Agricultural New Varieties Breeding Projects of the Zhejiang Province Science and Technology Department (grant No. 2021C02066-10).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ma, Y.; Zhang, H.; Tu, Y.; Chen, X. Advances in research on transcription factors related to fruit development and ripening. Genom. Appl. Biol. 2017, 36, 4836–4846. [Google Scholar]
  2. Zhang, C.; Wang, Y.; Chen, J.; Wang, Y.; Zhang, M. Research advances on the regulation of secondary metabolism by plant myb transcription factors. Genom. Appl. Biol. 2020, 39, 4171–4177. [Google Scholar]
  3. Shi, S.; Gong, X.; Zou, Y. The role of WRKY transcription factors in biotic and abiotic stress responses in plants. Chin. J. Biochem. Mol. Biol. 2017, 33, 674–680. [Google Scholar]
  4. Lloyd, A.; Brockman, A.; Aguirre, L.; Campbell, A.; Bean, A.; Cantero, A.; Gonzalez, A. Advances in the MYB-bHLH-WD repeat (MBW) pigment regulatory model: Addition of a wrky factor and co-option of an anthocyanin MYB for betalain regulation. Plant Cell Physiol. 2017, 58, 1431–1441. [Google Scholar] [CrossRef]
  5. Liu, J.; Osbourn, A.; Ma, P. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. Mol. Plant 2015, 8, 689–708. [Google Scholar] [CrossRef]
  6. Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef]
  7. Ares, J.; Ghosal, D.; Wienand, U.; Saedler, H. The regulatory c1 locus of zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators. EMBO J. 1987, 6, 3553–3558. [Google Scholar] [CrossRef]
  8. Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef]
  9. Du, H.; Liang, Z.; Zhao, S.; Nan, M.; Tran, L.; Lu, K.; Huang, Y.; Li, J. The evolutionary history of R2R3-MYB proteins across 50 eukaryotes: New insights into subfamily classification and expansion. Sci. Rep. 2015, 5, 11037. [Google Scholar] [CrossRef]
  10. Liu, Z.; Luan, Y.; Li, J.; Yin, Y. Expression of a tomato MYB gene in transgenic tobacco increases resistance to Fusarium oxysporum and Botrytis cinerea. Eur. J. Plant Pathol. 2016, 144, 607–617. [Google Scholar] [CrossRef]
  11. Liu, C.; Hao, J.; Qiu, M.; Pan, J.; He, Y. Genome-wide identification and expression analysis of the MYB transcription factor in Japanese plum (Prunus salicina). Genomics 2020, 112, 4875–4886. [Google Scholar] [CrossRef]
  12. Feng, S.; Xu, Y.; Yang, L.; Sun, S.; Wang, D.; Chen, X. Genome-wide identification and characterization of R2R3-MYB transcription factors in pear. Sci. Hortic. 2015, 197, 176–182. [Google Scholar] [CrossRef]
  13. Li, Q.; Zhang, C.; Li, J.; Wang, L.; Ren, Z. Genome-wide identification and characterization of R2R3MYB family in Cucumis sativus. PLoS ONE 2012, 7, e475762012. [Google Scholar] [CrossRef]
  14. Du, H.; Yang, S.; Liang, Z.; Feng, B.; Lei, L.; Huang, Y.; Tang, Y. Genome-wide analysis of the MYB transcription factor superfamily in soybean. BMC Plant Biol. 2012, 12, 106. [Google Scholar] [CrossRef]
  15. Wang, X.; Wu, J.; Guan, M.; Zhao, C.; Geng, P.; Zhao, Q. Arabidopsis MYB4 plays dual roles in flavonoid biosynthesis. Plant J. 2020, 101, 637–652. [Google Scholar] [CrossRef]
  16. Zhu, L.; Guan, Y.; Zhang, Z.; Song, A.; Chen, S.; Jiang, J.; Chen, F. CmMYB8 encodes an R2R3 MYB transcription factor which represses lignin and flavonoid synthesis in chrysanthemum. Plant Physiol. Biochem. 2020, 149, 217–224. [Google Scholar] [CrossRef]
  17. Lau, S.; Schwarzacher, T.; Othman, R.; Harikrishna, J. dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid. BMC Plant Biol. 2015, 15, 194. [Google Scholar] [CrossRef]
  18. Wang, F.; Kong, W.; Wong, G.; Fu, L.; Peng, R.; Li, Z.; Yao, Q. AtMYB12 regulates flavonoids accumulation and abiotic stress tolerance in transgenic Arabidopsis thaliana. Mol. Genet. Genom. 2016, 291, 1545–1559. [Google Scholar] [CrossRef]
