Health-Promoting Additives Supplemented in Inert Microdiets for Whiteleg Shrimp (Penaeus vannamei) Post-Larvae: Effects on Growth, Survival, and Health Status
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Dietary Treatments
2.2. Shrimp Rearing and Sampling
2.3. Oxidative Stress and Immunity-Related Biomarkers
2.3.1. Sample Preparation
2.3.2. Determination of Oxidative Stress Biomarkers
2.3.3. Analysis of Immune Parameters
2.3.4. Gene Expression Analysis
2.4. Data Analysis
3. Results
3.1. Growth Performance
3.2. Oxidative Stress and Immune Status Related Biomarkers
3.3. Gene Expression Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2022; FAO: Rome, Italy, 2022. [Google Scholar] [CrossRef]
- Song, Y.L.; Li, C.Y. Shrimp Immune System—Special Focus on Penaeidin. J. Mar. Sci. Technol. 2014, 22, 1–8. [Google Scholar] [CrossRef]
- de La Peña, L.D.; Cabillon, N.A.R.; Catedral, D.D.; Amar, E.C.; Usero, R.C.; Monotilla, W.D.; Calpe, A.T.; Fernandez, D.D.G.; Saloma, C.P. Acute Hepatopancreatic Necrosis Disease (AHPND) Outbreaks in Penaeus vannamei and P. monodon Cultured in the Philippines. Dis. Aquat. Org. 2015, 116, 251–254. [Google Scholar] [CrossRef] [Green Version]
- Shinn, A.P.; Pratoomyot, J.; Griffiths, D.; Trong, T.Q.; Vu, N.T.; Jiravanichpaisal, P.; Briggs, M. Asian Shrimp Production and the Economic Costs of Disease. Asian Fish. Sci. 2018, 31, 29–58. [Google Scholar] [CrossRef]
- Lulijwa, R.; Rupia, E.J.; Alfaro, A.C. Antibiotic Use in Aquaculture, Policies and Regulation, Health and Environmental Risks: A Review of the Top 15 Major Producers. Rev. Aquac. 2020, 12, 640–663. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S.; Esteban, M.Á. Beneficial Roles of Feed Additives as Immunostimulants in Aquaculture: A Review. Rev. Aquac. 2018, 10, 950–974. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, W.N.; Wang, A.L.; Wang, J.M.; Sun, R.Y. Effects of Dietary Vitamin E Supplementation on Antioxidant Enzyme Activities in Litopenaeus vannamei (Boone, 1931) Exposed to Acute Salinity Changes. Aquaculture 2007, 265, 351–358. [Google Scholar] [CrossRef]
- Wang, Y.B. Effect of Probiotics on Growth Performance and Digestive Enzyme Activity of the Shrimp Penaeus vannamei. Aquaculture 2007, 269, 259–264. [Google Scholar] [CrossRef]
- Tseng, D.Y.; Ho, P.L.; Huang, S.Y.; Cheng, S.C.; Shiu, Y.L.; Chiu, C.S.; Liu, C.H. Enhancement of Immunity and Disease Resistance in the White Shrimp, Litopenaeus vannamei, by the Probiotic, Bacillus subtilis E20. Fish Shellfish Immunol. 2009, 26, 339–344. [Google Scholar] [CrossRef]
- Yang, S.P.; Wu, Z.H.; Jian, J.C.; Zhang, X.Z. Effect of Marine Red Yeast Rhodosporidium paludigenum on Growth and Antioxidant Competence of Litopenaeus vannamei. Aquaculture 2010, 309, 62–65. [Google Scholar] [CrossRef]
- Zokaeifar, H.; Balcázar, J.L.; Saad, C.R.; Kamarudin, M.S.; Sijam, K.; Arshad, A.; Nejat, N. Effects of Bacillus subtilis on the Growth Performance, Digestive Enzymes, Immune Gene Expression and Disease Resistance of White Shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2012, 33, 683–689. [Google Scholar] [CrossRef] [Green Version]
