Next Article in Journal
Characterization of Free and Porous Silicon-Encapsulated Superparamagnetic Iron Oxide Nanoparticles as Platforms for the Development of Theranostic Vaccines
Previous Article in Journal
Foreign or Domestic CARs: Receptor Ligands as Antigen-Binding Domains
Previous Article in Special Issue
Crosstalk between Fibroblast Growth Factor (FGF) Receptor and Integrin through Direct Integrin Binding to FGF and Resulting Integrin-FGF-FGFR Ternary Complex Formation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cigarette Smoke Alters the Hematopoietic Stem Cell Niche

1
Department of Physiology, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA
2
Comprehensive Alcohol Research Center, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA
3
Alcohol and Drug Abuse Center of Excellence, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA
4
Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA
5
Department of Medicine, Section of Pulmonary and Critical Care Medicine, Louisiana State University Health Sciences Center, New Orleans, LA 70112, USA
6
Department of Surgery, Michigan State University, East Lansing, MI 48824, USA
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Med. Sci. 2014, 2(1), 37-50; https://doi.org/10.3390/medsci2010037
Submission received: 12 November 2013 / Revised: 18 January 2014 / Accepted: 10 February 2014 / Published: 18 February 2014
(This article belongs to the Special Issue Feature Papers 2013)

Abstract

Effects of tobacco smoke on hematologic derangements have received little attention. This study employed a mouse model of cigarette smoke exposure to explore the effects on bone marrow niche function. While lung cancer is the most widely studied consequence of tobacco smoke exposure, other malignancies, including leukemia, are associated with tobacco smoke exposure. Animals received cigarette smoke exposure for 6 h/day, 5 days/week for 9 months. Results reveal that the hematopoietic stem and progenitor cell (HSPC) pool size is reduced by cigarette smoke exposure. We next examined the effect of cigarette smoke exposure on one supporting cell type of the niche, the mesenchymal stromal cells (MSCs). Smoke exposure decreased the number of MSCs. Transplantation of naïve HSPCs into irradiated mice with cigarette smoke exposure yielded fewer numbers of engrafted HSPCs. This result suggests that smoke-exposed mice possess dysfunctional niches, resulting in abnormal hematopoiesis. Co-culture experiments using MSCs isolated from control or cigarette smoke-exposed mice with naïve HSPCs in vitro showed that MSCs from cigarette smoke-exposed mice generated marked expansion of naïve HSPCs. These data show that cigarette smoke exposure decreases in vivo MSC and HSC number and also increases pro-proliferative gene expression by cigarette smoke-exposed MSCs, which may stimulate HSPC expansion. These results of this investigation are clinically relevant to both bone marrow donors with a history of smoking and bone marrow transplant (BMT) recipients with a history of smoking.

1. Introduction

While pulmonary disorders are the most obvious manifestation of cigarette smoke-induced disease, there is a growing appreciation that smoking and chronic lung disease are associated with significant systemic consequences and comorbidities. Distal organ and tissue injury, linked to systemic inflammation and oxidative stress, commonly result in skeletal myopathy, cardiovascular disease, osteoporosis, depression and metabolic derangement.
Stem and progenitor cells play a pivotal role in tissue maintenance and repair in response to injury, and it has been proposed that resident and/or hematopoietic progenitor cell perturbations may be pathogenic in smoking-related emphysema [1]. Further, circulating endothelial and hematopoietic progenitors are particularly reduced in chronic obstructive pulmonary disease patients with low body mass index, suggesting that systemic disease is related to stem cell function [2].
Hematologic sequelae of tobacco smoke exposure include CD8+ cytotoxic T cell lymphocytosis and neutrophilia. BrdU labeling studies show decreased transit time through the post-mitotic pool of the bone marrow, consistent with chronic stimulation of hematopoiesis [3]. Despite the egress of maturing cells from the bone marrow, several studies have found fewer circulating CD34+ progenitor/stem cells in both smokers and patients with chronic lung disease [2,4,5,6]. Limited and conflicting data, using colony forming assays for hematopoietic progenitors, are available describing the effects of cigarette smoke and its constituents on bone marrow stem cells [7,8].
Within the bone marrow, hematopoiesis occurs within unique niches composed of many cell types including mesenchymal stromal cells (MSCs) and their progeny, endothelial cells, as well as the extracellular milieu [9]. Through the production of adhesion and soluble factors, MSCs participate in the regulation of activation and function of both long-term repopulating hematopoietic stem cells (LT-HSCs) and hematopoietic progenitor cells, which includes the activated short-term repopulating hematopoietic stem cells (ST-HSCs). LT-HSCs are capable of repopulating the immune system through serial bone marrow transplantations, while ST-HSCs have limited repopulation capacity [10]. The use of signaling lymphocyte activation molecule (SLAM) family of cell surface proteins has been shown to highly enrich LT-HSCs in mice studies [11]. Previous studies have shown that MSCs and their progeny express the alpha7 nicotinic receptor subunit and respond to nicotine, the primary active ingredient in cigarettes, in a dose-dependent manner [12,13,14]. Additionally, nicotine has been shown to perturb pre- and post-natal hematopoiesis [15]. In vitro low dose nicotine leads to enhanced survival, whereas high doses impair MSC differentiation and enhance apoptosis [7]. Exposure to unfractionated cigarette smoke extract also decreases both MSC differentiation and survival. Chronic smoke exposure’s impact on MSC-HSPC communication and subsequent effects on HSPC status remain unknown. We hypothesized that chronic smoke exposure decreases the bone marrow HSPC pool by perturbing the stem cell niche in a murine model. The results of this study may impact both bone marrow donors and BMT recipients.