  19. Pandey, A.; Misra, P.; Khan, M.; Swarnkar, G. Co-expression of Arabidopsis transcription factor, AtMYB12, and soybean iso-flavone synthase, GmIFS1, genes in tobacco leads to enhanced biosynthesis of isoflavones and flavonols resulting in osteo-protective activity. Plant Biotechnol. J. 2014, 12, 69–80. [Google Scholar] [CrossRef]
  20. Li, Y.; Chen, M.; Wang, S.; Ning, J.; Ding, X.; Chu, Z. AtMYB11 regulates caffeoylquinic acid and flavonol synthesis in tomato and tobacco. Plant Cell Tissue Organ Cult. 2015, 122, 309–319. [Google Scholar] [CrossRef]
  21. Pandey, A.; Misra, P.; Trivedi, P. Constitutive expression of Arabidopsis MYB transcription factor, AtMYB11, in tobacco mod-ulates flavonoid biosynthesis in favor of flavonol accumulation. Plant Cell Rep. 2015, 34, 1515–1528. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, F.; Cai, J.; Yang, Y.; Liu, Z. Overexpression of microRNA828 reduces anthocyanin accumulation in Arabidopsis. Plant Cell Tissue Organ Cult. 2013, 115, 159–167. [Google Scholar] [CrossRef]
  23. Preston, J.; Wheeler, J.; Heazlewood, J.; Li, S.; Parish, R. AtMYB32 is required for normal pollen development in Arabidopsis thaliana. Plant J. 2004, 40, 979–995. [Google Scholar] [CrossRef] [PubMed]
  24. Baumann, K.; Perez-Rodriguez, M.; Bradley, D.; Venail, J.; Martin, C. Control of cell and petal morphogenesis by R2R3 MYB transcription factors. Development 2007, 134, 1691–1701. [Google Scholar] [CrossRef] [PubMed]
  25. Akagi, T.; Katayama-Ikegami, A.; Yonemori, K. Proanthocyanidin biosynthesis of persimmon (Diospyros Kaki Thunb.) fruit. Sci. Hortic. 2011, 130, 373–380. [Google Scholar] [CrossRef]
  26. Gu, H. Studies on the Characteristics, Structures of Persimmon Tannin and Its Interaction with Some Snake Venom Proteins; Huazhong Agricultural University: Wuhan, China, 2007. [Google Scholar]
  27. Akagi, T.; Ikegami, A.; Tsujimoto, T.; Kobayashi, S.; Sato, A.; Kono, A.; Yonemori, K. DkMyb4 Is a myb transcription factor in-volved in proanthocyanidin biosynthesis in persimmon fruit. Plant Physiol. 2009, 151, 2028–2045. [Google Scholar] [CrossRef]
  28. Fang, F.; Wang, M.; Zhu, Q.; Min, T.; Grierson, D.; Yin, X.; Chen, K. DkMYB6 is involved in persimmon fruit deastringency, via transcriptional activation on both DkPDC and DkERF. Postharvest Biol. Technol. 2016, 111, 161–167. [Google Scholar] [CrossRef]
  29. Chen, W.; Zheng, Q.; Li, J.; Liu, Y.; Xu, L.; Zhang, Q.; Luo, Z. DkMYB14 is a bifunctional transcription factor that regulates the accumulation of proanthocyanidin in persimmon fruit. Plant J. 2021, 106, 1708–1727. [Google Scholar] [CrossRef]
  30. Xu, Y.; Liu, C.; Cheng, W.; Wu, K.; Gong, B. Full-length transcriptome profling for fruit development in Diospyros oleifera using nanopore sequencing. BMC Genom. Data 2023, 24, 17. [Google Scholar] [CrossRef]
  31. Kanzaki, S. The origin and cultivar development of Japanese Persimmon (Diospyros kaki Thunb.). Jpn. Soc Food Sci. Technol. 2016, 63, 328–330. [Google Scholar] [CrossRef]
  32. Fu, J.; Liu, H.; Hu, J.; Liang, Y.; Liang, J.; Wuyun, T.; Tan, X. Five complete chloroplast genome sequences from Diospyros: Genome organization and comparative analysis. PLoS ONE 2016, 11, 7. [Google Scholar] [CrossRef]
  33. Finn, R.; Clements, J.; Eddy, S. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, W29–W37. [Google Scholar] [CrossRef]
  34. Zhou, L.; Yarra, R.; Jin, L.; Cao, H. Genome-wide identification and expression analysis of MYB gene family in oil palm (Elaeis guineensis Jacq.) under abiotic stress conditions. Environ. Exp. Bot. 2020, 180, 104245. [Google Scholar] [CrossRef]