- Yue, Y.R.; Liu, Y.J.; Tian, L.X.; Gan, L.; Yang, H.J.; Liang, G.Y.; He, J.Y. The Effect of Dietary Taurine Supplementation on Growth Performance, Feed Utilization and Taurine Contents in Tissues of Juvenile White Shrimp (Litopenaeus vannamei, Boone, 1931) Fed with Low-Fishmeal Diets. Aquac. Res. 2013, 44, 1317–1325. [Google Scholar] [CrossRef]
- Façanha, F.N.; Oliveira-Neto, A.R.; Figueiredo-Silva, C.; Nunes, A.J.P. Effect of Shrimp Stocking Density and Graded Levels of Dietary Methionine over the Growth Performance of Litopenaeus vannamei Reared in a Green-Water System. Aquaculture 2016, 463, 16–21. [Google Scholar] [CrossRef]
- Wu, Y.S.; Liau, S.Y.; Huang, C.T.; Nan, F.H. Beta 1,3/1,6-Glucan and Vitamin C Immunostimulate the Non-Specific Immune Response of White Shrimp (Litopenaeus vannamei). Fish Shellfish Immunol. 2016, 57, 269–277. [Google Scholar] [CrossRef] [PubMed]
- Chien, C.C.; Lin, T.Y.; Chi, C.C.; Liu, C.H. Probiotic, Bacillus subtilis E20 Alters the Immunity of White Shrimp, Litopenaeus vannamei via Glutamine Metabolism and Hexosamine Biosynthetic Pathway. Fish Shellfish Immunol. 2020, 98, 176–185. [Google Scholar] [CrossRef]
- Ji, R.; Wang, Z.; He, J.; Masagounder, K.; Xu, W.; Mai, K.; Ai, Q. Effects of DL-Methionyl-DL-Methionine Supplementation on Growth Performance, Immune and Antioxidative Responses of White Leg Shrimp (Litopenaeus vannamei) Fed Low Fishmeal Diet. Aquac. Rep. 2021, 21, 100785. [Google Scholar] [CrossRef]
- To, V.A.; Liou, C.H.; der Yang, S. Can Dietary with a Taurine Supplement Improve Lipid Utilization, Growth Performance, Haemolymph Parameters and Immune Responses of White Shrimp (Litopenaeus vannamei)? Aquac. Rep. 2021, 52, 6612–6625. [Google Scholar] [CrossRef]
- Wang, L.; Li, X.; Lu, K.; Song, K.; Wang, G.; Zhang, C. Dietary Hydroxyl Methionine Selenium Supplementation Enhances Growth Performance, Antioxidant Ability and Nitrite Tolerance of Litopenaeus vannamei. Aquaculture 2021, 537, 736513. [Google Scholar] [CrossRef]
- Ruff, N.; Lavens, P.; Huo, J.-Z.; Sorgeloos, P.; Nelis, H.J.; de Leenheer, A. Antioxidant Effect of Dietary Tocopherol and Ascorbic Acid on Growth and Survival of Litopenaeus vannamei Postlarvae. Aquac. Int. 2001, 9, 115–126. [Google Scholar] [CrossRef]
- Miandare, H.K.; Yarahmadi, P.; Abbasian, M. Immune Related Transcriptional Responses and Performance of Litopenaeus vannamei Post-Larvae Fed on Dietary Probiotic PrimaLac®. Fish Shellfish Immunol. 2016, 55, 671–678. [Google Scholar] [CrossRef]
- Miandare, H.K.; Mirghaed, A.T.; Hosseini, M.; Mazloumi, N.; Zargar, A.; Nazari, S. Dietary Immunogen® Modulated Digestive Enzyme Activity and Immune Gene Expression in Litopenaeus vannamei Post Larvae. Fish Shellfish Immunol. 2017, 70, 621–627. [Google Scholar] [CrossRef]
