Cancers 2014, 6(1), 166-178; doi:10.3390/cancers6010166

Article
Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex
Vita M. Golubovskaya 1,*, Baotran Ho 1, Jeffrey Conroy 2, Song Liu 3, Dan Wang 3 and William G. Cance 1
1
Department of Surgical Oncology, Roswell Park Cancer Institute, Buffalo, NY 14263, USA; E-Mails: Baotran.Ho@roswellpark.org (B.H.); William.Cance@roswellpark.org (W.G.C.)
2
Genomics Shared Resource, Center for Personalized Medicine, Roswell Park Cancer Institute, Buffalo, NY 14263, USA; E-Mail: Jeffrey.Conroy@Roswellpark.org
3
Bioinformatics Core Facility, Biostatistics, Roswell Park Cancer Institute, Buffalo, NY 14263, USA; E-Mails: Song.Liu@roswellpark.org (S.L.); Dan.Wang@roswellpark.org (D.W.)
*
Author to whom correspondence should be addressed: E-Mail: Vita.Golubovskaya@roswellpark.org; Tel.: +1-716-845-3920; Fax: +1-716-845-3944.
Received: 22 November 2013; in revised form: 10 January 2014 / Accepted: 13 January 2014 /
Published: 21 January 2014

Abstract

: Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53+/+ and p53−/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53+/+ cells but not in p53−/− cells. Among up-regulated genes in HCT p53+/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53+/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach.
Keywords:
Focal Adhesion Kinase; p53; Mdm-2; Nutlin; gene expression profiling; microarrays; combination therapy

1. Introduction

Focal Adhesion Kinase (FAK) regulates many important cellular processes: proliferation, adhesion, spreading, motility, and survival [1,2,3]. The previous study demonstrated that p53 bound FAK promoter and repressed FAK transcription [4,5]. In addition, an analysis of 600 breast cancer tumors demonstrated that mutations of p53 highly correlated with FAK overexpression [6,7]. Moreover, estradiol caused p53-dependent inhibition of FAK expression in breast cancer cells [8]. These studies demonstrated the association of FAK and p53 signaling pathways in cancer [4,9].

Recently we have demonstrated a direct interaction of p53 protein with the N-terminal domain of FAK [4,10]. The interaction of FAK and p53 has been confirmed by another group, who demonstrated that FAK interacts not only with p53 but also with Mdm-2 to down-regulate p53 by ubiquitination [11]. We identified the 7 amino-acid binding site (amino-acids 65-72) in the proline-rich region of p53 protein that is involved in interaction with FAK [12] and by in silico modeling of NCI compound database we identified a small molecule compound Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) that directly bound to the N-terminal domain of FAK and disrupted FAK and p53 complex [13]. The R2 compound decreased viability and colony formation of colon cancer cells in a p53-dependent manner, and reactivated transcriptional activity of p53 with p21, Mdm-2 and Bax transcriptional targets [13]. In this report we performed microarray analysis with Illumina HumanRef-8 v3 bead chip on untreated HCTp53+/+ and HCTp53−/− cells and on the cells treated with R2 compound and revealed >1,484 genes significantly up- or down-regulated by R2 compound in a p53-dependent manner (p < 0.05). Among these genes the known p53 pro-apoptotic targets, such as Mdm-2, Noxa-1, and RIP1, were detected. Moreover, the combination of R2 with either M13 disrupting FAK and Mdm-2, or with Nutlin-1 disrupting p53 and Mdm-2 interaction, decreased HCT116 cancer cell clonogenicity more efficiently than each inhibitor alone in a p53-dependent manner. Thus, this study revealed a gene expression profile in response to R2 and demonstrated that its combination with M13 or Nutlin-1 can be a novel therapy approach to reactivate p53 and decrease the survival of cancer cells.