  35. Nguyen, L.; Schmidt, H.; Haeseler, A.; Minh, B. Iq-Tree: A fast and effective stochastic algorithm for estimating maxi-mum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  36. Katoh, K.; Standley, D. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  37. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.; Frank, M.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological dat. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  38. Cannon, S.; Mitra, A.; Baumgarten, A.; Young, N.; May, G. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana. BMC Plant Biol. 2004, 4, e102004. [Google Scholar] [CrossRef]
  39. Wang, L.; Qiu, T.; Yue, J.; Guo, N.; He, Y.; Han, X.; Wang, Q.; Jia, P.; Wang, H.; Li, M.; et al. Arabidopsis ADF1 is regulated by MYB73 and is involved in response to salt stress affecting actin filament organization. Plant Cell Physiol. 2021, 62, 1387–1395. [Google Scholar] [CrossRef]
  40. Persak, H.; Pitzschke, A. Dominant repression by arabidopsis transcription factor MYB44 causes oxidative damage and hypersensitivity to abiotic stress. Int. J. Mol. Sci. 2014, 15, 2517–2537. [Google Scholar] [CrossRef]
  41. Geng, P.; Zhang, S.; Liu, J.; Zhao, C.; Wu, J.; Cao, Y.; Fu, C.; Han, X.; He, H.; Zhao, Q. MYB20, MYB42, MYB43, and MYB85 regulate phenylalanine and lignin biosynthesis during secondary cell wall formation. Plant Physiol. 2020, 182, 1272–1283. [Google Scholar] [CrossRef]
  42. Fornale, S.; Lopez, E.; Salazar-Henao, J.; Fernandez-Nohales, P.; Rigau, J.; Caparros-Ruiz, D. AtMYB7, a new player in the regulation of uv-sunscreens in Arabidopsis thaliana. Plant Cell Physiol. 2014, 55, 507–516. [Google Scholar] [CrossRef] [PubMed]
  43. Su, F. Isolation and Characterization of MYB, Basic Helix-Loop-Helix and WD40 Transcription Factors Genes Involved in Persimmon Proanthocyanidin Metabolism; Huazhong Agricultural University: Wuhan, China, 2012. [Google Scholar]
  44. Zhang, C.; Ma, R.; Xu, J.; Yan, J.; Guo, L.; Song, J.; Feng, R.; Yu, M. Genome-wide identification and classification of MYB super-family genes in peach. PLoS ONE 2018, 13, e01991922018. [Google Scholar]
  45. Li, C.; Lu, S. Genome-wide characterization and comparative analysis of R2R3-MYB transcription factors shows the complexity of MYB-associated regulatory networks in Salvia miltiorrhiza. BMC Genom. 2014, 15, 277. [Google Scholar] [CrossRef] [PubMed]
  46. Zhang, N.; Ran, J.; Bao, S.; Ma, Y.; Marie, A.; Yan, K. Identification and expression analysis of MYB transcription factors in Glycyrrhiza uralensis. Mol. Plant Breed. 2023. [Google Scholar]
  47. Yang, K.; Li, Y.; Wang, S.; Xu, X. Genome-wide identification and expression analysis of the MYB transcription factor in moso bamboo (Phyllostachys edulis). Peer J. 2019, 6, e62422019. [Google Scholar] [CrossRef]
  48. Mmadi, M.; Dossa, K.; Wang, L.; Zhou, R.; Wang, Y.; Cisse, N.; Sy, M.; Zhang, X. Functional characterization of the versatile MYB gene family uncovered their important roles in plant development and responses to drought and waterlogging in sesame. Genes 2017, 8, 362. [Google Scholar] [CrossRef]
  49. Wang, N.; Ma, Q.; Ma, J.; Pei, W.; Liu, G.; Cui, Y.; Wu, M.; Zang, X.; Zhang, J.; Yu, S.; et al. A comparative genome-wide analysis of the R2R3-MYB gene family among four gossypium species and their sequence variation and association with fiber quality traits in an interspecific g. hirsutum × g. barbadense population. Front. Genet. 2019, 10, 741. [Google Scholar] [CrossRef]
  50. Prouse, M.; Campbell, M. The interaction between MYB proteins and their target DNA binding sites. Biochim. ET Biophys. Acta-Gene Regul. Mech. 2012, 1819, 67–77. [Google Scholar] [CrossRef]
