MiR-93-5p Promotes Cell Proliferation through Down-Regulating PPARGC1A in Hepatocellular Carcinoma Cells by Bioinformatics Analysis and Experimental Verification
Abstract
:1. Introduction
2. Methods
2.1. Data Mining of Public Resources
2.2. Cell Culture and Transfection
2.3. Western Blot Analysis
2.4. RNA Isolation and Quantitative PCR
2.5. Plasmids and Luciferase Reporter Assay
2.6. Cell Proliferation Assay and Cell Cycle Assay
2.7. Statistical Analysis
3. Results
3.1. Extraction of microRNA-mRNA Regulatory Network
3.2. Hub Gene PPARGC1A Was Associated with LIHC Patient Prognosis
3.3. MiR-93-5p is Up-Regulated, PPARGC1A Is Down-Regulated in Hepatoma Cells
3.4. MiR-93-5p Suppressed PPARGC1A Expression by Directly Binding to Its 3′UTR
3.5. MiR-93-5p Promotes Hepatoma Cells Proliferation
4. Discussion
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Venook, A.P.; Papandreou, C.; Furuse, J.; de Guevara, L.L. The incidence and epidemiology of hepatocellular carcinoma: A global and regional perspective. Oncologist 2010, 15 (Suppl. S4), 5–13. [Google Scholar] [CrossRef] [PubMed]
- Stepien, M.; Fedirko, V.; Duarte-Salles, T.; Ferrari, P.; Freisling, H.; Trepo, E.; Trichopoulou, A.; Bamia, C.; Weiderpass, E.; Olsen, A.; et al. Prospective association of liver function biomarkers with development of hepatobiliary cancers. Cancer Epidemiol. 2016, 40, 179–187. [Google Scholar] [CrossRef] [PubMed]
- Simoneau, E.; Hassanain, M.; Madkhali, A.; Salman, A.; Nudo, C.G.; Chaudhury, P.; Metrakos, P. (18)F-Fluorodeoxyglucose positron-emission tomography could have a prognostic role in patients with advanced hepatocellular carcinoma. Curr. Oncol. 2014, 21, e551–e556. [Google Scholar] [CrossRef] [PubMed]
- Eatrides, J.; Wang, E.; Kothari, N.; Kim, R. Role of Systemic Therapy and Future Directions for Hepatocellular Carcinoma. Cancer Control 2017, 24. [Google Scholar] [CrossRef] [PubMed]
- Zamora-Valdes, D.; Taner, T.; Nagorney, D.M. Surgical Treatment of Hepatocellular Carcinoma. Cancer Control 2017, 24. [Google Scholar] [CrossRef] [PubMed]
- Dowman, J.K.; Hopkins, L.J.; Reynolds, G.M.; Nikolaou, N.; Armstrong, M.J.; Shaw, J.C.; Houlihan, D.D.; Lalor, P.F.; Tomlinson, J.W.; Hübscher, S.G.; et al. Development of hepatocellular carcinoma in a murine model of nonalcoholic steatohepatitis induced by use of a high-fat/fructose diet and sedentary lifestyle. Am. J. Pathol. 2014, 184, 1550–1561. [Google Scholar] [CrossRef] [PubMed]
- Karagozian, R.; Derdak, Z.; Baffy, G. Obesity-associated mechanisms of hepatocarcinogenesis. Metabolism 2014, 63, 607–617. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Tan, M.; Cai, Q. The Warburg effect in tumor progression: Mitochondrial oxidative metabolism as an anti-metastasis mechanism. Cancer Lett. 2015, 356, 156–164. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.; Shi, W.; Li, Z.; Liu, H. Activation of mPTP-dependent mitochondrial apoptosis pathway by a novel pan HDAC inhibitor resminostat in hepatocellular carcinoma cells. Biochem. Biophys. Res. Commun. 2016, 477, 527–533. [Google Scholar] [CrossRef] [PubMed]
- Charos, A.E.; Reed, B.D.; Raha, D.; Szekely, A.M.; Weissman, S.M.; Snyder, M. A highly integrated and complex PPARGC1A transcription factor binding network in HepG2 cells. Genome Res. 2012, 22, 1668–1679. [Google Scholar] [CrossRef] [PubMed]
- Kamimura, N.; Ichimiya, H.; Iuchi, K.; Ohta, S. Molecular hydrogen stimulates the gene expression of transcriptional coactivator PGC-1alpha to enhance fatty acid metabolism. NPJ Aging Mech. Dis. 2016, 2, 16008. [Google Scholar] [CrossRef] [PubMed]
- Puigserver, P.; Spiegelman, B.M. Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): Transcriptional coactivator and metabolic regulator. Endocr. Rev. 2003, 24, 78–90. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Zhang, H.; Zhang, Y.; Li, S.; Wang, X.; Wang, X.; Wang, C.; Liu, B.; Zen, K.; Zhang, C.Y.; et al. Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma. Tumour Biol. 2017, 39. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Liang, T.; Yu, J.; Zou, Q. A Comprehensive Analysis of miRNA/isomiR Expression with Gender Difference. PLoS ONE 2016, 11, e0154955. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.; Cheng, S.; Song, B.; Zhong, X.; Lin, X.; Li, W.; Li, L.; Zhang, Y.; Zhang, H.; Ji, Z.; et al. The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis. Science 2015, 350, 691–694. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Zou, Q.; Sun, X.H.; Zhao, L.P. Computational identification of microRNAs and their targets in perennial Ryegrass (Lolium perenne). Appl. Biochem. Biotechnol. 2014, 173, 1011–1022. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zeng, X.; He, Z.; Zou, Q. Inferring microRNA-disease associations by random walk on a heterogeneous network with multiple data sources. IEEE/ACM Trans. Comput. Biol. Bioinform. 2017, 14, 905–915. [Google Scholar] [CrossRef] [PubMed]
- Zou, Q.; Li, J.; Hong, Q.; Lin, Z.; Wu, Y.; Shi, H.; Ju, Y. Prediction of MicroRNA-Disease Associations Based on Social Network Analysis Methods. BioMed Res. Int. 2015, 2015, 810514. [Google Scholar] [CrossRef] [PubMed]
- Zou, Q.; Li, J.; Song, L.; Zeng, X.; Wang, G. Similarity computation strategies in the microRNA-disease network: A survey. Brief Funct. Genom. 2016, 15, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Zeng, X.; Zhang, X.; Zou, Q. Integrative approaches for predicting microRNA function and prioritizing disease-related microRNA using biological interaction networks. Brief Bioinform. 2016, 17, 193–203. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Yu, J.; Liang, T.; Zou, Q. miR-isomiRExp: A web-server for the analysis of expression of miRNA at the miRNA/isomiR levels. Sci. Rep. 2016, 6, 23700. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.H.; Zhao, L.P.; Zou, Q.; Wang, Z.B. Identification of microRNA genes and their mRNA targets in Festuca arundinacea. Appl. Biochem. Biotechnol. 2014, 172, 3875–3887. [Google Scholar]
- Spizzo, R.; Nicoloso, M.S.; Croce, C.M.; Calin, G.A. SnapShot: MicroRNAs in Cancer. Cell 2009, 137, 586.e1. [Google Scholar] [CrossRef] [PubMed]
- Di Leva, G.; Garofalo, M.; Croce, C.M. MicroRNAs in cancer. Annu. Rev. Pathol. 2014, 9, 287–314. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.; Liao, Z.; Zou, Q. Which statistical significance test best detects oncomiRNAs in cancer tissues? An exploratory analysis. Oncotarget 2016, 7, 85613–85623. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Zhang, J.; Xuan, P.; Zou, Q. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species. BioMed Res. Int. 2016, 2016. [Google Scholar] [CrossRef] [PubMed]
- Zou, Q.; Mao, Y.; Hu, L.; Wu, Y.; Ji, Z. miRClassify: An advanced web server for miRNA family classification and annotation. Comput. Biol. Med. 2014, 45, 157–160. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Wei, L.; Guan, X.; Wu, Y.; Zou, Q.; Ji, Z. Briefing in family characteristics of microRNAs and their applications in cancer research. Biochim. Biophys. Acta 2014, 1844, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Thurnherr, T.; Mah, W.C.; Lei, Z.; Jin, Y.; Rozen, S.G.; Lee, C.G. Differentially Expressed miRNAs in Hepatocellular Carcinoma Target Genes in the Genetic Information Processing and Metabolism Pathways. Sci. Rep. 2016, 6. [Google Scholar] [CrossRef] [PubMed]
- Shi, K.Q.; Lin, Z.; Chen, X.J.; Song, M.; Wang, Y.Q.; Cai, Y.J.; Yang, N.B.; Zheng, M.H.; Dong, J.Z.; Zhang, L.; et al. Hepatocellular carcinoma associated microRNA expression signature: Integrated bioinformatics analysis, experimental validation and clinical significance. Oncotarget 2015, 6, 25093–25108. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Wang, X.; Lin, D.; Zou, Q. Construction and Identification of the RNAi Recombinant Lentiviral Vector Targeting Human DEPDC7 Gene. Interdiscip. Sci. Comput. Life Sci. 2017, 9, 350–356. [Google Scholar] [CrossRef] [PubMed]
- Ohta, K.; Hoshino, H.; Wang, J.; Ono, S.; Iida, Y.; Hata, K.; Huang, S.K.; Colquhoun, S.; Hoon, D.S. MicroRNA-93 activates c-Met/PI3K/Akt pathway activity in hepatocellular carcinoma by directly inhibiting PTEN and CDKN1A. Oncotarget 2015, 6, 3211–3224. [Google Scholar] [CrossRef] [PubMed]
- Plaisier, C.L.; O’Brien, S.; Bernard, B.; Reynolds, S.; Simon, Z.; Toledo, C.M.; Ding, Y.; Reiss, D.J.; Paddison, P.J.; Baliga, N.S. Causal Mechanistic Regulatory Network for Glioblastoma Deciphered Using Systems Genetics Network Analysis. Cell Syst. 2016, 3, 172–186. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Lowdon, R.F.; Li, D.; Lawson, H.A.; Madden, P.A.; Costello, J.F.; Wang, T. Exploring long-range genome interactions using the WashU Epigenome Browser. Nat. Methods 2013, 10, 375–376. [Google Scholar] [CrossRef] [PubMed]
- Lindskog, C. The Human Protein Atlas—An important resource for basic and clinical research. Expert Rev. Proteom. 2016, 13, 627–629. [Google Scholar] [CrossRef] [PubMed]
- Guo, Q.; Cheng, Y.; Liang, T.; He, Y.; Ren, C.; Sun, L.; Zhang, G. Comprehensive analysis of lncRNA-mRNA co-expression patterns identifies immune-associated lncRNA biomarkers in ovarian cancer malignant progression. Sci Rep. 2015, 5. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Zhao, J.; Huang, S.; Wang, Y.; Zhu, L.; Cao, Y.; Xiong, J.; Deng, J. MiR-93-5p promotes gastric cancer-cell progression via inactivation of the Hippo signaling pathway. Gene 2018, 641, 240–247. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Y.; Liao, X.H.; Yu, C.X.; Yao, A.; Qin, H.; Li, J.P.; Hu, P.; Li, H.; Guo, W.; Gu, C.J.; Zhang, T.C. MiR-93-5p inhibits the EMT of breast cancer cells via targeting MKL-1 and STAT3. Exp. Cell Res. 2017, 357, 135–144. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Huang, Y.; Yue, X.; Lu, H.; Xuan, P.; Ju, Y. In Silico Prediction of Gamma-Aminobutyric Acid Type-A Receptors Using Novel Machine-Learning-Based SVM and GBDT Approaches. BioMed Res. Int. 2016, 2016. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Wang, X.; Zeng, Y.; Zou, Q. Identification of DEP domain-containing proteins by a machine learning method and experimental analysis of their expression in human HCC tissues. Sci. Rep. 2016, 6. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Wang, X.; Chen, X.; Zou, Q. Prediction and Identification of Kruppel-like transcription factors by machine learning method. Comb. Chem. High Throughput Screen. 2017, 20, 594–602. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Wu, P.H.; Tarr, P.T.; Lindenberg, K.S.; St-Pierre, J.; Zhang, C.Y.; Mootha, V.K.; Jäger, S.; Vianna, C.R.; Reznick, R.M.; et al. Defects in adaptive energy metabolism with CNS-linked hyperactivity in PGC-1alpha null mice. Cell 2004, 119, 121–135. [Google Scholar] [CrossRef] [PubMed]
- Li, Y. The Effects of C/EBP-β Silence on the Proliferation, Apoptosis and Migration in Hepatocellular Carcinoma; Jiangsu University: ZhenJiang, China, 2015. [Google Scholar]
- Lyu, X.; Fang, W.; Cai, L.; Zheng, H.; Ye, Y.; Zhang, L.; Peng, H.; Cho, W.C.; Wang, E.; Marincola, F.M.; et al. TGFbetaR2 is a major target of miR-93 in nasopharyngeal carcinoma aggressiveness. Mol. Cancer 2014, 13, 51. [Google Scholar] [CrossRef] [PubMed]
- Du, L.; Zhao, Z.; Ma, X.; Hsiao, T.H.; Chen, Y.; Young, E.; Suraokar, M.; Wistuba, I.; Minna, J.D.; Pertsemlidis, A. miR-93-directed downregulation of DAB2 defines a novel oncogenic pathway in lung cancer. Oncogene 2014, 33, 4307–4315. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Wang, C.; Lei, F.; Zhang, L.; Zhang, X.; Liu, A.; Wu, G.; Zhu, J.; Song, L. miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget 2015, 6, 8286–8299. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence 5′ to 3′ | |
---|---|---|
Forward | Reverse | |
PPARGC1A | TGAACTGAGGGACAGTGATTTC | CCCAAGGGTAGCTCAGTTTATC |
β-actin | CGTGCGTGACATTAAGGAGAAG | GGAAGGAAGGCTGGAAGAGTG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Liao, Z.; Bai, Z.; He, Y.; Duan, J.; Wei, L. MiR-93-5p Promotes Cell Proliferation through Down-Regulating PPARGC1A in Hepatocellular Carcinoma Cells by Bioinformatics Analysis and Experimental Verification. Genes 2018, 9, 51. https://doi.org/10.3390/genes9010051
Wang X, Liao Z, Bai Z, He Y, Duan J, Wei L. MiR-93-5p Promotes Cell Proliferation through Down-Regulating PPARGC1A in Hepatocellular Carcinoma Cells by Bioinformatics Analysis and Experimental Verification. Genes. 2018; 9(1):51. https://doi.org/10.3390/genes9010051
Chicago/Turabian StyleWang, Xinrui, Zhijun Liao, Zhimin Bai, Yan He, Juan Duan, and Leyi Wei. 2018. "MiR-93-5p Promotes Cell Proliferation through Down-Regulating PPARGC1A in Hepatocellular Carcinoma Cells by Bioinformatics Analysis and Experimental Verification" Genes 9, no. 1: 51. https://doi.org/10.3390/genes9010051