2. Results

2.1. Global Microarray Gene Profiling in HCT116 Cells Treated with R2 Demonstrated Up- and Down-Regulates Genes in a p53-Dependent Manner

To detect global gene profiling and reveal differentially expressed genes in response to R2 compound that disrupted FAK and p53 interaction [13], we performed a microarray analysis in R2-treated and untreated HCT116 p53+/+ and HCT116 p53−/− cells using an Illumina Human ref-8 v3.0 bead chip and compared global gene expression (Figure 1). Since recently we detected that treatment of HCT116 cells at 25 μM of R2 for 24 hours significantly up-regulated transcriptional activity of p53, we treated HCT116 p53+/+ and HCT116p53−/− cells with this dose of compound for 24 hours. The heatmap of the genes that are significantly up- or down-regulated, p < 0.05 in untreated and R2-treated HCT116 p53+/+ and p53−/− cells is shown in Figure 1. We detected 1,484 genes that were differentially expressed: down or up-regulated by 25 μM R2 treatment for 24 hours in HCT116 p53+/+ cells but not in HCT116 p53−/− cells (p < 0.05). The 961 genes were ≥1.2 fold significantly affected in HCT116p53+/+ cells, but not in HCTp53−/− cells. The Table 1 presents a list of important genes ≥1.2 fold significantly up- or down-regulated in HCT116 p53+/+ cells (p < 0.05), but not in HCT116 p53−/− cells and also shows several genes that were significantly inversely affected in both cell lines (marked by an asterisk).

Cancers 06 00166 g001 200
Figure 1. Gene expression profiling in HCT116 p53+/+ and HCT116 p53−/− cells in response to R2. The heatmap of untreated and R2-treated cells demonstrated significantly up-and down-regulated (p < 0.05) genes in colon cancer cells. The heatmap is shown in the left panel. Red indicates significantly up-regulated genes, and green indicates down-regulated genes (p < 0.05). Un-marks Untreated cells, R2 marks HCT116 cells treated with 25 μM R2 for 24 hours.

Click here to enlarge figure

Figure 1. Gene expression profiling in HCT116 p53+/+ and HCT116 p53−/− cells in response to R2. The heatmap of untreated and R2-treated cells demonstrated significantly up-and down-regulated (p < 0.05) genes in colon cancer cells. The heatmap is shown in the left panel. Red indicates significantly up-regulated genes, and green indicates down-regulated genes (p < 0.05). Un-marks Untreated cells, R2 marks HCT116 cells treated with 25 μM R2 for 24 hours.
Cancers 06 00166 g001 1024

Among the genes up or down-regulated by R2 in a p53-dependent manner, we detected up-regulated targets of p53, such as Mdm-2 and Noxa1 and pro-apoptotic proteins RIP-1 (Table 1). Among the down-regulated genes Met oncogene, PLK2, MTF1, KIF14, BIRC2 and other important genes were detected (Table 1).

Table 1. Several up-regulated and down-regulated genes by 25 μM R2 in HCT116 p53+/+ cells in a p53-dependent manner (≥1.2-fold, p < 0.05).