  51. Ji, Q.; Wang, D.; Zhou, J.; Xu, Y.; Shen, B.; Zhou, F. Genome-wide characterization and expression analyses of the MYB super-family genes during developmental stages in Chinese jujube. Peer J. 2019, 7, e63532019. [Google Scholar]
  52. Liu, C.; Xie, T.; Chen, C.; Luan, A.; Long, J.; Li, C.; Ding, Y.; He, Y. Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple (Ananas comosus). BMC Genom. 2017, 18, 503. [Google Scholar] [CrossRef]
  53. Li, Z.; Peng, R.; Tian, Y.; Tian, Y.; Han, H.; Xu, J. Genome-Wide identification and analysis of the MYB transcription factor su-perfamily in Solanum lycopersicum. Plant Cell Physiol. 2016, 57, 1657–1677. [Google Scholar] [CrossRef]
  54. Xing, H.; Wu, J.; Wang, L. Research progress on the metabolism and regulation of astringent substances in fruits. J. Fruit Sci. 2023. [Google Scholar]
  55. Han, W.; Li, J.; Liang, Y.; Li, H.; Li, C.; Fu, J. Annual variation of soluble tannin in the fruits and leaves of persimmon. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2015, 39, 61–66. [Google Scholar]
Agriculture 13 00955 g001 550
Figure 1. Phylogenetic tree of R2R3-MYB proteins. The blue triangles represent 129 DoMYBs; the yellow triangles represent 126 AtMYBs. The names of each group are marked by English letters with Arabic numerals.
Figure 1. Phylogenetic tree of R2R3-MYB proteins. The blue triangles represent 129 DoMYBs; the yellow triangles represent 126 AtMYBs. The names of each group are marked by English letters with Arabic numerals.
Agriculture 13 00955 g001
Agriculture 13 00955 g002 550
Figure 2. Gene structure of R2R3-MYB genes in D. oleifera. The 129 DoMYB sequences were aligned by MAFFT, and the phylogenetic tree was constructed by IQ-tree. MYB motif (left); boxes of different colors represent different motifs. Intron and exon structure (right); yellow boxes for exons, black lines for introns, green boxes for untranslated regions.
Figure 2. Gene structure of R2R3-MYB genes in D. oleifera. The 129 DoMYB sequences were aligned by MAFFT, and the phylogenetic tree was constructed by IQ-tree. MYB motif (left); boxes of different colors represent different motifs. Intron and exon structure (right); yellow boxes for exons, black lines for introns, green boxes for untranslated regions.
Agriculture 13 00955 g002
Agriculture 13 00955 g003 550
Figure 3. Protein repeat sequence of R2 and R3 in DoMYB. The markers of R2 and R3 repeat sequences consist of motifs 3, 6, 2, 5, and 1. The total height of each stack represents the conservation of the MYB protein sequence at that location. English letters represent different types of amino acid residues.
Figure 3. Protein repeat sequence of R2 and R3 in DoMYB. The markers of R2 and R3 repeat sequences consist of motifs 3, 6, 2, 5, and 1. The total height of each stack represents the conservation of the MYB protein sequence at that location. English letters represent different types of amino acid residues.
Agriculture 13 00955 g003
Agriculture 13 00955 g004 550
Figure 4. Chromosome locations, region duplication, and predicted cluster for DoMYB. The scale is in megabases (Mb). Red lines show the segmental duplication of DoMYB genes. Blue lines show the tandem duplication of DoMYB genes.
Figure 4. Chromosome locations, region duplication, and predicted cluster for DoMYB. The scale is in megabases (Mb). Red lines show the segmental duplication of DoMYB genes. Blue lines show the tandem duplication of DoMYB genes.
Agriculture 13 00955 g004
Agriculture 13 00955 g005 550
Figure 5. Synteny analysis of R2R3-MYB genes between D. oleifera and Arabidopsis. Blue lines indicate homologous genes between D. oleifera and Arabidopsis.
Figure 5. Synteny analysis of R2R3-MYB genes between D. oleifera and Arabidopsis. Blue lines indicate homologous genes between D. oleifera and Arabidopsis.