2. Experimental Section

2.1. Animals

Female C57BL/6 mice (8 weeks old; National Cancer Institute) were housed (5/cage) in a specific pathogen-free facility with a 12 h light/dark cycle. Mice were maintained on a standard laboratory diet. Enhanced GFP (eGFP) transgenic mice (C57BL/6-Tg(UBC-GFP)30Scha/J; The Jackson Laboratory, Bar Harbor, ME, USA) were bred in the Louisiana State University Health Sciences Center, New Orleans animal care facility following an approved Institutional Animal Care and Use Committee (IACUC) protocol. The LSUHSC IACUC approved all experimental procedures in adherence to the National Institutes of Health guidelines prior to the initiation of experiments.

2.2. Cigarette Smoke Exposure

Smoke-exposed mice (mean ± SE: pre-exposure body weight 18.21 ± 0.16 g; post-exposure weight 25.37 ± 0.40 g; n = 20) were transferred to separate smoking cages and placed into Plexiglas® chambers (model TE-10, Teague Enterprises, Davis, CA, USA). Animals were next exposed to whole body mainstream and side stream smoke via inhalation from 3R4F research cigarettes (University of Kentucky, Lexington, KY, USA) at 100 mg/m3 total suspended particles (TSP) for 6 h/day, 5 days/week for 9 months. Control mice (pre-exposure body weight 18.24 ± 0.20 g; post-exposure weight 28.33 ± 1.17; n = 10) were kept in identical cages and exposed to filtered air in parallel with the experimental group.

2.3. Hematopoietic Bone Marrow Cell Isolation

Following 9 months of smoke exposure, femurs were isolated from both control and smoke exposure groups. Hematopoietic bone marrow cells (BMCs) were collected by centrifugation at 500× g for 5 min. Femurs were then flushed with 1 mL of PBS to collect any remaining cells. BMCs were next filtered through a 70 μm nylon cell strainer (BD Biosciences, San Jose, CA, USA). Erythrocytes were lysed with 1 mL RBC Lysis Solution (Qiagen, Valencia, CA, USA) for 3 min, washed with 3 mL PBS and centrifuged at 500× g for 5 min. Cell pellets were decanted and resuspended in 1 mL PBS for quantification and viability assessment with a hemocytometer by trypan blue exclusion.

2.4. Mesenchymal Stromal Cell Isolation and Colony Forming Unit-Fibroblast (CFU-f) Assays

Mesenchymal stromal cells (MSCs) were isolated from the bone marrow of 9 months smoke-exposed or control mice using two different methods. Briefly, bones (both femur and tibia) were crushed with pestle and digested with 0.25% collagenase 1 (Collagenase type 1, 290 U/mg, Worthington, Lakewood, NJ, USA). After digestion, cells were filtered through a 70-μm cell strainer (BD Biosciences), centrifuged at 500× g for 5 min, and resuspended in Complete Mesencult® Medium (StemCell Technologies, Vancouver, Canada). For the second method, bone marrow cells were collected by centrifugation of both femur and tibia at 500× g for 5 min. The bones were then flushed with 1 mL of sterile PBS to collect any remaining cells. Then cells were filtered through a 70-μm cell strainer and resuspended as stated above. Five million cells (in 2 mL media/well) were then plated in 6 well plates and incubated in a hypoxia incubator (5% O2 with 5% CO2) at 37 °C. MSCs are highly sensitive to atmospheric oxygen and have been shown to have enhanced proliferation when cultured with lower oxygen concentration. Upon achieving 70%–80% confluency, cells were released with 0.25% trypsin and aliquots preserved in freeze media (90% heat inactivated FBS + 10% DMSO) and stored in liquid N2 for future use. CFU-f assays were performed by incubating 106 cells (2 mL media/well) in 6 well plates under hypoxic conditions (5% CO2) at 37 °C. After two weeks of incubation, cells were Giemsa stained and colony counts determined. All experiments utilized the crush method for harvesting MSCs.

2.5. Cell Immunostaining and Flow Cytometry

BMCs were analyzed for hematopoietic stem and progenitor cell (HSPC) and MSC phenotypes using multicolor flow cytometry. HSPCs were defined by lineage (Lin)−/stem cell factor receptor (ckit)+/stem cell antigen-1 (Sca-1)+ and, long-term repopulating hematopoietic stem cells (LT-HSCs) were defined using signaling lymphocyte activation molecule (SLAM) family (Lin-CD48-CD150+) [11]. Nucleated BMCs were stained with monoclonal antibodies in StemSpan Serum-free Media (1 × 106 cells in 100 µL). All antibodies were purchased from eBioscience Inc. (San Diego, CA, USA) unless otherwise stated. Mouse biotin-conjugated hematopoietic lineage panel (10 µg/mL each) was added to BMCs and included CD3 (clone:145-2c11), CD45R/B220 (clone RA3-6B2), CD11b (clone M1/70), TER-119 (cloneTER-119), and Ly-6G (clone RB6-8c5) (eBioscience) or isotype control antibodies. Cells were incubated at room temperature (RT) in the dark for 15 min. Cells were washed in 2 mL of PBS at 500× g for 5 min, decanted, and resuspended in a mixture of PE-TxR-streptavidin (10 µg/mL; BD Biosciences) and fluorochrome-conjugated anti-mouse ckit (APC-AF750; clone 2B8), Sca-1 (PE-Cy5.5; clone D7), SLAM markers CD48 (APC; clone HM 48-1) and CD150 (PE; clone mshad 150), or isotype matched controls. BMCs were again incubated at RT in the dark for an additional 15 min. Cells were washed and resuspended in a final volume of 250 µL of PBS + 1% paraformaldehyde (PFA). Analysis was performed on a LSR-II flow cytometer with FACSDiva™ software [16]. All quantification was done on live cells only (LIVE/DEAD Fixable Dead Cell Stain, Life Technologies, Grand Island, NY, USA).