Click here to display table

Table 1. Several up-regulated and down-regulated genes by 25 μM R2 in HCT116 p53+/+ cells in a p53-dependent manner (≥1.2-fold, p < 0.05).
Up-regulated genes
HCT116 p53+/+ cellsHCT116p53−/− cells
Entrez
Gene ID
Gene SymbolNameFunctionFold Change
R2-treated/Untreated
p-valueFold ChangeR2-treated/Untreatedp-value
8737RIPK1Receptor (TNFRSF)-interacting serine-threonine kinase 1Apoptosis, regulation of I-kappa B/NF-kappa B cascade1.200.010.950.46
3725JUNJun oncogene Serine-threonine kinase 1Transcription1.210.071.010.83
10811NOXA1NADPH oxidase activatorSuperoxide metabolic process1.200.010.850.02
8739HRKHarakiri, Bcl2 interacting proteinInduction of apoptosis1.220.011.060.37
4193MDM2Mdm2 p53 binding protein homolog (mouse)Ubiquitination, negative regulation of proliferation1.220.030.920.29
10608MXD4MAX dimerization protein 4Negative regulation of transcription1.230.0251.000.93
5602MAPK13Mitogen-activated protein kinase 13Protein phosphorylation1.230.0170.870.08
3429IFI27Interferon inducible protein 27Interferon-regulated process1.250.0130.990.93
5300PIN1Peptidylprolil cis/trans isomeraseCell cycle, protein folding1.260.0040.950.49
7159TP53BP2 *Tumor p53 binding protein 2Apoptosis1.280.0140.790.02
9064MAP3K6Mitogen-activated kinase-kinase 6Protein phosphorylation1.280.0031.080.22
1396CRIP1Cysteine-rich protein 1Cell proliferation1.310.0261.170.046
7867MAPKAPK3Mitogen-activated protein kinase 3Protein phosphorylation1.360.00080.950.48
3675ITGA3Integrin, alpha 3Cell adhesion1.400.00031.10.13
5296PIK3R2Phosphoinositide-3-kinase, regulatory subunitSignal transduction1.410.000190.880.084
83990BRIP1 *BRCA1 interacting protein C-terminal helicase 1DNA damage checkpoijnt metabolic process1.430.00240.640.00056
90850ZNF598Zinc finger protein 598Protein binding1.510.00291.070.41
3659IRF1Interferon regulatory factor 1Regulation of interleukin-121.559.04E-051.000.99
85441PRIC285Peroxisomal proliferator-activated receptor A interacting complex 285Regulation of transcription1.584.98E-050.830.028
22937SCAPSREBF chaperoneLipid metabolic process1.611.5E-0.50.960.51
5652PRSS8Protease, serine, 8Proteolysis1.812.21E-060.960.59
147166TRIM16L *Tripartite motif-containing 16-like 1.840.0080.470.0025
Down-regulated genes
HCT116 p53+/+ cellsHCT116p53−/− cells
Entrez
Gene ID
Gene SymbolNameFunctionFold Change
R2-treated/Untreated
p-valueFold Change
R2-treated/Untreated
p-value
7272TTK *TTK protein kinaseProtein amino acid phosphorylation; Mitotic spindle organization0.820.0161.20.02
10769PLK2Polo-like kinase 2Mitotic cell cycle0.820.0191.050.47
4233METMet proto-oncogeneProtein amino acid phosphorylation; Multicellular organismal development0.810.010.890.14
27085MTBPMdm-2, transformed 3T3 cell double minute 2, p53 binding proteinUbiquitin-dependent protein catabolic process; cell cycle0.800.00661.130.1
4436MSH2Mut S homolog 2Mismatch repair0.80.0170.880.13
2353FOSFOS oncogeneDNA methylation, transcription0.770.0321.070.51
64282PAPD5 *PAP associated domain 5DNA replication; cell cycle0.770.0281.770.0007
9928KIF14Kinesin 14Microtubule-based movement0.760.011.020.82
9112MTA1Metastasis associated 1Regulation of transcription0.750.0261.260.06
7013TERF1 *Telomeric repeat binding factor 1Telomere maintenance via telomerase0.740.0011.260.0058
5099PCDH7Procadherin 7Cell adhesion0.730.0021.160.09
4774NFIANuclear factor 1/ADNA replication; transcription0.720.0081.230.06
54434SSH1 *Slingshot homolog 1Cell morphogenesis; cytoskeleton0.650.0151.530.015
329BIRC2Baculoviaral IAP repeat-containing 2Cell surface receptor linked signaling pathway;
regulation of apoptosis
0.621.43E-050.930.36
4520MTF 1 *Metal regulatory transcription factor 1Regulation of transcription;
Response to oxidative stress
0.580.0031.660.004

The genes encoding p53 targeted proteins or proteins associated with p53 pathway are marked in bold. * The significantly inversely affected genes in HCT116 p53+/+ and HCT116 p53−/− marked with an asterisk.

Real-time PCR analysis confirmed and validated several up-regulated genes: RIP1, Mdm-2, PRSS8, and BRIP, and several down-regulated genes: MET, MTF1, PLK1, and BIRC2 (Figure 2). The data of RT-PCR and microarray analyses were very similar (Figure 2). Thus, R2 reactivated p53 activity and affected many p53 target and critical genes in a p53-dependent manner.

Cancers 06 00166 g002 200
Figure 2. Real-time confirmed and validated differentially expressed up- and down-regulated (p < 0.05) genes in R2-treated cells versus untreated cells. The fold of RQ treated to untreated ratios is shown for RT-PCR. The bold black bars show average fold of ratios of R2 treated to untreated by microarray analysis and the striped black and white bars show average fold of mRNA levels of gene expression by RT-PCR analysis. Up-regulated and down-regulated genes are marked. The changes are statistically significant, p < 0.05.