- Madani, N.S.H.; Adorian, T.J.; Farsani, H.G.; Hoseinifar, S.H. The Effects of Dietary Probiotic Bacilli (Bacillus subtilis and Bacillus licheniformis) on Growth Performance, Feed Efficiency, Body Composition and Immune Parameters of Whiteleg Shrimp (Litopenaeus vannamei) Postlarvae. Aquac. Rep. 2018, 49, 1926–1933. [Google Scholar] [CrossRef]
- Costas, B.; Couto, A.; Azeredo, R.; Machado, M.; Krogdahl, Å.; Oliva-Teles, A. Gilthead Seabream (Sparus aurata) Immune Responses Are Modulated after Feeding with Purified Antinutrients. Fish Shellfish Immunol. 2014, 41, 70–79. [Google Scholar] [CrossRef] [PubMed]
- Clairborne, A. Catalase activity. In Handbook of Methods in Oxygen Radical Research; Greenwald, R.A., Ed.; CRC Press: Boca Raton, FL, USA, 1985; pp. 283–284. [Google Scholar]
- Torres, M.A.; Testa, C.P.; Gáspari, C.; Beatriz Masutti, M.; Maria Neves Panitz, C.; Curi-Pedrosa, R.; Alves de Almeida, E.; di Mascio, P.; Wilhelm Filho, D. Oxidative Stress in the Mussel Mytella guyanensis from Polluted Mangroves on Santa Catarina Island, Brazil. Mar. Pollut. Bull. 2002, 44, 923–932. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, A.C.M.; Gravato, C.; Quintaneiro, C.; Bordalo, M.D.; Barata, C.; Soares, A.M.V.M.; Pestana, J.L.T. Energetic Costs and Biochemical Biomarkers Associated with Esfenvalerate Exposure in Sericostoma vittatum. Chemosphere 2017, 189, 445–453. [Google Scholar] [CrossRef]
- Costas, B.; Conceição, L.E.C.; Aragão, C.; Martos, J.A.; Ruiz-Jarabo, I.; Mancera, J.M.; Afonso, A. Physiological Responses of Senegalese Sole (Solea senegalensis Kaup, 1858) after Stress Challenge: Effects on Non-Specific Immune Parameters, Plasma Free Amino Acids and Energy Metabolism. Aquaculture 2011, 316, 68–76. [Google Scholar] [CrossRef]
- Ji, P.F.; Yao, C.L.; Wang, Z.Y. Immune Response and Gene Expression in Shrimp (Litopenaeus vannamei) Hemocytes and Hepatopancreas against Some Pathogen-Associated Molecular Patterns. Fish Shellfish Immunol. 2009, 27, 563–570. [Google Scholar] [CrossRef]
- Machado, M.; Azeredo, R.; Díaz-Rosales, P.; Afonso, A.; Peres, H.; Oliva-Teles, A.; Costas, B. Dietary Tryptophan and Methionine as Modulators of European Seabass (Dicentrarchus labrax) Immune Status and Inflammatory Response. Fish Shellfish Immunol. 2015, 42, 353–362. [Google Scholar] [CrossRef] [Green Version]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, 45. [Google Scholar] [CrossRef]
- Wang, Y.; Li, M.; Filer, K.; Xue, Y.; Ai, Q.; Mai, K. Evaluation of Schizochytium meal in microdiets of Pacific white shrimp (Litopenaeus vannamei) larvae. Aquac. Rep. 2017, 48, 2328–2336. [Google Scholar] [CrossRef]
- Wang, Y.; Li, M.; Filer, K.; Xue, Y.; Ai, Q.; Mai, K. Replacement of fish oil with a DHA-rich Schizochytium meal on growth performance, activities of digestive enzyme and fatty acid profile of Pacific white shrimp (Litopenaeus vannamei) larvae. Aquac. Nutr. 2017, 23, 1113–1120. [Google Scholar] [CrossRef]
- NRC. Nutrient Requirements of Fish and Shrimp; National Academy Press: Washington, DC, USA, 2011. [Google Scholar] [CrossRef]
- Destoumieux, D.; Munoz, M.; Bulet, P.; Bachère, E. Penaeidins, a Family of Antimicrobial Peptides from Penaeid Shrimp (Crustacea, Decapoda). Cell. Mol. Life Sci. 2000, 57, 1260–1271. [Google Scholar] [CrossRef] [Green Version]
- Muñoz, M.; Vandenbulcke, F.; Gueguen, Y.; Bachère, E. Expression of Penaeidin Antimicrobial Peptides in Early Larval Stages of the Shrimp Penaeus vannamei. Dev. Comp. Immunol. 2003, 27, 283–289. [Google Scholar] [CrossRef]
- Mishra, J.K.; Samocha, T.M.; Patnaik, S.; Speed, M.; Gandy, R.L.; Ali, A.M. Performance of an Intensive Nursery System for the Pacific White Shrimp, Litopenaeus vannamei, under Limited Discharge Condition. Aquac. Eng. 2008, 38, 2–15. [Google Scholar] [CrossRef]
- Qiu, X.; Buentello, A.; Shannon, R.; Mustafa, A.; Abebe, A.; Davis, D.A. Evaluation of Three Non-Genetically Modified Soybean Cultivars as Ingredients and a Yeast-Based Additive as a Supplement in Practical Diets for Pacific White Shrimp Litopenaeus vannamei. Aquac. Nutr. 2018, 24, 173–183. [Google Scholar] [CrossRef]
- Xie, J.J.; Lemme, A.; He, J.Y.; Yin, P.; Figueiredo-Silva, C.; Liu, Y.J.; Xie, S.W.; Niu, J.; Tian, L.X. Fishmeal Levels Can Be Successfully Reduced in White Shrimp (Litopenaeus vannamei) If Supplemented with DL-Methionine (DL-Met) or DL-Methionyl-DL-Methionine (Met-Met). Aquac. Nutr. 2018, 24, 1144–1152. [Google Scholar] [CrossRef]
- Wang, L.; Ye, L.; Hua, Y.; Zhang, G.; Li, Y.; Zhang, J.; He, J.; Liu, M.; Shao, Q. Effects of Dietary Dl-Methionyl-Dl-Methionine (Met-Met) on Growth Performance, Body Composition and Haematological Parameters of White Shrimp (Litopenaeus vannamei) Fed with Plant Protein–Based Diets. Aquac. Rep. 2019, 50, 1718–1730. [Google Scholar] [CrossRef]
- Guo, J.; Duan, M.; Qiu, X.; Masagounder, K.; Davis, D.A. Characterization of Methionine Uptake and Clearance in the Hemolymph of Pacific White Shrimp Litopenaeus vannamei. Aquaculture 2020, 526, 735351. [Google Scholar] [CrossRef]
- Machado, M.; Fernández-Boo, S.; Teixeira, C.; Veigas, M.; Serradeiro, R.; Dias, J.; Costas, B.; Masagounder, K. DL-Methionyl-DL-Methionine as an efficient methionine source for promoting zootechnical performance and methionine-related pathways in the whiteleg shrimp (Penaeus vannamei). Br. J. Nutr. 2022. accepted. [Google Scholar] [CrossRef]
- Vargas-Albores, F.; Yepiz-Plascencia, G.; Jiménez-Vega, F.; Ávila-Villa, A. Structural and Functional Differences of Litopenaeus vannamei Crustins. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2004, 138, 415–422. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Huang, H.; Wang, F.; Aweya, J.J.; Zheng, Z.; Zhang, Y. Prediction and Characterization of a Novel Hemocyanin-Derived Antimicrobial Peptide from Shrimp Litopenaeus vannamei. Amino Acids 2018, 50, 995–1005. [Google Scholar] [CrossRef]
- Fajardo, C.; Martinez-Rodriguez, G.; Costas, B.; Mancera, J.M.; Fernandez-Boo, S.; Rodulfo, H.; de Donato, M. Shrimp Immune Response: A Transcriptomic Perspective. Rev. Aquac. 2021, 14, 1136–1149. [Google Scholar] [CrossRef]
- Zhang, Y.; Yan, F.; Hu, Z.; Zhao, X.; Min, S.; Du, Z.; Zhao, S.; Ye, X.; Li, Y. Hemocyanin from Shrimp Litopenaeus vannamei Shows Hemolytic Activity. Fish Shellfish Immunol. 2009, 27, 330–335. [Google Scholar] [CrossRef]
- Zheng, L.; Zhao, X.; Zhang, P.; Chen, C.; Liu, S.; Huang, R.; Zhong, M.; Wei, C.; Zhang, Y. Hemocyanin from Shrimp Litopenaeus vannamei Has Antiproliferative Effect against HeLa Cell in Vitro. PLoS ONE 2016, 11, e0151801. [Google Scholar] [CrossRef]
- Chen, J.-C.; Cheng, S.-Y.; Chen, C.-T. Changes of haemocyanin, protein and free amino acid levels in the haemolymph of Penaeus japonicus exposed to ambient ammonia. Comp. Biochem. Physiol. 1994, 109, 339–347. [Google Scholar] [CrossRef]
- Li, E.; Wang, X.; Chen, K.; Xu, C.; Qin, J.G.; Chen, L. Physiological change and nutritional requirement of Pacific white shrimp Litopenaeus vannamei at low salinity. Rev. Aquac. 2015, 9, 57–75. [Google Scholar] [CrossRef]
- Pogue, R.; Murphy, E.J.; Fehrenbach, G.W.; Rezoagli, E.; Rowan, N.J. Exploiting Immunomodulatory Properties of β-Glucans Derived from Natural Products for Improving Health and Sustainability in Aquaculture-Farmed Organisms: Concise Review of Existing Knowledge, Innovation and Future Opportunities. Curr. Opin. Environ. Sci. Health 2021, 21, 100248. [Google Scholar] [CrossRef]
- Monaghan, P.; Metcalfe, N.B.; Torres, R. Oxidative Stress as a Mediator of Life History Trade-Offs: Mechanisms, Measurements and Interpretation. Ecol. Lett. 2009, 12, 75–92. [Google Scholar] [CrossRef]
- Bai, N.; Gu, M.; Zhang, W.; Xu, W.; Mai, K. Effects of β-Glucan Derivatives on the Immunity of White Shrimp Litopenaeus vannamei and Its Resistance against White Spot Syndrome Virus Infection. Aquaculture 2014, 426–427, 66–73. [Google Scholar] [CrossRef]
- Burgents, J.E.; Burnett, K.G.; Burnett, L.E. Disease Resistance of Pacific White Shrimp, Litopenaeus vannamei, Following the Dietary Administration of a Yeast Culture Food Supplement. Aquaculture 2004, 231, 1–8. [Google Scholar] [CrossRef]
- Li, H.; Xu, C.; Zhou, L.; Dong, Y.; Su, Y.; Wang, X.; Qin, J.G.; Chen, L.; Li, E. Beneficial Effects of Dietary β-Glucan on Growth and Health Status of Pacific White Shrimp Litopenaeus vannamei at Low Salinity. Fish Shellfish Immunol. 2019, 91, 315–324. [Google Scholar] [CrossRef]
- Bai, N.; Zhang, W.; Mai, K.; Wang, X.; Xu, W.; Ma, H. Effects of Discontinuous Administration of β-Glucan and Glycyrrhizin on the Growth and Immunity of White Shrimp Litopenaeus vannamei. Aquaculture 2010, 306, 218–224. [Google Scholar] [CrossRef]
Ingredients (g kg−1) | NC | PC | T + M | BG |
---|---|---|---|---|
Marine protein mix 1 | 515 | 515 | 510 | 515 |
Fish protein hydrolysate 2 | 103 | 103 | 103 | 103 |
Plant protein mix 3 | 160 | 160 | 160 | 160 |
Cellulose 4 | 17 | 10 | 0 | 9 |
Fish oil 5 | 19 | 19 | 19 | 19 |
Marine phospholipids 6 | 28 | 28 | 28 | 28 |
Lecithin 7 | 56 | 56 | 56 | 56 |
Vitamins and minerals 8 | 50 | 57 | 57 | 57 |
Cholesterol 9 | 10 | 10 | 10 | 10 |
Antioxidant 10 | 4 | 4 | 4 | 4 |
Monoammonium phosphate 11 | 38 | 38 | 38 | 38 |
β-(1, 3)/(1, 6)-glucans 12 | 0 | 0 | 0 | 1 |
DL-Methionine 13 | 0 | 0 | 5 | 0 |
Taurine 14 | 0 | 0 | 10 | 0 |
1 Proprietary product for shrimp: 37% crude protein, 5% crude fat—SPAROS, Portugal | ||||
2 Sopropêche, France | ||||
3 Proprietary product for shrimp: 13% crude protein, 1% crude fat—SPAROS, Portugal | ||||
4 Disproquimica, Portugal | ||||
5 Sopropêche, France | ||||
6 Triple nine, Denmark | ||||
7 Lecico, Germany | ||||
8 Proprietary premixes/products for shrimp—SPAROS, Portugal | ||||
9 Carbogen, The Netherlands | ||||
10 Kemin, Italy | ||||
11 Timab Iberica, Spain | ||||
12 MacroGard—Orffa, The Netherlands | ||||
13 Premix—Especialidades Agricolas e Pecuárias Lda, Portugal | ||||
14 Proprietary product for marine fish and shrimp—SPAROS, Portugal |
NC | PC | T + M | BG | |
---|---|---|---|---|
Dry matter (DM, %) | 94.0 ± 0.5 | 93.7 ± 0.5 | 94.3 ± 0.5 | 94.3 ± 0.5 |
Crude protein (% DM) | 66.2 ± 1.7 | 66.4 ± 1.7 | 67.4 ± 1.7 | 66.1 ± 1.7 |
Crude fat (% DM) | 15.9 ± 1.0 | 16.2 ± 1.0 | 16.3 ± 1.0 | 15.6 ± 1.0 |
Fiber (% DM) | 1.4 ± 0.7 | 1.2 ± 0.7 | 1.1 ± 0.7 | 1.2 ± 0.7 |
Ash (% DM) | 11.4 ± 0.4 | 11.7 ± 0.4 | 11.7 ± 0.4 | 11.8 ± 0.4 |
Phosphorous (% DM) | 1.9 ± 0.4 | 2.0 ± 0.4 | 1.9 ± 0.5 | 2.0 ± 0.4 |
Energy (MJ/Kg DM) | 23.0 ± 0.0 | 23.0 ± 0.0 | 23.1 ± 0.0 | 22.9 ± 0.0 |
Vitamin C (mg/kg DM) | 159.6 ± 0.0 | 2027.7 ± 0.0 | 2014.8 ± 0.0 | 2014.8 ± 0.0 |
Vitamin E (mg/kg DM) | 42.6 ± 0.0 | 1067.2 ± 0.0 | 1060.4 ± 0.0 | 1060.4 ± 0.0 |
Taurine (g/100 g DM) | 0.31 ± 0.3 | 0.31 ± 0.3 | 0.94 ± 0.9 | 0.31 ± 0.3 |
Methionine (g/100 g DM) | 1.5 ± 0.2 | 1.5 ± 0.2 | 2.0 ± 0.3 | 0.6 ± 0.1 |
Gene | Acronym | Efficiency (%) | Annealing Temperature (°C) | Accession n° | Amplicon Length (bp) | Primer Sequence (5′-3′) |
---|---|---|---|---|---|---|
Cytoplasmic-type actin 4 | bactn | 83.2 | 62 | MF627841.1 | 260 | F: CACGAGACCACCTACAACTCCATC R: TCCTGCTTGCTGATCCACATCTG |
Ribosomal protein L8 | rpl-8 | 90 | 62 | DQ316258.1 | 219 | F: AGCCAAGCAAGATGGGTCG R: TGTAACGATAAGGGTCACGGAAG |
PvHm117 crustin P | crus | 81 | 62 | AY488497.1 | 109 | F: GAAACCACCACCAACACCTACTCC R: TCTGTGCGGCCTCTTTACGG |
Penaeidin-3a | pen-3 | 86.1 | 62 | Y14926.1 | 137 | F: ATACCCAGGCCACCACCCTT R: TGACAGCAACGCCCTAACC |
Hemocyanin | hmc | 92 | 62 | KY695246.1 | 124 | F: GTCTTAGTGGTTCTTGGGCTTGTC R: GGTCTCCGTCCTGAATGTCTCC |
Lysozyme C-like | lys | 73 | 62 | XM_027352857 | 82 | F: CGGGAAAGGCTATTCTGCCT R: CCAGCACTCTGCCATGTACT |
C-type lectin 2-like | lect | 83 | 62 | DQ858899.2 | 138 | F: GCTTCTGTTGGTGCTGTTGGC R: GTTCCCTTCCCGTATGTGGC |
Thioredoxin 1 | trd | 85.3 | 62 | EU499301.1 | 116 | F: TTAACGAGGCTGGAAACA R: AACGACATCGCTCATAGA |
Glutathione transferase | gst | 99 | 62 | AY573381 | 146 | F: AAGATAACGCAGAGCAAGG R: TCGTAGGTGACGGTAAAGA |
Glutathione peroxidase | gpx | 86.6 | 62 | XM_027372127.1 | 117 | F: AGGGACTTCCACCAGATG R: CAACAACTCCCCTTCGGTA |
Caspase 3 | casp-3 | 93.6 | 62 | KC660103.1 | 182 | F: ACATTTCTGGGCGGAACACC R: GTGACACCCGTGCTTGTACA |
NC | PC | T + M | BG | |
---|---|---|---|---|
Initial weight (mg) | 8.8 ± 0.0 | |||
Final weight (mg) | 110.8 ± 19.3 | 110.8 ± 18.4 | 114.0 ± 9.5 | 94.4 ± 9.2 |
RGR (% day−1) | 15.0 ± 1.1 | 15.0 ± 1.1 | 15.3 ± 0.5 | 14.0 ± 0.6 |
FCR | 0.9 ± 0.0 | 0.9 ± 0.2 | 0.9 ± 0.1 | 1.0 ± 0.2 |
Survival (%) | 87.0 ± 6.6 | 86.2 ± 7.6 | 85.5 ± 6.1 | 87.5 ± 5.0 |
NC | PC | T + M | BG | p-Value | |
---|---|---|---|---|---|
CAT (U mg−1 protein) | 22.9 ± 8.0 | 22.4 ± 6.3 | 28.9 ± 19.3 | 21.4 ± 7.2 | 0.675 |
LPO (nmol g wt−1) | 14.0 ± 2.2 ab | 15.6 ± 3.1 a | 14.6 ± 2.6 ab | 12.7 ± 2.1 b | 0.039 |
tGSH (nmol mg protein−1) | 4.7 ± 0.9 a | 5.0 ± 0.7 ab | 5.0 ± 0.8 ab | 5.7 ± 1.1 b | 0.018 |
Lysozyme (µg mg protein−1) | 1.2 ± 0.5 | 1.5 ± 0.6 | 1.1 ± 0.3 | 1.2 ± 0.4 | 0.165 |
Pro-phenoloxidase (×10−3 U mL−1) | 12.1 ± 6.8 | 14.0 ± 9.3 | 12.4 ± 3.8 | 13.0 ± 6.5 | 0.854 |
Bactericidal activity (%) | 12.6 ± 6.9 | 12.9 ± 8.1 | 14.6 ± 11.9 | 14.5 ± 7.8 | 0.551 |
Gene | Acronym | Relative Expression | p-Value | |||
---|---|---|---|---|---|---|
NC | PC | T + M | BG | |||
PvHm117 crustin P | crus | 0.6 ± 0.2 a | 1.1 ± 0.5 ab | 1.3 ± 0.4 b | 1.5 ± 0.8 b | 0.003 |
Penaeidin-3a | pen-3 | 0.4 ± 0.3 a | 1.1 ± 0.4 b | 0.7 ± 0.5 ab | 1.2 ± 0.8 b | 0.001 |
Hemocyanin | hmc | 1.1 ± 0.7 b | 1.9 ± 2.4 ab | 0.2 ± 0.2 a | 0.7 ± 0.7 ab | 0.029 |
Lysozyme C-like | lys | 0.7 ± 0.4 | 1.1 ± 0.5 | 1.3 ± 0.6 | 1.3 ± 0.9 | 0.212 |
C-type lectin 2-like | lect | 0.7 ± 0.4 | 1.1 ± 0.5 | 1.3 ± 0.7 | 1.3 ± 1.0 | 0.236 |
Thioredoxin 1 | trd | 1.0 ± 0.5 | 1.0 ± 0.2 | 1.0 ± 0.3 | 0.90 ± 0.3 | 0.819 |
Glutathione transferase | gst | 0.9 ± 0.5 | 0.9 ± 0.4 | 0.6 ± 0.3 | 0.4 ± 0.1 | 0.218 |
Glutathione peroxidase | gpx | 1.0 ± 0.4 | 1.1 ± 0.4 | 0.9 ± 0.1 | 1.0 ± 0.3 | 0.622 |
Caspase 3 | casp-3 | 0.6 ± 0.3 | 0.8 ± 0.4 | 0.6 ± 0.5 | 1.9 ± 2.5 | 0.410 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barreto, A.; Peixoto, D.; Fajardo, C.; Pinto, W.; Rocha, R.J.M.; Conceição, L.E.C.; Costas, B. Health-Promoting Additives Supplemented in Inert Microdiets for Whiteleg Shrimp (Penaeus vannamei) Post-Larvae: Effects on Growth, Survival, and Health Status. Animals 2023, 13, 726. https://doi.org/10.3390/ani13040726
Barreto A, Peixoto D, Fajardo C, Pinto W, Rocha RJM, Conceição LEC, Costas B. Health-Promoting Additives Supplemented in Inert Microdiets for Whiteleg Shrimp (Penaeus vannamei) Post-Larvae: Effects on Growth, Survival, and Health Status. Animals. 2023; 13(4):726. https://doi.org/10.3390/ani13040726
Chicago/Turabian StyleBarreto, André, Diogo Peixoto, Carlos Fajardo, Wilson Pinto, Rui J. M. Rocha, Luís E. C. Conceição, and Benjamín Costas. 2023. "Health-Promoting Additives Supplemented in Inert Microdiets for Whiteleg Shrimp (Penaeus vannamei) Post-Larvae: Effects on Growth, Survival, and Health Status" Animals 13, no. 4: 726. https://doi.org/10.3390/ani13040726