2.6. Bone Marrow Repopulation Assay

To measure HSPC repopulating ability, 9 months smoke-exposed and control mice were irradiated with 8 Gy (Mark 1 Irradiator, JL Shepherd & Associates, San Fernando, CA, USA) at 425 Rad/min for 1.88 min. Four hours after radiation, animals were transplanted with eGFP bone marrow cells (106) from 7–8 weeks old GFP transgenic mice (no smoke exposure) via jugular vein injection. Animals were not exposed to smoke after transplantation. Twenty weeks after transplantation, mice were sacrificed to collect bone marrow cells according to the protocol vida supra. GFP positive bone marrow cells were analyzed for HSPC engraftment by flow cytometry as aforementioned.

2.7. Mesenchymal and Hematopoietic Progenitor Cell Co-Culture

Passage 1 MSCs isolated from control and smoke-exposed mice were thawed and seeded onto 24 well plates in 1 mL of media at 25,000 cells/mL and incubated for 24 h in a humidified incubator at 37 °C and 5% CO2. Lineage negative cells were isolated from 7–8 weeks old eGFP transgenic mice (female) using a lineage cell depletion kit (Miltenyi Biotec Inc, Auburn, CA, USA) according to the manufacturer’s protocol. Lin-cells (104) were co-cultured with MSCs in StemSpan SFEM media (Stemcell Technologies, Vancouver, Canada) + 2% HI FBS. Cells were harvested and then analyzed using an LSRII flow cytometer (BD Biosciences) on day 1, 4, and 8 of co-culture. Only GFP+ cells were analyzed for HSPC populations.

2.8. Quantitative mRNA Expression

MSCs were co-cultured as described above along with two additional groups of control and smoke-exposed MSCs without eGFP+ HSPCs. After 24 h of co-culture, wells were washed with 0.5 mL of Cell Dissociation Solution (non-enzymatic, 1×; Sigma) for 1 min to remove HSPCs. Removal of eGFP+ cells was confirmed by fluorescence microscopy. Persistently adherent cells were then washed twice with PBS followed by trypsinization. The cells were then lysed and reverse transcription (RT) performed using the TaqMan® Gene Expression Cells-to-CT™ Kit (Ambion, Grand Island, NY, USA) according to the manufacturer’s protocol with one modification: RQ1 RNase-free DNase (Promega, Madison, WI, USA) was used in place of Ambion DNase. Real-time PCR was performed using 5 μL of a 1:5 dilution of either RT or no RT (NRT) reactions with RT2 SYBR® Green qPCR Mastermix (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. Gene expression (gene primers; Table 1) was measured using the iCycler iQ™ Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA) and the 2−ΔΔCT method was used to determine fold change with 18S rRNA as the housekeeping control. All primers were designed to cross exon-exon junctions to avoid possible amplification of residual DNA.

2.9. Statistical Analysis

Data are presented as mean ± SEM. The sample size is indicated in each figure legend. All statistical analysis was performed using GraphPad Prism Software™ [17]. Statistical analysis was conducted using unpaired Student’s t-test, non-parametric Mann-Whitney t-test, or two-way ANOVA, followed by Bonferroni post-tests (for comparisons between multiple groups). Asterisks and different letters denote statistical significance with p < 0.05.
Table 1. Primer sequences used for reverse transcription (RT)-qPCR analysis of niche mediators. 18S rRNA was used as a loading control to normalize results. Abbreviations: Angiopoietin 1 (Angpt1); Bone morphogenic protein 4 (Bmp4); N-cadherin (Cdh2); Chemokine (C-X-C motif) ligand 12 (Cxcl12); Dikkopf 2 (Dkk2); Jagged 1 (Jag1); Platelet-derived growth factor alpha (Pdgfa).
Table 1. Primer sequences used for reverse transcription (RT)-qPCR analysis of niche mediators. 18S rRNA was used as a loading control to normalize results. Abbreviations: Angiopoietin 1 (Angpt1); Bone morphogenic protein 4 (Bmp4); N-cadherin (Cdh2); Chemokine (C-X-C motif) ligand 12 (Cxcl12); Dikkopf 2 (Dkk2); Jagged 1 (Jag1); Platelet-derived growth factor alpha (Pdgfa).
Gene SymbolForward PrimerReverse Primer
18SATTCGAACGTCTGCCCTATCAGTCACCCGTGGTCACCATG
Angpt1GAGGATTGAGCTGATGGACTGACCGTGTAAGATCAAGCTGC
Bmp4GAGCAGAGCCAGGGAACGAAGAGGAAACGAAAAGCAGAG
Cdh2GGACAGCCCCTTCTCAATGTTCTCACAGCATACACCGTG
Cxcl12CGCTCTGCATCAGTGACGTGAAGGGCACAGTTTGGAG
Dkk2CAGTCAGCCAACCGATCTGCTTCCAACTTCACATTCCTTATCAC
Jag1CGAACCCCTGTCATAATGGAGACAGGTCCCGCTATTGTAAC
PdgfaGACCTCCAGCGACTCTTGCCTCAATACTTCTCTTCCTGCG