Agriculture 13 00955 g005
Agriculture 13 00955 g006 550
Figure 6. Transcriptome expression of R2R3-MYB genes in D. oleifera. The genes with high or low expression were dyed red and blue respectively during the development period. Log2 (FPKM + 1) values were displayed according to the color code. The grey shows genes with no expression.
Figure 6. Transcriptome expression of R2R3-MYB genes in D. oleifera. The genes with high or low expression were dyed red and blue respectively during the development period. Log2 (FPKM + 1) values were displayed according to the color code. The grey shows genes with no expression.
Agriculture 13 00955 g006
Agriculture 13 00955 g007 550
Figure 7. Gene expression trends of DoMYB genes at different stages.
Figure 7. Gene expression trends of DoMYB genes at different stages.
Agriculture 13 00955 g007
Table
Table 1. The 10 μL PCR reaction system.
Table 1. The 10 μL PCR reaction system.
ReactantVolume (μL)
cDNA2
Forward Primer1
Reverse Primer1
RNase-free H2O1
iTaqTM Universal Syber Green PCR Master Mix5
Table
Table 2. The primer sequences.
Table 2. The primer sequences.
GeneForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)Tm (°C)
DoMYB16TTTGCTTCTGCAGCCGTCGCTCAAGGTTGAGGTCTGG60.9
DoMYB22GCTTGGACGAAGGAAGAAGACTTTCCACTGCGATGCAACC61.5
DoMYB56GATCCCTTCCAAAGGCTGCTGTGAAATTACCACGTTTGAG58.1
DoMYB85CTCATCGCTTACATCCGAGGAGGTAATTGATCCAGCGG58.0
Table
Table 3. Protein information of R2R3-MYB in D. oleifera.
Table 3. Protein information of R2R3-MYB in D. oleifera.
Gene NamePl (aa)MW (Da)PIAlpha
Helix (Hh)		Extend Strand (Ee)Beta Turn (Tt)Random Coil (Cc)
DoMYB144749,831.879.231473316251
DoMYB237642,563.756.401373811190
DoMYB347353,058.378.191654023245
DoMYB431535,216.815.62761515209
DoMYB523726,628.138.68881712120
DoMYB630734,743.545.891211111164
DoMYB742646,859.696.681462818234
DoMYB833037,558.845.53951612207
DoMYB919021,895.139.2274201581
DoMYB1030734,318.376.54613416196
DoMYB1118020,789.829.7168201379
DoMYB1217620,289.199.6061101392
DoMYB1331535,361.686.061083825144
DoMYB1420924,049.695.2590131492
DoMYB1527831,480.369.16973017134
DoMYB1624427,431.138.94822115126
DoMYB1747753,580.977.941644320250
DoMYB1824227,907.758.5484412142
DoMYB1974580,030.098.9716413138412
DoMYB2028232,411.608.151191613134
DoMYB2133336,681.786.601371728151
DoMYB2213515,755.009.965871060
DoMYB2335739,107.399.641092619203
DoMYB2428432,286.215.71821915168
DoMYB2532536,196.016.14117710191
DoMYB2629131,579.478.37971512167
DoMYB2742247,592.028.821175728220
DoMYB2830634,324.575.44892312182
DoMYB2935839,020.089.19852111241
DoMYB3029332,627.488.03105176165
DoMYB3130534,515.838.63961810181
DoMYB3233136,414.597.62851512219
DoMYB3333637,340.037.041102314189
DoMYB3430734,436.045.81851517190
DoMYB3532236,305.239.41762916201
DoMYB3633736,950.066.78833618200
DoMYB3732235,998.416.75122915176
DoMYB3829433,021.389.95933117153
DoMYB3930334,106.436.641141816155
DoMYB4032936,687.905.621052518181
DoMYB4125728,927.687.58961417130
DoMYB4225728,914.258.5784810155
DoMYB4336140,132.218.11138713203
DoMYB4434538,760.766.891602318144
DoMYB4529933,209.676.10751614194
DoMYB4630834,203.016.391011510182
DoMYB4731936,255.336.011104426139
DoMYB4821124,400.878.7783151598
DoMYB4926429,978.525.1887813156
DoMYB5026029,677.747.71811612151
DoMYB5129833,412.366.00871817176
DoMYB5224627,496.918.65484927122
DoMYB5332035,136.878.121202619155
DoMYB5426930,495.479.14149121890
DoMYB5522725,176.039.50732814112
DoMYB5621424,086.308.61681812116
DoMYB5729833,336.326.10832412179
DoMYB5826829,346.158.36602218168
DoMYB5945951,543.095.731653818238
DoMYB6027630,087.028.84932615142
DoMYB6132636,744.144.84892416197
DoMYB6226329,832.705.42841811150
DoMYB6324828,486.518.28932611118
DoMYB6415017,520.209.946591165
DoMYB6534338,660.605.68121186198
DoMYB6632836,744.145.37751713223
DoMYB6730834,665.815.601502316119
DoMYB6826930,023.705.25891612152
DoMYB6930434,383.197.15982614166
DoMYB7026830,117.188.7791218148
DoMYB7132936,389.435.45862114208
DoMYB7224027,555.098.2573314150
DoMYB7319421,813.426.0080161880
DoMYB7433837,928.476.111122311192
DoMYB7525529,174.585.9291215147
DoMYB7640143,298.306.101214218220
DoMYB7753258,007.835.771214218220
DoMYB7835740,912.839.311891713138
DoMYB7930034,227.616.32952312170
DoMYB8026330,501.715.3678617162
DoMYB8127531,064.007.051002011144
DoMYB8230033,664.539.811201117152
DoMYB8329032,913.669.471092721133
DoMYB8435639,191.545.391443515162
DoMYB8522325,287.939.06652713118
DoMYB8623827,029.517.74791518126
DoMYB8733537,946.415.271041913199
DoMYB8826730,934.378.96992513130
DoMYB8929733,889.728.8185188186
DoMYB9031534,912.495.821141213176
DoMYB9132436,292.586.411272916152
DoMYB9240044,426.445.201423923196
DoMYB9341846,206.039.281354516222
DoMYB9418821,414.056.777161398
DoMYB9535139,417.115.49123614208
DoMYB9619121,802.426.5269138101
DoMYB9730834,698.156.45752918186
DoMYB9830434,321.477.97842820172
DoMYB9935639,267.036.421302011195
DoMYB10032436,284.615.521161912177
DoMYB10124327,224.388.78116241984
DoMYB10232936,989.768.091161914180
DoMYB10328931,383.248.9983159182
DoMYB10432436,675.758.8474289213
DoMYB10537642,123.006.35985425199
DoMYB10632235,361.586.181241620163
DoMYB10729333,084.085.38724918154
DoMYB10830734,040.006.33982320166
DoMYB10921524,752.278.8384211595
DoMYB11027830,587.709.71894420125
DoMYB11136641,940.989.391902117138
DoMYB11243747,323.995.581192515278
DoMYB11329432,965.137.55109179159
DoMYB11430733,741.825.921231615153
DoMYB11542146,970.167.161071616282
DoMYB11629332,205.635.12713015177
DoMYB11734438,716.177.771231615153
DoMYB11821825,472.069.1811682272
DoMYB11925729,072.378.6887413153
DoMYB12030233,305.366.76117178160
DoMYB12129231,846.847.66803116165
DoMYB12232236,028.099.531242215161
DoMYB12342248,001.005.991082113280
DoMYB12432936,333.106.46803116165
DoMYB12532335,995.215.34921514202
DoMYB12622825,949.925.80881111118
DoMYB12719922,270.005.9189131384
DoMYB12826329,832.705.42841811150
DoMYB12934038,213.705.771271712184
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ji, K.; Liu, C.; Wu, K.; Yue, Z.; Dong, Y.; Gong, B.; Xu, Y. Genome-Wide Characterization of the R2R3-MYB Gene Family in Diospyros oleifera. Agriculture 2023, 13, 955. https://doi.org/10.3390/agriculture13050955

AMA Style

Ji K, Liu C, Wu K, Yue Z, Dong Y, Gong B, Xu Y. Genome-Wide Characterization of the R2R3-MYB Gene Family in Diospyros oleifera. Agriculture. 2023; 13(5):955. https://doi.org/10.3390/agriculture13050955

Chicago/Turabian Style

Ji, Kang, Cuiyu Liu, Kaiyun Wu, Zhihui Yue, Yi Dong, Bangchu Gong, and Yang Xu. 2023. "Genome-Wide Characterization of the R2R3-MYB Gene Family in Diospyros oleifera" Agriculture 13, no. 5: 955. https://doi.org/10.3390/agriculture13050955

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop