Physiological and Transcriptome Analysis Reveals the Differences in Genes of Antioxidative Defense Components and Cold-Related Proteins in Winter and Spring Wheat during Cold Acclimation
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Plant Culture and Sampling
2.2.1. Determination of Overwintering Rate
2.2.2. Plant Culture, Sampling of Physiological Indices, and RNA-seq
2.3. Determination of Electrical Conductivity, ROS CONTENT, and Antioxidants
2.4. RNA-Seq Analysis
2.5. Analysis of RNA-Seq Data
2.6. Gene Ontology (GO) Analysis
2.7. Quantitative RT-PCR
2.8. Analysis of the Evolutionary Tree of POD and Cis-acting Element
3. Results
3.1. Comparison of Cold Resistance between DM1 and CS at Low Temperatures Stress
3.2. Response of ROS and ROS-Scavenging Enzymes to Cold Acclimation in DM1 and CS
3.3. Transcriptome Profiles of the Tiller Nodes of CS and DM1
3.4. Expression Analysis of Antioxidant Genes in DM1 and CS
3.5. Expression of Cold Acclimation RESISTANCE Genes
4. Discussion
4.1. Changes in the Antioxidant System of Wheat under Cold Conditions
4.2. Response of Cold Resistance Genes in Wheat Varieties to Cold Acclimation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fowler, D.B. Wheat production in the high winter stress climate of the great plains of North America—An experiment in crop adaptation. Crop Sci. 2012, 52, 11–20. [Google Scholar] [CrossRef]
- Abhinandan, K.; Skori, L.; Stanic, M.; Hickerson, N.M.N.; Jamshed, M.; Samuel, M.A. Abiotic stress signaling in wheat—An inclusive overview of hormonal interactions during abiotic stress responses in wheat. Front. Plant Sci. 2018, 9, 734. [Google Scholar] [CrossRef]
- Cheong, B.E.; Ho, W.W.H.; Biddulph, B.; Wallace, X.; Rathjen, T.; Rupasinghe, T.W.T.; Roessner, U.; Dolferus, R. Phenotyping reproductive stage chilling and frost tolerance in wheat using targeted metabolome and lipidome profiling. Metabolomics 2019, 15, 144. [Google Scholar] [CrossRef]
- Ding, Y.; Shi, Y.; Yang, S. Molecular regulation of plant responses to environmental temperatures. Mol. Plant. 2020, 13, 544–564. [Google Scholar] [CrossRef]
- Li, X.; Jiang, H.; Liu, F.; Cai, J.; Dai, T.; Cao, W.; Jiang, D. Induction of chilling tolerance in wheat during germination by pre-soaking seed with nitric oxide and gibberellin. Plant Growth Regul. 2013, 71, 31–40. [Google Scholar] [CrossRef]
- Esim, N.; Atici, O.; Mutlu, S. Effects of exogenous nitric oxide in wheat seedlings under chilling stress. Toxicol. Ind. Health. 2014, 30, 268–274. [Google Scholar] [CrossRef]
- Liu, L.; Ji, H.; An, J.; Shi, K.; Ma, J.; Liu, B.; Tang, L.; Cao, W.; Zhu, Y. Response of biomass accumulation in wheat to low-temperature stress at jointing and booting stages. Environ. Exp. Bot. 2019, 157, 46–57. [Google Scholar] [CrossRef]
- Hassan, M.A.; Xiang, C.; Farooq, M.; Muhammad, N.; Yan, Z.; Hui, X.; Yuanyuan, K.; Bruno, A.K.; Lele, Z.; Jincai, L. Cold stress in wheat: Plant acclimation responses and management strategies. Front. Plant Sci. 2021, 12, 676–884. [Google Scholar] [CrossRef]
- Majláth, I.; Szalai, G.; Soós, V.; Sebestyén, E.; Balázs, E.; Vanková, R.; Dobrev, P.I.; Tari, I.; Tandori, J.; Janda, T. Effect of light on the gene expression and hormonal status of winter and spring wheat plants during cold hardening. Physiol. Plant. 2012, 145, 296–314. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, J.; Huang, Z.; Mi, L.; Xu, K.; Wu, J.; Fan, Y.; Ma, S.; Jiang, D. Effects of low temperature at booting stage on sucrose metabolism and endogenous hormone contents in winter wheat spikelet. Front. Plant Sci. 2019, 10, 498. [Google Scholar] [CrossRef]
- Willick, I.R.; Takahashi, D.; Fowler, D.B.; Uemura, M.; Tanino, K.K. Tissue-specific changes in apoplastic proteins and cell wall structure during cold acclimation of winter wheat crowns. J. Exp. Bot. 2018, 69, 1221–1234. [Google Scholar] [CrossRef]
- Chow-Shi-Yée, M.; Grondin, M.; Ouellet, F.; Averill-Bates, D.A. Control of stress-induced apoptosis by freezing tolerance-associated wheat proteins during cryopreservation of rat hepatocytes. Cell Stress Chaperones 2020, 25, 869–886. [Google Scholar] [CrossRef]
- Ouellet, F.; Carpentier, E.; Cope, M.J.T.; Monroy, A.F.; Sarhan, F. Regulation of a wheat actin-depolymerizing factor during cold acclimation. Plant Physiol. 2001, 125, 360–368. [Google Scholar] [CrossRef]
- Calderon, F.P.; Yoon, J.S.; Kim, D.Y.; Seo, Y.W. Effect of chilling acclimation on germination and seedlings response to cold in different seed coat colored wheat (Triticum aestivum L.). BMC Plant Biol. 2022, 21, 252. [Google Scholar] [CrossRef]
- Repetto, M.; Semprine, J.; Boveris, A. Lipid peroxidation: Chemical mechanism, biological implications and analytical determination. Lipid Peroxidation 2012, 1, 3–30. [Google Scholar] [CrossRef]
- Singh, A.; Kumar, A.; Yadav, S.; Singh, I.K. Reactive oxygen species-mediated signaling during abiotic stress. Plant Gene 2019, 18, 100–173. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Bhuyan, M.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Mahmud, J.A.; Fujita, M.; Fotopoulos, V. Reactive oxygen species and antioxidant defense in plants under abiotic stress: Revisiting the crucial role of a universal defense regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
- Demidchik, V. Mechanisms of oxidative stress in plants: From classical chemistry to cell biology. Environ. Exp. Bot. 2015, 109, 212–228. [Google Scholar] [CrossRef]
- Zhang, S.; Xu, B.; Gan, Y. Seed treatment with Trichoderma longibrachiatum T6 promotes wheat seedling growth under NaCl stress through activating the enzymatic and nonenzymatic antioxidant defense systems. Int. J. Mol. Sci. 2019, 20, 3729. [Google Scholar] [CrossRef]
- Caverzan, A.; Casassola, A.; Brammer, S.P. Antioxidant responses of wheat plants under stress. Genet. Mol. Biol. 2016, 39, 1–6. [Google Scholar] [CrossRef]
- Ermakov, A.; Bobrovskikh, A.; Zubairova, U.; Konstantinov, D.; Doroshkov, A. Stress-induced changes in the expression of antioxidant system genes for rice (Oryza Sativa L.) and bread wheat (Triticum Aestivum L.). PeerJ 2019, 7, e7791. [Google Scholar] [CrossRef]
- Wang, K.; Gong, Q.; Ye, X. Recent developments and applications of genetic transformation and gen ome editing technologies in wheat. Theor. Appl. Genet. 2020, 133, 1603–1622. [Google Scholar] [CrossRef]
- Su, H.; Tan, C.; Liu, Y.; Chen, X.; Li, X.; Jones, A.; Zhu, Y.; Song, Y. Physiology and molecular breeding in sustaining wheat grain setting and quality under spring cold stress. Int. J. Mol. Sci. 2022, 23, 14099. [Google Scholar] [CrossRef]
- Sun, A.; Fu, L.; Chen, L.; Wang, X.; Song, Y.; Li, Z. Characterization of two winter wheat varieties’ responses to freezing in a frigid region of the people’s Republic of China. Can. J. Plant Sci. 2017, 97, 808–815. [Google Scholar] [CrossRef]
- Sun, Y.; Liu, X.; Fu, L.; Qin, P.; Li, T.; Ma, X.; Wang, X. Overexpression of TaBADH increases salt tolerance in Arabidopsis. Can. J. Plant Sci. 2019, 99, 546–555. [Google Scholar] [CrossRef]
- Liu, X.; Fu, L.; Qin, P.; Sun, Y.; Liu, J.; Wang, X. Overexpression of the wheat trehalose 6-phosphate synthase 11 gene enhances cold tolerance in Arabidopsis thaliana. Gene 2019, 710, 210–217. [Google Scholar] [CrossRef]
- Tian, Y.; Peng, K.; Bao, Y.; Zhang, D.; Meng, J.; Wang, D.; Wang, X.; Cang, J. Glucose-6-phosphate dehydrogenase and 6-phosphogluconate dehydrogenase genes of winter wheat enhance the cold tolerance of Transgenic Arabidopsis. Plant Physiol. Biochem. 2021, 161, 96–107. [Google Scholar] [CrossRef]
- Peng, K.; Tian, Y.; Cang, J.; Yu, J.; Wang, D.; He, F.; Jiao, H.; Tan, Y. Overexpression of tafba-a10 from winter wheat enhances freezing tolerance in Arabidopsis thaliana. J. Plant Growth Regul. 2022, 41, 314–326. [Google Scholar] [CrossRef]
- Lu, Q.; Xu, Q.; Guo, F.; Lv, Y.; Song, C.; Feng, M.; Yu, J.; Zhang, D.; Cang, J. Identification and characterization of long non-coding rnas as competing endogenous rnas in the cold stress response of Triticum Aestivum. Plant Biol. 2020, 22, 635–645. [Google Scholar] [CrossRef]
- Wang, R.; Yu, M.; Xia, J.; Xing, J.; Fan, X.; Xu, Q.; Cang, J.; Zhang, D. Overexpression of TaMYC2 confers freeze tolerance by ICE-CBF-COR module in Arabidopsis thaliana. Front. Plant Sci. 2022, 13, 1042889. [Google Scholar] [CrossRef]
- Wang, R.; Yu, M.; Xia, J.; Ren, Z.; Xing, J.; Li, C.; Xu, Q.; Cang, J.; Zhang, D. Cold stress triggers freezing tolerance in wheat (Triticum aestivum L.) via hormone regulation and transcription of related genes. Plant Biol. 2022. [Google Scholar] [CrossRef]
- Du, Y.; Liu, C.; Li, N.; Lu, X.; Ge, R.; Liu, X.; Fu, L.; Zhao, L.; Liu, J.; Wang, X. Time-course transcriptome profiling revealed the specific expression patterns of mads-box genes associated with the distinct developmental processes between winter and spring wheat. Gene 2022, 809, 146030. [Google Scholar] [CrossRef]
- Lv, L.; Dong, C.; Liu, Y.; Zhao, A.; Zhang, Y.; Li, H.; Chen, X. Transcription associated metabolomic profling reveals the critical role of frost tolerance in wheat. BMC Plant Biol. 2022, 22, 333. [Google Scholar] [CrossRef]
- Tian, Y.; Peng, K.; Lou, G.; Ren, Z.; Sun, X.; Wang, Z.; Xing, J.; Song, C.; Cang, J. Transcriptome analysis of the winter wheat Dn1 in response to cold stress. BMC Plant Biol. 2022, 22, 277. [Google Scholar] [CrossRef]
- Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef] [PubMed]
- Sagisaka, S. The occurrence of peroxide in a perennial plant, Populus Gelrica. Plant Physiol. 1976, 57, 308–309. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Niu, H.; Xu, K.; Xu, Q.; Wang, S.; Liang, X.; Jiang, Y.; Niu, J. Gwas for resistance against black point caused by Bipolaris sorokiniana in wheat. J. Cereal Sci. 2020, 91, 102859. [Google Scholar] [CrossRef]
- Wei, J.; Li, C.; Li, Y.; Jiang, G.; Cheng, G.; Zheng, Y. Effects of external potassium (K) supply on drought tolerances of two contrasting winter wheat cultivars. PLoS ONE 2013, 8, e69737. [Google Scholar] [CrossRef] [PubMed]
- Dou, X.; Wang, Y.; Wang, H.; Yue, J. Physiological response and tolerance difference of two wheat varieties to nacl stress. Acta Ecol. Sin. 2021, 41, 4976–4992. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Qin, S.; Liu, H.; Nie, Z.; Gao, W.; Li, C.; Lin, Y.; Zhao, P. Asa–Gsh cycle and antioxidant enzymes play important roles in Cd tolerance of wheat. Bull. Environ. Contam. Toxicol. 2018, 101, 684–690. [Google Scholar] [CrossRef] [PubMed]
- Lv, X.; Li, H.; Chen, X.; Xiang, X.; Guo, Z.; Yu, J.; Zhou, Y. The role of calcium-dependent protein kinase in hydrogen peroxide, nitric oxide and Aba-dependent cold acclimation. J. Exp. Bot. 2018, 69, 4127–4139. [Google Scholar] [CrossRef] [PubMed]
- Theocharis, A.; Clément, C.; Barka, E.A. Physiological and molecular changes in plants grown at low temperatures. Planta 2012, 235, 1091–1105. [Google Scholar] [CrossRef] [PubMed]
- Rife, C.; Zeinali, H. Cold tolerance in oilseed rape over varying acclimation durations. Crop Sci. 2003, 43, 96–100. [Google Scholar] [CrossRef]
- Fujita, M.; Fujita, Y.; Noutoshi, Y.; Takahashi, F.; Narusaka, Y.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Crosstalk between abiotic and biotic stress responses: A current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 2006, 9, 436–442. [Google Scholar] [CrossRef]
- Gechev, T.; Petrov, V. Reactive oxygen species and abiotic stress in plants. Int. J. Mol. Sci. 2020, 21, 7433. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Yu, J.; Cang, J.; Lu, Q.; Fan, B.; Xu, Q.; Li, W.; Wang, X. Aba enhanced cold tolerance of wheat ‘Dn1’ via increasing ros scavenging system. Plant Signal. Behav. 2020, 15, 1780403. [Google Scholar] [CrossRef]
- Quan, L.J.; Zhang, B.; Shi, W.W.; Li, H.Y. Hydrogen peroxide in plants: A versatile molecule of the reactive oxygen species network. J. Integr. Plant Biol. 2008, 50, 2–18. [Google Scholar] [CrossRef]
- Tuteja, N. Mechanisms of high salinity tolerance in plants. Methods Enzymol. 2007, 428, 419–438. [Google Scholar] [CrossRef]
- Qin, Y.; Cui, S.; Cui, P.; Zhang, B.; Quan, X. TaFLZ2D enhances salinity stress tolerance via superior ability for ionic stress tolerance and ROS detoxification. Plant Physiol. Biochem. 2021, 168, 516–525. [Google Scholar] [CrossRef] [PubMed]
- Rani, A.; Kiran, A.; Sharma, K.D.; Prasad, P.V.V.; Jha, U.C.; Siddique, K.H.M.; Nayyar, H. Cold tolerance during the reproductive phase in chickpea (Cicer Arietinum L.) is associated with superior cold acclimation ability involving antioxidants and cryoprotective solutes in anthers and ovules. Antioxidants 2021, 10, 1693. [Google Scholar] [CrossRef] [PubMed]
- Jiang, G.; Hassan, M.A.; Muhammad, N.; Arshad, M.; Chen, X.; Xu, Y.; Xu, H.; Ni, Q.; Liu, B.; Yang, W.; et al. Comparative physiology and transcriptome analysis of young spikes in response to late spring coldness in wheat (Triticum aestivum L.). Front. Plant Sci. 2022, 13, 811884. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Pang, D.; Jin, M.; Chen, J.; Kong, X.; Li, W.; Chang, Y.; Li, Y.; Wang, Z. Identification of plant hormones and candidate hub genes regulating flag leaf senescence in wheat response to water deficit stress at the grain-filling stage. Plant Direct 2019, 3, e00152. [Google Scholar] [CrossRef]
- Ma, S.; Gong, Q.; Bohnert, H.J. Dissecting salt stress pathways. J. Exp. Bot. 2006, 57, 1097–1107. [Google Scholar] [CrossRef]
- Yang, C.Y.; Hsu, F.C.; Li, J.P.; Wang, N.N.; Shih, M.C. The Ap2/Erf transcription factor Aterf73/Hre1 modulates ethylene responses during hypoxia in Arabidopsis. Plant Physiol. 2011, 156, 202–212. [Google Scholar] [CrossRef] [PubMed]
- Guan, Q.; Wu, J.; Yue, X.; Zhang, Y.; Zhu, J. A nuclear calcium-sensing pathway is critical for gene regulation and salt stress tolerance in Arabidopsis. PLoS Genet. 2013, 9, e1003755. [Google Scholar] [CrossRef]
- Wang, P.; Du, Y.; Zhao, X.; Miao, Y.; Song, C.P. The Mpk6-Erf6-Ros-Responsive Cis-Acting Element7/Gcc Box complex modulates oxidative gene transcription and the oxidative response in Arabidopsis. Plant Physiol. 2013, 161, 1392–1408. [Google Scholar] [CrossRef]
- Bertini, L.; Cozzolino, F.; Proietti, S.; Falconieri, G.S.; Iacobucci, I.; Salvia, R.; Falabella, P.; Monti, M.; Caruso, C. What antarctic plants can tell us about climate changes: Temperature as a driver for metabolic reprogramming. Biomolecules 2021, 11, 1094. [Google Scholar] [CrossRef]
- Li, Q.; Byrns, B.; Badawi, M.A.; Diallo, A.B.; Danyluk, J.; Sarhan, F.; Laudencia-Chingcuanco, D.; Zou, J.; Fowler, D.B. Transcriptomic insights into phenological development and cold tolerance of wheat grown in the field. Plant Physiol. 2018, 176, 2376–2394. [Google Scholar] [CrossRef]
- Hwarari, D.; Guan, Y.; Ahmad, B.; Movahedi, A.; Min, T.; Hao, Z.; Lu, Y.; Chen, J.; Yang, L. Ice-Cbf-Cor signaling cascade and its regulation in plants responding to cold stress. Int. J. Mol. Sci. 2022, 23, 1549. [Google Scholar] [CrossRef] [PubMed]
- Ganeshan, S.; Vitamvas, P.; Fowler, D.B.; Chibbar, R.N. Quantitative expression analysis of selected cor genes reveals their differential expression in leaf and crown tissues of wheat (Triticum Aestivum L.) during an extended low temperature acclimation regimen. J. Exp. Bot. 2008, 59, 2393–2402. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.H.; Jiang, J.; Lin, S.J.; Wang, B.C.; Wang, Y.C.; Liu, G.F.; Yang, C.P. A Thcap gene from Tamarix Hispida confers cold tolerance in transgenic Populus (P. Davidiana X P. Bolleana). Biotechnol. Lett. 2009, 31, 1079–1087. [Google Scholar] [CrossRef]
- Kippes, N.; VanGessel, C.; Hamilton, J.; Akpinar, A.; Budak, H.; Dubcovsky, J.; Pearce, S. Effect of Phyb and Phyc loss-of-function mutations on the wheat transcriptome under short and long day photoperiods. BMC Plant Biol. 2020, 20, 297. [Google Scholar] [CrossRef] [PubMed]
- Konstantinov, D.K.; Zubairova, U.S.; Ermakov, A.A.; Doroshkov, A.V. Comparative transcriptome profiling of a resistant vs susceptible bread wheat (Triticum Aestivum L.) cultivar in response to water deficit and cold stress. PeerJ 2021, 9, e11428. [Google Scholar] [CrossRef] [PubMed]







| Gene ID | Forward Primer | Reverse Primer |
|---|---|---|
| TraesCS2B01G614400 | CCGACCGTACGTACTGATTAAC | CGGTGAAGCCGACTGATTAT |
| TraesCS6D01G054400 | GAGATTAGCAACCCTCCTTCTC | CTGGGCTCTCGAAGACATTT |
| TraesCS6B01G063400 | CATCGGCTCACATCTTGTACTC | CGAACCAGATTAACGGCTCTTAT |
| TraesCS7D01G347300 | GGCCTGAAATGGAGGAGAAA | CTACCCTGACGCAGATGTAAAG |
| TraesCS3D01G158600 | CCAACCTCGTGCCCTTTAT | ATCGGGATCGCTGTCAAATTA |
| TraesCS5B01G312000 | GTGGTGGTCAAGTACGCTAAT | CTCTCTTATAGCGGCAAGGATTT |
| TraesCS1D01G411000 | TCATTCTCTCCGGTCCTACTT | AGTGCTGAAAGGCGAGATAC |
| TraesCS2A01G048400 | CCTGCTGGTGAGGAAATTCA | CACCTTCTTCTTCTGTGCTCTC |
| Log2 Fold-Change | Gene ID | CS Log2 A/B | DM1 Log2 A/B | CS Log2 C/D | DM1 Log2 C/D |
|---|---|---|---|---|---|
| Cold-responsive protein | TraesCS5A01G403600 | 6.65 | 11.51 | 7.80 | 10.86 |
| TraesCS5B01G408300 | 7.48 | 11.23 | 6.06 | 9.97 | |
| TraesCS5D01G041400 | 8.00 | 11.23 | 7.29 | 10.93 | |
| TraesCS1D01G411000 | 4.03 | 14.51 | 7.16 | 11.75 | |
| TraesCS1B01G432400 | 5.93 | 11.83 | 6.46 | 11.12 | |
| TraesCS1A01G403000 | 6.50 | 14.34 | 7.13 | 12.53 | |
| TraesCS5A01G403700 | 0.50 | 0.89 | 1.11 | 1.50 | |
| Cold acclimation protein | TraesCS5A01G403600 | 2.73 | 3.78 | 3.53 | 4.56 |
| TraesCS5B01G408300 | 1.97 | 3.73 | 3.28 | 4.61 | |
| TraesCS5D01G041400 | 4.13 | 4.78 | 6.01 | 6.48 | |
| TraesCS1D01G411000 | 0.22 | 1.32 | 0.80 | 2.04 | |
| TraesCS1B01G432400 | 0.76 | 1.52 | 1.35 | 2.19 | |
| TraesCS1A01G403000 | 0.52 | 1.44 | 1.67 | 2.66 | |
| TraesCS5A01G403700 | 0.54 | −0.75 | 0.56 | −0.35 | |
| Cold-regulated protein | TraesCS3D01G156500 | 0.5 | 0.89 | 0.15 | 0.59 |
| TraesCS3A01G148700 | −0.19 | 0.63 | −0.31 | 0.21 | |
| TraesCS3D01G156500 | 0.5 | 0.89 | 0.15 | 0.59 | |
| TraesCS3B01G175900 | 1.04 | 1.55 | 1.54 | 1.24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, X.; Wu, Y.; Tang, C.; Liu, C.; Li, N.; Du, Y.; Fu, L.; Liu, X.; Liu, J.; Wang, X. Physiological and Transcriptome Analysis Reveals the Differences in Genes of Antioxidative Defense Components and Cold-Related Proteins in Winter and Spring Wheat during Cold Acclimation. Agronomy 2023, 13, 605. https://doi.org/10.3390/agronomy13020605
Lu X, Wu Y, Tang C, Liu C, Li N, Du Y, Fu L, Liu X, Liu J, Wang X. Physiological and Transcriptome Analysis Reveals the Differences in Genes of Antioxidative Defense Components and Cold-Related Proteins in Winter and Spring Wheat during Cold Acclimation. Agronomy. 2023; 13(2):605. https://doi.org/10.3390/agronomy13020605
Chicago/Turabian StyleLu, Xiaoguang, Yuhan Wu, Chaoyue Tang, Chang Liu, Ninghui Li, Yuchen Du, Lianshuang Fu, Xin Liu, Jun Liu, and Xiaonan Wang. 2023. "Physiological and Transcriptome Analysis Reveals the Differences in Genes of Antioxidative Defense Components and Cold-Related Proteins in Winter and Spring Wheat during Cold Acclimation" Agronomy 13, no. 2: 605. https://doi.org/10.3390/agronomy13020605
APA StyleLu, X., Wu, Y., Tang, C., Liu, C., Li, N., Du, Y., Fu, L., Liu, X., Liu, J., & Wang, X. (2023). Physiological and Transcriptome Analysis Reveals the Differences in Genes of Antioxidative Defense Components and Cold-Related Proteins in Winter and Spring Wheat during Cold Acclimation. Agronomy, 13(2), 605. https://doi.org/10.3390/agronomy13020605