3. Results and Discussion

The current study examined the effects of cigarette smoke exposure on hematopoietic stem and progenitor cells (HSPCs) and on the hematopoietic stem cell niche in the bone marrow. We found that smoke exposure decreased HSPCs and showed a trend for decreased long-term repopulating hematopoietic stem cells (LT-HSCs), as defined by lineage (Lin)-c-kit+Sca-1+ (LKS) and signaling lymphocyte activation molecule (SLAM; Lin-CD48-CD150+) marker phenotypes, respectively [10,11]. This observed decrease in frequency of both ST-HSCs and LT-HSCs could be clinically significant for BMTs when using bone marrow donated from patients with a history of cigarette smoke exposure. Moreover, MSCs, the prototypic niche cell, were diminished in animals exposed to smoke and, as evidenced by repopulation studies, the smoke-exposed bone marrow is ill equipped to support HSPCs. These findings are further supported by ex vivo studies showing that key MSC-produced molecules are perturbed by smoke exposure and that smoke-exposed MSCs accelerate HSPC proliferation, providing an explanatory mechanism for the diminished bone marrow HSPC counts.
The niche comprises mesenchymal stromal cells (MSCs) and their progeny, endothelial cells, extracellular matrix, and soluble mediators [18]. The niche MSC lineage plays a major role in instructing HSPC fate, through either quiescence and self-renewal or lineage commitment toward mature blood cell types. Effects of cigarette smoke on the structure and function of the niche have yet to be explored.
Published evidence of the effects of cigarette smoke on various bone marrow cell populations have shown mixed results. Data from these studies demonstrated opposing effects of cigarette smoke extract and nicotine alone on function of MSCs and their progeny [7,19,20,21]. Other studies have reported dose-dependent effects of nicotine alone, with low dose nicotine enhancing MSC activity and osteoblastogenesis, while high dose nicotine inhibits these functions [12,13,14]. To date, only a handful of publications have assessed in vivo effects of smoke exposure on the hematopoietic microenvironment [8,22,23]. These studies have consistently shown enhanced hematopoietic activity as assessed by accelerated neutrophil differentiation and transit into the circulation [24]. Additionally, nicotine has been shown to lead to enhanced extramedullary hematopoiesis, which suggests disruption of the physiological functioning of the bone marrow niche microenvironment [8].

3.1. Cigarette Smoke Exposure Decreases the Number of Bone Marrow HSPCs

To investigate the effects of long term (9 months) smoke exposure on the quantity of bone marrow HSPCs, BMCs were analyzed by flow cytometry based on their cell surface marker expression. Bone marrow lineage negative (Lin) c-kit+Sca-1+ cells are enriched for hematopoietic stem cells, however the majority of these cells are short-term repopulating stem cells (ST-HSCs) and hematopoietic progenitor cells [25]. Our results show that Linc-kit+Sca-1+ cells were significantly fewer in the smoke-exposed bone marrow compared to controls (Figure 1A). We found no difference in the total number of BMCs between groups.
Figure 1. Flow cytometric analysis of hematopoietic stem/progenitor cells (HSPCs) following 9 months of control or smoke exposure. (A) Total Lin-c-kit+Sca-1+ (LKS; short-term repopulating hematopoietic stem cells (ST-HSCs)) per femur of control and smoke exposed mice; (B) Long-term (LT)-HSC identified by signaling lymphocyte activation molecule (SLAM) markers (Lin-CD48-CD150+) support the trend observed in the ST-HSC population. * p < 0.05; N = 12 for each group.
Figure 1. Flow cytometric analysis of hematopoietic stem/progenitor cells (HSPCs) following 9 months of control or smoke exposure. (A) Total Lin-c-kit+Sca-1+ (LKS; short-term repopulating hematopoietic stem cells (ST-HSCs)) per femur of control and smoke exposed mice; (B) Long-term (LT)-HSC identified by signaling lymphocyte activation molecule (SLAM) markers (Lin-CD48-CD150+) support the trend observed in the ST-HSC population. * p < 0.05; N = 12 for each group.
The SLAM family of cell surface markers (CD150 and CD48) has been shown to specifically identify murine long-term hematopoietic stem cells (LT-HSCs) [26]. This phenotype is maintained even under stress conditions in mice [11,27]. Employing SLAM markers, we found a trend for a decrease in total LT-HSCs in the cigarette smoke-exposed animals, but this data failed to reach significance (p = 0.1124; Figure 1B).

3.1.1. Cigarette Smoke Decreases the Number of Bone Marrow MSCs

Effects of cigarette smoke exposure on MSC number was assessed by FACS analysis and colony forming unit-fibroblast (CFU-f) activity were determined using the MesenCult® culture system. FACS analysis of MSCs isolated using the crush method showed a trend for decreased numbers of total Lin‑CD44+CD34+Sca-1+CD105+ cells. Both the marrow centrifugation with flushing method and the compact bone crush method were performed to isolate MSCs. Compared with control animals, smoke-exposed mice had significantly fewer CFU-f following both isolation methods (Figure 2B,C). However, we found more CFU-f using the compact bone crush method than centrifugation plus flushing, as expected. These results suggest that smoking reduces either the frequency of MSCs, the ability of MSCs to form colonies, or both. As the compact bone crush method isolates greater numbers of MSCs from bone, we utilized this isolation method for the remainder of the studies.
Figure 2. Smoke exposure decreases bone marrow mesenchymal stromal cells (MSCs). (A) Fluorescence-activated cell sorting (FACS) analysis of MSCs by surface phenotype; (B,C) Functional enumeration, based on colony forming unit-fibroblast (CFU-f) assays, is decreased in MSCs from smoke exposed animals. * p < 0.05; N = 6 for both groups.
Figure 2. Smoke exposure decreases bone marrow mesenchymal stromal cells (MSCs). (A) Fluorescence-activated cell sorting (FACS) analysis of MSCs by surface phenotype; (B,C) Functional enumeration, based on colony forming unit-fibroblast (CFU-f) assays, is decreased in MSCs from smoke exposed animals. * p < 0.05; N = 6 for both groups.

3.1.2. Cigarette Smoke Impairs the Engraftment of HSPCs in the Bone Marrow

To investigate the effects of smoking on HSPC engraftment, we reconstituted irradiated mice (both smoke-exposed and age-matched controls) with bone marrow cells from C57BL/6 eGFP-transgenic mice. The animals were not re-exposed to cigarette smoke after transplantation. Twenty weeks post-transplantation, HSPCs were analyzed by flow cytometry. The number of engrafted eGFP+ cells in the bone marrow of smoke-exposed mice was significantly reduced as compared to control animals (Figure 3A). GFP+ ST-HSCs were significantly greater in controls animals than in smoke-exposed mice (Figure 3B). Additionally, the GFP+ LT-HSCs were significantly reduced in the cigarette smoke-exposed bone marrow (Figure 3C).
Figure 3. Smoke exposure decreases cell engraftment after bone marrow transplantation. (A) Total GFP+ bone marrow cells; (B) GFP+ ST-HSCs; and (C) GFP+ LT-HSCs from control and cigarette smoke-exposed animals 20 weeks post-GFP+ bone marrow transplant. * p < 0.05; N = 6 for both groups.
Figure 3. Smoke exposure decreases cell engraftment after bone marrow transplantation. (A) Total GFP+ bone marrow cells; (B) GFP+ ST-HSCs; and (C) GFP+ LT-HSCs from control and cigarette smoke-exposed animals 20 weeks post-GFP+ bone marrow transplant. * p < 0.05; N = 6 for both groups.

3.1.3. Smoke-Exposed MSCs Promote Expansion of Primitive Bone Marrow Cells

Recent publications suggest that human MSCs support ex vivo expansion of HSPCs [28,29,30]. As an ex vivo model of a simplified hematopoietic stem cell niche, Lin-bone marrow cells from healthy, eGFP+ transgenic mice were co-cultured on monolayers of MSCs from control and smoke-exposed mice. eGFP+ HSPCs were assessed serially by flow cytometry. The total number of eGFP+Lin-CD48-CD150+ cells was significantly increased at day 4 and day 8 in wells containing smoke-exposed MSCs (Figure 4A). Co-culture with MSCs from smoke-exposed animals induced an expansion of eGFP+Lin-c-kit+Sca-1+ cells at day 4 but this cell type returned to baseline at day 8 (Figure 4B). One function of MSCs is to participate in maintaining HSC self-renewal [31,32]. These results demonstrate that smoke-exposed MSCs induced a pronounced expansion of Lin-CD48-CD150+ cells, which may be related to impaired HSPC differentiation. This hypothesis warrants further examination.
Figure 4. Co-culture of Lin-GFP+ HSPCs with MSCs isolated from control and smoke‑exposed animals. (A) MSCs isolated from smoke-exposed animals leads to increased numbers of Lin-GFP+CD48-CD150+ cells following 4 and 8 days of co-culture; (B) Lin-c-kit+Sca-1+ ST-HSCs are increased after 4 days of co-culture in the smoke‑exposed MSC group, but return to day 1 levels after 8 days. * p < 0.05; N = 5 for each group.
Figure 4. Co-culture of Lin-GFP+ HSPCs with MSCs isolated from control and smoke‑exposed animals. (A) MSCs isolated from smoke-exposed animals leads to increased numbers of Lin-GFP+CD48-CD150+ cells following 4 and 8 days of co-culture; (B) Lin-c-kit+Sca-1+ ST-HSCs are increased after 4 days of co-culture in the smoke‑exposed MSC group, but return to day 1 levels after 8 days. * p < 0.05; N = 5 for each group.

3.1.4. Cigarette Smoke Perturbs MSC Expression of Niche Molecules

MSCs play a pivotal role in maintaining homeostasis of the bone marrow niche through the expression of an array of signaling molecules. As MSC niche molecule expression is informed by feedback interaction with target cells, experimental and control MSCs were co-cultured for 24 h with eGFP+Lin- bone marrow cells from healthy mice. Removal of eGFP+ hematopoietic cells was confirmed by inspection for residual fluorescence after washing and, total MSC RNA was extracted to determine their gene expression of putative regulators of niche function (Table 2) [18,33]. We found the highest expression of Angiopoietin 1 (Angpt1) in control MSCs co-cultured with HSPCs. Smoke-exposed MSCs with or without co-culture showed a 60% reduction in gene expression as compared to control. Bone morphogenic protein 4 (BMP4) and Cxcl12 were both decreased in smoke-exposed MSC groups. MSCs from smoke-exposed mice had decreased expression of Dikkopf 2 (Dkk2) and showed over a 200% increase in Jagged 1 (Jag1) expression. Finally, platelet-derived growth factor alpha (Pdgfa) showed a 143% increase in expression from MSCs isolated from smoke-exposed mice. These data indicate that smoke-exposed MSCs have aberrant gene expression across multiple pathways that are known to regulate hematopoiesis, and likely contribute to a dysfunctional niche.
Table 2. RT-qPCR analysis of MSC niche mediators from control and smoke-exposed animals were cultured alone or co-cultured with naïve Lin-GFP+ HSPCs for 1 day. Smoke exposure led to down regulation of all but two of the analyzed genes, Jagged1 and Platelet-derived growth factor-α. Data are expressed as a percent change from control ± SEM (MSC alone). Different letters in parenthesis next to the percent values signify statistical significance; p < 0.05. Abbreviations: Angiopoietin 1 (Angpt1); Bone morphogenic protein 4 (Bmp4); N-cadherin (Cdh2); Chemokine (C-X-C motif) ligand 12 (Cxcl12); Dikkopf 2 (Dkk2); Jagged 1(Jag1); Platelet-derived growth factor alpha (Pdgfa).
Table 2. RT-qPCR analysis of MSC niche mediators from control and smoke-exposed animals were cultured alone or co-cultured with naïve Lin-GFP+ HSPCs for 1 day. Smoke exposure led to down regulation of all but two of the analyzed genes, Jagged1 and Platelet-derived growth factor-α. Data are expressed as a percent change from control ± SEM (MSC alone). Different letters in parenthesis next to the percent values signify statistical significance; p < 0.05. Abbreviations: Angiopoietin 1 (Angpt1); Bone morphogenic protein 4 (Bmp4); N-cadherin (Cdh2); Chemokine (C-X-C motif) ligand 12 (Cxcl12); Dikkopf 2 (Dkk2); Jagged 1(Jag1); Platelet-derived growth factor alpha (Pdgfa).
Gene SymbolMSCCo-CultureMSC-CSECo-Culture-CSE
Angpt1100 ± 18 (a)356 ± 110 (b)40 ± 8 (a)41 ± 12 (a)
Bmp4100 ± 44 (a)113 ± 30 (a)18 ± 6 (a)34 ± 21 (a)
Cdh2100 ± 9 (a,b)110 ± 23 (b)64 ± 5 (a,b)40 ± 13 (a)
Cxcl12100 ± 12 (a)51 ± 13 (b,c)69 ± 7 (a,b)18 ± 7 (c)
Dkk2100 ± 4 (a)50 ± 20 (b)26 ± 8 (b,c)9 ± 3 (c)
Jag1100 ± 12 (a)31 ± 5 (a)203 ± 37 (b)26 ± 9 (a)
Pdgfa100 ± 3 (a)43 ± 5 (b)143 ± 18 (c)29 ± 9 (b)

4. Conclusions

These data support our hypothesis that hematologic changes in cigarette smokers are caused by damage to niche cells, specifically MSCs and their progeny. We have shown that smoke exposure decreased HSPC pool size and concomitantly deceased MSC number. The decreased number of MSCs corresponded to a decrease in naïve HSPC engraftment after bone marrow transplantation in smoke-exposed animals. In spite of this decrease in engraftment and number of HSPCs and MSCs, smoke exposure also altered MSC gene expression of pro-proliferative signaling proteins. Our data thus suggest that smoke exposure leads to dysregulation of hematopoiesis through disruption of MSC signaling pathways in addition to decreasing MSC number. This may serve as one mechanism by which smoke exposure promotes greater peripheral leukocyte production in cigarette smokers. These data also offer potential targets of therapeutic intervention with regards to both bone marrow donor and transplant recipient with a history of cigarette smoke exposure.

Acknowledgments

We thank Connie Porretta for assistance in flow cytometry and Joe Soblosky and Venkat Subramaniam for technical support. We are grateful to Meredith Booth for her help with the generation of figures. This work was supported by grants from the National Institutes of Health (HL073770, AA009803, AA020312, and AA019676).

Author Contributions

RWS, FH, PZ, and DAW contributed to study conception and design; RWS, FH, and TR contributed to the acquisition of data; RWS, FH, TR, JNM, PZ, and DAW contributed to analysis and interpretation of data, drafting of the manuscript, and critical revisions of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Taraseviciene-Stewart, L.; Voelkel, N.F. Molecular pathogenesis of emphysema. J. Clin. Invest. 2008, 118, 394–402. [Google Scholar] [CrossRef]
  2. Huertas, A.; Testa, U.; Riccioni, R.; Petrucci, E.; Riti, V.; Savi, D.; Serra, P.; Bonsignore, M.R.; Palange, P. Bone marrow-derived progenitors are greatly reduced in patients with severe COPD and low-BMI. Respir. Physiol. Neurobiol. 2010, 170, 23–31. [Google Scholar] [CrossRef]
  3. Terashima, T.; Wiggs, B.; English, D.; Hogg, J.C.; van Eeden, S.F. Phagocytosis of small carbon particles (PM10) by alveolar macrophages stimulates the release of polymorphonuclear leukocytes from bone marrow. Am. J. Respir. Crit. Care Med. 1997, 155, 1441–1447. [Google Scholar] [CrossRef]
  4. Kondo, T.; Hayashi, M.; Takeshita, K.; Numaguchi, Y.; Kobayashi, K.; Iino, S.; Inden, Y.; Murohara, T. Smoking cessation rapidly increases circulating progenitor cells in peripheral blood in chronic smokers. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 1442–1447. [Google Scholar] [CrossRef]
  5. Bonsignore, M.R.; Palange, P.; Testa, U.; Huertas, A.; Antonucci, R.; Serra, P.; Bonsignore, G. Circulating CD34+ cells are decreased in chronic obstructive pulmonary disease. Proc. Am. Thorac. Soc. 2006, 3, 537–538. [Google Scholar] [CrossRef]
  6. Ludwig, A.; Jochmann, N.; Kertesz, A.; Kuhn, C.; Mueller, S.; Gericke, C.; Baumann, G.; Stangl, K.; Stangl, V. Smoking decreases the level of circulating CD34+ progenitor cells in young healthy women—A pilot study. BMC Wom. Health 2010, 10, 20. [Google Scholar] [CrossRef]
  7. Gullihorn, L.; Karpman, R.; Lippiello, L. Differential effects of nicotine and smoke condensate on bone cell metabolic activity. J. Orthop. Trauma 2005, 19, 17–22. [Google Scholar] [CrossRef]
  8. Pandit, T.S.; Sikora, L.; Muralidhar, G.; Rao, S.P.; Sriramarao, P. Sustained exposure to nicotine leads to extramedullary hematopoiesis in the spleen. Stem Cells 2006, 24, 2373–2381. [Google Scholar] [CrossRef]
  9. Ema, H.; Suda, T. Two anatomically distinct niches regulate stem cell activity. Blood 2012, 120, 2174–2181. [Google Scholar] [CrossRef]
  10. Chang, E.; Forsberg, E.C.; Wu, J.; Wang, B.; Prohaska, S.S.; Allsopp, R.; Weissman, I.L.; Cooke, J.P. Cholinergic activation of hematopoietic stem cells: Role in tobacco-related disease? Vasc. Med. 2010, 15, 375–385. [Google Scholar] [CrossRef]
  11. Yilmaz, O.H.; Kiel, M.J.; Morrison, S.J. SLAM family markers are conserved among hematopoietic stem cells from old and reconstituted mice and markedly increase their purity. Blood 2006, 107, 924–930. [Google Scholar] [CrossRef]
  12. Schraufstatter, I.; DiScipio, R.G.; Khaldoyanidi, S. Alpha 7 subunit of nAChR regulates migration of human mesenchymal stem cells. J. Stem Cells 2010, 4, 203–216. [Google Scholar]
  13. Deng, Y.; Li, T.Q.; Yan, Y.E.; Magdalou, J.; Wang, H.; Chen, L.B. Effect of nicotine on chondrogenic differentiation of rat bone marrow mesenchymal stem cells in alginate bead culture. Biomed. Mater. Eng. 2012, 22, 81–87. [Google Scholar]
  14. Kim, D.H.; Liu, J.; Bhat, S.; Benedict, G.; Lecka-Czernik, B.; Peterson, S.J.; Ebraheim, N.A.; Heck, B.E. Peroxisome proliferator-activated receptor delta agonist attenuates nicotine suppression on human mesenchymal stem cell-derived osteogenesis and involves increased expression of heme oxygenase-1. J. Bone Miner. Metab. 2013, 31, 44–52. [Google Scholar] [CrossRef]
  15. Serobyan, N.; Jagannathan, S.; Orlovskaya, I.; Schraufstatter, I.; Skok, M.; Loring, J.; Khaldoyanidi, S. The cholinergic system is involved in regulation of the development of the hematopoietic system. Life Sci. 2007, 80, 2352–2360. [Google Scholar] [CrossRef]
  16. FACSDiva software™, version 6.1.3; BD Biosciences: San Jose, CA, USA, 2009.
  17. GrapPad Prism Software™, version 5.03; GraphPad Software Inc.: La Jolla, CA, USA, 2010.
  18. Levesque, J.P.; Helwani, F.M.; Winkler, I.G. The endosteal “osteoblastic” niche and its role in hematopoietic stem cell homing and mobilization. Leukemia 2010, 24, 1979–1992. [Google Scholar] [CrossRef]
  19. Fang, M.A.; Frost, P.J.; Iida-Klein, A.; Hahn, T.J. Effects of nicotine on cellular function in UMR 106–01 osteoblast-like cells. Bone 1991, 12, 283–286. [Google Scholar] [CrossRef]
  20. Ramp, W.K.; Lenz, L.G.; Galvin, R.J. Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells. Proc. Soc. Exp. Biol. Med. 1991, 197, 36–43. [Google Scholar] [CrossRef]
  21. Liu, X.D.; Zhu, Y.K.; Umino, T.; Spurzem, J.R.; Romberger, D.J.; Wang, H.; Reed, E.; Rennard, S.I. Cigarette smoke inhibits osteogenic differentiation and proliferation of human osteoprogenitor cells in monolayer and three-dimensional collagen gel culture. J. Lab. Clin. Med. 2001, 137, 208–219. [Google Scholar] [CrossRef]
  22. Khaldoyanidi, S.; Sikora, L.; Orlovskaya, I.; Matrosova, V.; Kozlov, V.; Sriramarao, P. Correlation between nicotine-induced inhibition of hematopoiesis and decreased CD44 expression on bone marrow stromal cells. Blood 2001, 98, 303–312. [Google Scholar] [CrossRef]
  23. Zhou, J.; Eksioglu, E.A.; Fortenbery, N.R.; Chen, X.; Wang, H.; Epling-Burnette, P.K.; Djeu, J.Y.; Wei, S. Bone marrow mononuclear cells up-regulate toll-like receptor expression and produce inflammatory mediators in response to cigarette smoke extract. PLoS One 2011, 6, e21173. [Google Scholar] [CrossRef]
  24. Terashima, T.; Wiggs, B.; English, D.; Hogg, J.C.; van Eeden, S.F. The effect of cigarette smoking on the bone marrow. Am. J. Respir. Crit. Care Med. 1997, 155, 1021–1026. [Google Scholar] [CrossRef]
  25. Zhao, Y.; Lin, Y.; Zhan, Y.; Yang, G.; Louie, J.; Harrison, D.E.; Anderson, W.F. Murine hematopoietic stem cell characterization and its regulation in BM transplantation. Blood 2000, 96, 3016–3022. [Google Scholar]
  26. Kiel, M.J.; Yilmaz, O.H.; Iwashita, T.; Yilmaz, O.H.; Terhorst, C.; Morrison, S.J. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 2005, 121, 1109–1121. [Google Scholar] [CrossRef]
  27. Liang, Y.; van Zant, G.; Szilvassy, S.J. Effects of aging on the homing and engraftment of murine hematopoietic stem and progenitor cells. Blood 2005, 106, 1479–1487. [Google Scholar] [CrossRef]
  28. Koh, S.H.; Choi, H.S.; Park, E.S.; Kang, H.J.; Ahn, H.S.; Shin, H.Y. Co-culture of human CD34+ cells with mesenchymal stem cells increases the survival of CD34+ cells against the 5-aza-deoxycytidine- or trichostatin A-induced cell death. Biochem. Biophys. Res. Commun. 2005, 329, 1039–1045. [Google Scholar] [CrossRef]
  29. Li, N.; Feugier, P.; Serrurrier, B.; Latger-Cannard, V.; Lesesve, J.F.; Stoltz, J.F.; Eljaafari, A. Human mesenchymal stem cells improve ex vivo expansion of adult human CD34+ peripheral blood progenitor cells and decrease their allostimulatory capacity. Exp. Hematol. 2007, 35, 507–515. [Google Scholar] [CrossRef]
  30. Sharma, M.B.; Limaye, L.S.; Kale, V.P. Mimicking the functional hematopoietic stem cell niche in vitro: Recapitulation of marrow physiology by hydrogel-based three-dimensional cultures of mesenchymal stromal cells. Haematologica 2012, 97, 651–660. [Google Scholar] [CrossRef]
  31. Ding, L.; Morrison, S.J. Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches. Nature 2013, 495, 231–235. [Google Scholar] [CrossRef]
  32. Greenbaum, A.; Hsu, Y.M.; Day, R.B.; Schuettpelz, L.G.; Christopher, M.J.; Borgerding, J.N.; Nagasawa, T.; Link, D.C. CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature 2013, 495, 227–230. [Google Scholar] [CrossRef]
  33. Lataillade, J.J.; Pierre-Louis, O.; Hasselbalch, H.C.; Uzan, G.; Jasmin, C.; Martyre, M.C.; Le Bousse-Kerdiles, M.C.; French INSERM and the European EUMNET Networks on Myelofibrosis. Does primary myelofibrosis involve a defective stem cell niche? From concept to evidence. Blood 2008, 112, 3026–3035. [Google Scholar] [CrossRef]

Share and Cite

MDPI and ACS Style

Siggins, R.W.; Hossain, F.; Rehman, T.; Melvan, J.N.; Zhang, P.; Welsh, D.A. Cigarette Smoke Alters the Hematopoietic Stem Cell Niche. Med. Sci. 2014, 2, 37-50. https://doi.org/10.3390/medsci2010037

AMA Style

Siggins RW, Hossain F, Rehman T, Melvan JN, Zhang P, Welsh DA. Cigarette Smoke Alters the Hematopoietic Stem Cell Niche. Medical Sciences. 2014; 2(1):37-50. https://doi.org/10.3390/medsci2010037

Chicago/Turabian Style

Siggins, Robert W., Fokhrul Hossain, Tayyab Rehman, John N. Melvan, Ping Zhang, and David A. Welsh. 2014. "Cigarette Smoke Alters the Hematopoietic Stem Cell Niche" Medical Sciences 2, no. 1: 37-50. https://doi.org/10.3390/medsci2010037

APA Style

Siggins, R. W., Hossain, F., Rehman, T., Melvan, J. N., Zhang, P., & Welsh, D. A. (2014). Cigarette Smoke Alters the Hematopoietic Stem Cell Niche. Medical Sciences, 2(1), 37-50. https://doi.org/10.3390/medsci2010037

Article Metrics

Back to TopTop