Click here to enlarge figure

Figure 2. Real-time confirmed and validated differentially expressed up- and down-regulated (p < 0.05) genes in R2-treated cells versus untreated cells. The fold of RQ treated to untreated ratios is shown for RT-PCR. The bold black bars show average fold of ratios of R2 treated to untreated by microarray analysis and the striped black and white bars show average fold of mRNA levels of gene expression by RT-PCR analysis. Up-regulated and down-regulated genes are marked. The changes are statistically significant, p < 0.05.
Cancers 06 00166 g002 1024

2.2. The R2 Sensitized Cancer Cells to M13 (Disrupting FAK and Mdm-2) and Nutlin-1 (Disrupting p53 and Mdm-2) Treatments

Since we detected p53-dependent up-regulation of Mdm-2 expression (Table 1) in HCT116p53+/+ cells, and Mdm-2 was shown to bind FAK to down-regulate p53, providing survival to cancer cells [11], we used compound M13 that disrupted interaction of FAK and Mdm-2, called M13 that up-regulated p53 activity and caused apoptosis in HCT116 p53+/+ cells [14] in combination with R2 in clonogenicity assay to test if combination of R2 and M13 will decrease cancer cell clonogenicity more effectively than each agent alone. Figure 3A shows that combination of R2 and M13 is more effective in decreasing clonogenicity of HCT116 p53+/+ cells than each agent alone. This effect was not observed in HCT116 p53−/− cells.

Since Nutlin-1 that disrupts p53 and Mdm-2 protein interaction [15], also can induce p53, we treated HCT116 p53+/+ and HCT53−/− cells with either R2 alone, Nutlin-1 alone or with combination of R2 and Nutlin-1 (Figure 1B). The combination of R2 and Nutlin-1 also decreased number of colonies compared with each agent alone in HCT116 p53+/+ cells in a p53-dependent manner (Figure 3B). Thus, the combination of R2 and M13 or R2 and Nutlin-1 was more effective in decreasing clonogenicity than with each agent alone in HCTp53+/+ cells, but not in HCT116 p53−/− cells (Figure 3).

Cancers 06 00166 g003 200
Figure 3. R2 sensitized HCT116 cells to M13 and Nutlin. Clonogenicity assay was performed on HCT116p53+/+ cells or HCT116p53/ treated for one week either with R2 alone, M13 alone, or with a combination of R2 and M13 (A), or R2 alone, Nutlin-1 alone, or with combination of R2 and Nutlin-1 (B). The representative clonogenicity assay of several independent experiments is shown. Colonies were counted and quantification is shown on the right panels. Bars show average number of colonies per treatment from two or four independent experiments. * Student’s t-test, p < 0.05, R2+M13 or R2+Nutlin-1 versus untreated HCT116p53+/+ and HCT116 p53−/− or treated cells with a single agent. The p-values are shown in combination group versus single agent.

Click here to enlarge figure

Figure 3. R2 sensitized HCT116 cells to M13 and Nutlin. Clonogenicity assay was performed on HCT116p53+/+ cells or HCT116p53/ treated for one week either with R2 alone, M13 alone, or with a combination of R2 and M13 (A), or R2 alone, Nutlin-1 alone, or with combination of R2 and Nutlin-1 (B). The representative clonogenicity assay of several independent experiments is shown. Colonies were counted and quantification is shown on the right panels. Bars show average number of colonies per treatment from two or four independent experiments. * Student’s t-test, p < 0.05, R2+M13 or R2+Nutlin-1 versus untreated HCT116p53+/+ and HCT116 p53−/− or treated cells with a single agent. The p-values are shown in combination group versus single agent.
Cancers 06 00166 g003 1024

Thus, a combination of compounds that target FAK and p53, FAK and Mdm-2 or p53 and Mdm-2 can be an effective therapeutic approach to block colon cancer cells.

3. Experimental

3.1. Cell Lines and Culture

The early passage HCT116p53/ and HCT116p53+/+ colon cancer cells were obtained from Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD, USA) and maintained in McCoy’s5A medium with 10% FBS and 1 μg/mL penicillin/streptomycin. The cells were passaged less than two month after resuscitation of frozen aliquots.

3.2. Reagents

R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) was kindly provided by Drs. Ethirajan Manivannan and Ravindra Pandey (Roswell Park Cancer Institute, Buffalo, NY, USA). M13 (5'-O-tritylthymidine) and Nutlin-1 were obtained from Sigma (St. Louis, MO, USA). The compounds were solubilized in DMSO at a concentration of 25 mM.

3.3. Clonogenicity Assay

One thousand cells were plated on six-well plates and incubated with different R2 compound, M13, Nutlin-1 or with combination of R2 and M13 or R2 and Nutlin-1 compounds or without compound for seven or ten days. Then cells were fixed in 25% methanol and stained with Crystal Violet. The colonies were counted from two of four independent experiments per each treatment group.

3.4. RNA Isolation

The untreated and treated cells with 25 μM R2 for 24 hours were used for isolation of RNA. Total RNA was isolated from the frozen cell pellets using the RNeasy midi kits (Qiagen, Inc., Valencia, CA, USA) following the manufacturer’s instructions. Before labeling, RNA samples were quantitated using a ND-1000 spectrophotometer (Nano Drop, Wilmington, DE, USA).

3.5. Microarray Analysis

Expression profiling was accomplished using the HumanRef-8 whole-genome gene expression array and direct hybridization assay (Illumina, Inc., San Diego, CA, USA). Initially, 500 ng total RNA was converted to cDNA, followed by in vitro transcription to generate biotin labeled cRNA using the Ambion Illumina Total Prep RNA Amplification Kit (Ambion, Inc., Foster City, CA, USA) according to the manufacturer’s instructions. The labeled probes were hybridized overnight at 58 °C to the Illumina HumanRef-8v3BeadChips. Following washing and staining with Cy3-streptavidin conjugate, the BeadChips were imaged using the Illumina Bead Array Reader to measure fluorescence intensity at each probe. The raw intensity of each Illumina Human ref-8 v3.0 gene expression array was scanned and extracted using Bead Scan, with the data corrected by background subtraction in Genome Studio (v2010.1), gene expression module (v1.6.0). The BeadChip data files were further analyzed with a Bioconductor package to determine gene expression signal levels.

3.6. Bioinformatics and Statistical Analyses

The lumi module in the R-based Bioconductor package was used to transform the expression intensity to log2 scale. The log2 transformed intensity data were normalized using the Quantile normalization algorithm. The Limma program in the Bioconductor package under R computing environment was used to calculate the level of differential gene expression. Briefly, a linear model based on Bayesian method has been used to fit to the data (with cell means corresponding to the different conditions and a random effect for array). Each sample was analyzed in duplicate. For each comparison, we obtained the list of differentially expressed genes constrained by p-value < 0.05 and at least 1.2 fold change. Microarray and bioinformatics analysis were submitted to NCBI and the GEO accession number is GSE33918.

3.7. Real-Time PCR

Real-time PCR with forward and reverse primers and fluorescent probe 5’FAM and 3’TAMRA was performed, as described in [6]. The primers (marked f-for forward and r-for reverse) and fluorescent probes for microarray validation by RT-PCR were the following: RIP: f-5'-ATATCCCAGTGCCTGAGACC-3', r-5'-AGATTCATCTGTTGGTGGCA-3', and probe 5'-CCCAC CATGCCATTCAGCTCC-3'; Mdm-2: f-5'GAATCTACAGGGACGCCATC3', r-5'-CTGATCCAAC CAATCACCTG-3', and probe 5'-TCACTTACACCAGCATCAAGATCCGG-3'; PRSS8: f-5'-ATG GTGTGTGCTGGCTATGT-3', r-5'-CGTCAGGTACCAGAGACCCT-3', and probe 5'-CGCCTGCC AGGGTGACTCTG-3'; BRIP: f-5'-CAGATGAGGGCGTAAGTGAA-3', r-5'-TCTTTCAGAAGGT GGTGTGC-3', and probe 5'-TCATGTTGTTGTGCATGCCATTCA-3'; MET, f-5'-CAGCGCGTTGA CTTATTCAT-3', r-5'-CCCTCTGATGTCCCAAGATT-3' and probe 5'-CCACCTTCATTAAAGG AGACCTCACCA-3'; MTF, f-5'-CAATGCACTTCCACAACACA-3', r-5'-CCTGGGTCGTACTG GAATTT-3', and probe 5'-TTCTGTCCACAGATTCTGAATTGCGA-3'; PLK, f-5'-GAGCAGCTG AGCACATCATT-3', r-5'-CATGTGAGCACCATTGTTGA-3', and probe 5'-CAGACCACACCGTC GGTGTCC-3'; BIRC2, f-5'-GCTAGTCTGGGATCCACCTC-3', r-5'-AGAGGGTTTGGAGAAAG GCT-3', and probe 5'-TGCACATTCATTATCTCCCACCTTGG-3'. GAPDG was used as endogenous control, as described [6]. All experiments were performed in triplicates and RQ was calculated for each gene tested.

3.8. Statistical Analyses

Student’s t test was performed to determine significance. The difference between treated and untreated samples with p < 0.05 was considered significant.

4. Discussion

By microarray gene expression profiling analysis we identified differentially expressed genes in HCT116 p53+/+ cells affected by R2 in a p53-dependent manner. Among differentially expressed genes, important down-stream players of p53 signaling were identified, such as Mdm-2, Noxa-1, and RIP-1.

We detected 1484 genes that were up or down-regulated by R2 in HCT116p53+/+ cells but not in HCT116/− cells. Among these genes are Mdm-2, a known transcriptional target of p53 [16]. And it has been shown also to be up-regulated by Nutlins, which disrupted binding of Mdm-2 and p53 as a result of p53 increased activity and expression [16]. Among up-regulated genes, RIP-1 has been detected. In a previous report we demonstrated an association of FAK and RIP-1, where FAK sequestered pro-apoptotic RIP-1 from its pro-apoptotic functioning [17]. Thus, activation of RIP-1 by R2 can decrease the survival functions of colon cancer cells. Another gene, encoding Noxa-1 protein (Phorbol-12-myristate-13-acetate-induced protein 1) was one of the significantly up-regulated targets caused by R2. It is known that Noxa-1 is a transcriptional target of p53 and is a pro-apoptotic member of the Bcl-2 proteins family and is involved in p53-mediated apoptotic signaling [18].

Another up-regulated gene is BRIP1 (BRCA1-interacting protein 1) which encodes Fanconi anemia group J protein, a member of DNA helicase [19], known to be critical for breast cancer suppression and DNA repair. BRIP1 protein is mutated in the cancer prone syndrome Fanconi anemia, a disorder characterized by congenital malformations and a predisposition to the development of malignancies. At the molecular level, it is associated with chromosomal instability and defective DNA repair.

PRSS8 gene was also significantly up-regulated by R2. It encodes serine protease 8 or prostasin, known as a suppressor of invasion. Recently, loss of prostasin has been shown to be associated with epithelial-mesenchymal transition (EMT) [20].

Among down-regulated genes, Met gene encoding Met protooncogene has been detected. It is known that Met interacts with FAK and controls survival signaling in cancer cells [21]. Thus, the microarray study confirmed our functional data on up-regulation of p53 targets by R2 and revealed novel genes and signaling pathways affected by FAK and p53 disruption.

Another protein encoded by PLK2 (Polo-like Kinase 2), one of the p53 targets [22], was also affected by R2 [23]. Recently, PLK-2 deficient tumors demonstrated increased apoptosis in response to chemotherapy and silencing of PLK2 also caused increased apoptosis due to mitotic catastrophe, suggesting that PLK functions in the cell cycle arrest [24].

Among down-regulated proteins by R2 microarray analysis, we detected Mdm-2-binding protein, encoded by the MTBP gene. This protein has been shown to bind Mdm-2 [25] and regulates Mdm-2-dependent p53 homeostasis.

It is known that FAK and p53 interact and also that Mdm-2 interacts with p53 and with FAK [11]. Since, we detected increased Mdm-2 expression by R2, and Mdm-2 was shown to bind FAK and p53 to down-regulate p53 activity, we tested combination of drugs targeting of these complexes by combination of R2 and M13 or R2 and Nutlin-1. We demonstrated increased efficacy of the combinations in HCT116p53+/+ cells, but not HCTp53/− cells. Thus, the combination of therapies targeting FAK-p53 and FAK-Mdm-2 or FAK-p53 and Mdm-2-p53 can be important to enhance targeting of these complexes. Thus, Roslin 2 or R2 compound can be a potential approach for increasing p53 activity, similar to small molecule compounds such as Nutlins [16] or RITA [26] that are known to disrupt p53 and Mdm-2 interactions. The combination of FAK-p53 by R2 and FAK-Mdm-2 by M13 and Nutlin-1 targeting p53-Mdm-2 complexes can provide an effective combination therapy approach targeting the FAK scaffold [27] that can be used in future preclinical and clinical trials.

5. Conclusions

In conclusion, we demonstrated a gene expression profile in response to the small molecule compound R2 that targeted FAK and p53 interaction and showed that combination of FAK-p53-Mdm-2 targeting compounds that can be used as a novel approach in vivo. This study has a high impact on p53-regulated signaling and provides novel data on FAK and p53 interaction.

Acknowledgments

We would like to thank Andrew Gordon for help in editing the manuscript. The work was supported by NIH grant CA65910 (WGC), Susan G. Komen for the Cure BCTR0707148 (VMG) and partly by the NCI Cancer Center Support grant to the Roswell Park Cancer Institute (CA 16056).

Authors Contributions

Vita Golubovskaya and William Cance designed all experiments, wrote and edited manuscript. Baotran Ho performed drug treatments, RT-PCR and clonogenicity assays. Jeffrey Conroy contributed to the experimental design, running and analysis of the gene expression microarray assays. Song Liu and Dan Wang performed Bioinformatics and statistical analyses of gene expression data.

Conflicts of Interest

WG and VG are Co-Founders and shareholders of CureFAKtor Pharmaceuticals LLC.

References

  1. Hanks, S.K.; Polte, T.R. Signaling through focal adhesion kinase. Bioessays 1997, 19, 137–145, doi:10.1002/bies.950190208.
  2. Mitra, S.K.; Schlaepfer, D.D. Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr. Opin. Cell Biol. 2006, 18, 516–523, doi:10.1016/j.ceb.2006.08.011.
  3. McLean, G.W.; Carragher, N.O.; Avizienyte, E.; Evans, J.; Brunton, V.G.; Frame, M.C. The role of focal-adhesion kinase in cancer—A new therapeutic opportunity. Nat. Rev. Cancer 2005, 5, 505–515, doi:10.1038/nrc1647.
  4. Golubovskaya, V.M.; Cance, W.G. Focal adhesion kinase and p53 signaling in cancer cells. Int. Rev. Cytol. 2007, 263, 103–153.
  5. Golubovskaya, V.; Kaur, A.; Cance, W. Cloning and characterization of the promoter region of human focal adhesion kinase gene: Nuclear factor kappa B and p53 binding sites*1. Biochim. Biophys. Acta Gene Struct. Expr. 2004, 1678, 111–125, doi:10.1016/j.bbaexp.2004.03.002.
  6. Golubovskaya, V.M.; Conway-Dorsey, K.; Edmiston, S.N.; Tse, C.K.; Lark, A.A.; Livasy, C.A.; Moore, D.; Millikan, R.C.; Cance, W.G. FAK overexpression and p53 mutations are highly correlated in human breast cancer. Int. J. Cancer 2009, 125, 1735–1738, doi:10.1002/ijc.24486.
  7. Cance, W.G.; Golubovskaya, V.M. Focal adhesion kinase versus p53: Apoptosis or survival? Sci. Signal. 2008, 1, pe22.
  8. Anaganti, S.; Fernandez-Cuesta, L.; Langerod, A.; Hainaut, P.; Olivier, M. p53-Dependent repression of focal adhesion kinase in response to estradiol in breast cancer cell-lines. Cancer Lett. 2011, 300, 215–224, doi:10.1016/j.canlet.2010.10.008.
  9. Golubovskaya, V.M.; Cance, W. Focal adhesion kinase and p53 signal transduction pathways in cancer. Front. Biosci. 2010, 15, 901–912, doi:10.2741/3653.
  10. Golubovskaya, V.M.; Finch, R.; Cance, W.G. Direct interaction of the N-terminal domain of focal adhesion kinase with the N-terminal transactivation domain of p53. J. Biol. Chem. 2005, 280, 25008–25021, doi:10.1074/jbc.M414172200.
  11. Lim, S.T.; Chen, X.L.; Lim, Y.; Hanson, D.A.; Vo, T.T.; Howerton, K.; Larocque, N.; Fisher, S.J.; Schlaepfer, D.D.; Ilic, D. Nuclear FAK promotes cell proliferation and survival through FERM-enhanced p53 degradation. Mol. Cell. 2008, 29, 9–22, doi:10.1016/j.molcel.2007.11.031.
  12. Golubovskaya, V.M.; Finch, R.; Zheng, M.; Kurenova, E.V.; Cance, W.G. The 7-amino-acid site in the proline-rich region of the N-terminal domain of p53 is involved in the interaction with FAK and is critical for p53 functioning. Biochem. J. 2008, 411, 151–160, doi:10.1042/BJ20071657.
  13. Golubovskaya, V.M.; Ho, B.; Zheng, M.; Magis, A.; Ostrov, D.; Morrison, C.; Cance, W.G. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth. BMC Cancer 2013, 13, 342–348, doi:10.1186/1471-2407-13-342.
  14. Golubovskaya, V.; Palma, N.L.; Zheng, M.; Ho, B.; Magis, A.; Ostrov, D.; Cance, W.G. A small-molecule inhibitor, 5'-O-Tritylthymidine, targets FAK And Mdm-2 interaction, and blocks breast and colon tumorigenesis in vivo. Anticancer Agents Med. Chem. 2013, 13, 532–545, doi:10.2174/1871520611313040002.
  15. Vassilev, L.T.; Vu, B.T.; Graves, B.; Carvajal, D.; Podlaski, F.; Filipovic, Z.; Kong, N.; Kammlott, U.; Lukacs, C.; Klein, C.; et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004, 303, 844–848, doi:10.1126/science.1092472.
  16. Vassilev, L.T. p53 Activation by small molecules: Application in oncology. J. Med. Chem. 2005, 48, 4491–4499, doi:10.1021/jm058174k.
  17. Kurenova, E.; Xu, L.-H.; Yang, X.; Baldwin, A.S., Jr.; Craven, R.J.; Hanks, S.K.; Liu, Z.-G.; Cance, W.G. Focal adhesion kinase suppresses apoptosis by binding to the death domain of receptor-interacting protein. Mol. Cell. Biol. 2004, 24, 4361–4371, doi:10.1128/MCB.24.10.4361-4371.2004.
  18. Shibue, T.; Takeda, K.; Oda, E.; Tanaka, H.; Murasawa, H.; Takaoka, A.; Morishita, Y.; Akira, S.; Taniguchi, T.; Tanaka, N. Integral role of Noxa in p53-mediated apoptotic response. Genes Dev. 2003, 17, 2233–2238, doi:10.1101/gad.1103603.
  19. Xie, J.; Litman, R.; Wang, S.; Peng, M.; Guillemette, S.; Rooney, T.; Cantor, S.B. Targeting the FANCJ-BRCA1 interaction promotes a switch from recombination to poleta-dependent bypass. Oncogene 2010, 29, 2499–2508, doi:10.1038/onc.2010.18.
  20. Chen, L.M.; Verity, N.J.; Chai, K.X. Loss of prostasin (PRSS8) in human bladder transitional cell carcinoma cell lines is associated with epithelial-mesenchymal transition (EMT). BMC Cancer 2009, 9, 377, doi:10.1186/1471-2407-9-377.
  21. Chen, S.-Y.; Chen, H.-C. Direct interaction of Focal Adhesion Kinase (FAK) with Met is required for FAK to promote hepatocyte growth factor-induced cell invasion. Mol. Cell. Biol. 2006, 26, 5155–5167, doi:10.1128/MCB.02186-05.
  22. Smith, P.; Syed, N.; Crook, T. Epigenetic inactivation implies a tumor suppressor function in hematologic malignancies for Polo-like kinase 2 but not Polo-like kinase 3. Cell Cycle 2006, 5, 1262–1264, doi:10.4161/cc.5.12.2813.
  23. Burns, T.F.; Fei, P.; Scata, K.A.; Dicker, D.T.; El-Deiry, W.S. Silencing of the novel p53 target gene Snk/Plk2 leads to mitotic catastrophe in paclitaxel (taxol)-exposed cells. Mol. Cell. Biol. 2003, 23, 5556–5571, doi:10.1128/MCB.23.16.5556-5571.2003.
  24. Matthew, E.M.; Hart, L.S.; Astrinidis, A.; Navaraj, A.; Dolloff, N.G.; Dicker, D.T.; Henske, E.P.; El-Deiry, W.S. The p53 target Plk2 interacts with TSC proteins impacting mTOR signaling, tumor growth and chemosensitivity under hypoxic conditions. Cell Cycle 2009, 8, 4168–4175, doi:10.4161/cc.8.24.10800.
  25. Boyd, M.T.; Vlatkovic, N.; Haines, D.S. A novel cellular protein (MTBP) binds to MDM2 and induces a G1 arrest that is suppressed by MDM2. J. Biol. Chem. 2000, 275, 31883–31890, doi:10.1074/jbc.M004252200.
  26. Issaeva, N.; Bozko, P.; Enge, M.; Protopopova, M.; Verhoef, L.G.; Masucci, M.; Pramanik, A.; Selivanova, G. Small molecule RITA binds to p53, blocks p53-HDM-2 interaction and activates p53 function in tumors. Nat. Med. 2004, 10, 1321–1328, doi:10.1038/nm1146.
  27. Cance, W.G.; Kurenova, E.; Marlowe, T.; Golubovskaya, V. Disrupting the scaffold to improve focal adhesion kinase-targeted cancer therapeutics. Sci. Signal. 2013, 6, pe10.
Cancers EISSN 2072-6694 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert