Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder
Abstract
:1. Introduction
2. Results and Discussion
2.1. Hypomethylation of rDNA in Borderline Personality Disorder
Category | BPD Patients (n = 24) | Control Persons (n = 11) |
---|---|---|
Female | 24 | 11 |
Mean age (±SD) | 33 ± 11 | 32 ± 7 |
DSM-IV criteria 1 b | 75% (18/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 2 b | 54% (13/24) | 0% (p ≤ 0.003) c |
DSM-IV criteria 3 b | 92% (22/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 4 b | 63% (15/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 5 b | 88% (21/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 6 b | 88% (21/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 7 b | 58% (14/24) | 0% (p ≤ 0.002) c |
DSM-IV criteria 8 b | 63% (15/24) | 0% (p ≤ 0.001) c |
DSM-IV criteria 9 b | 54% (13/24) | 0% (p ≤ 0.003) c |
Observed positive diagnosis | 100% (24/24) | 0% (p ≤ 0.001) c |
Acute self injuring behavior (ASIB) a | 63% (15/24) | 0% (p ≤ 0.002) c |
Prior self injuring behavior (PSIB) a | 88% (21/24) | 0% (p ≤ 0.001) c |
Suicide background (SB) a | 83% (20/24) | 0% (p ≤ 0.001) c |
Nicotine consumption (NC) a | 71% (17/24) | 36% (4/11) (n.s.) c |
Alcohol abuse (AA) a | 25% (6/24) | 0% (n.s.) c |
Additional drug abuse (ADA) a | 17% (4/24) | 0% (n.s.) c |
Prior traumatic experience (PTE) a | 63% (15/24) | 0% (p ≤ 0.001) c |
2.2. Hypermethylation of PRIMA1 in Borderline Personality Disorder
3. Experimental Section
3.1. Tissue Samples
Patient No. | Age | Crit. 1 | Crit. 2 | Crit. 3 | Crit. 4 | Crit. 5 | Crit. 6 | Crit. 7 | Crit. 8 | Crit. 9 | ASIB a | PSIB a | SB a | NC a | AA a | ADA a | PTE a | Co-Diagnosis a |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | 40 | + | − | + | + | + | + | + | − | − | + | + | − | − | − | − | + | – |
2 | 33 | + | − | + | + | + | + | + | + | + | + | + | + | + | − | − | − | – |
3 | 24 | + | + | + | + | + | + | + | + | + | − | + | + | + | − | − | + | – |
4 | 40 | + | − | + | + | − | + | + | + | + | − | + | + | + | − | − | − | F10 |
5 | 52 | + | − | + | + | + | − | + | − | + | − | − | + | − | − | − | + | – |
6 | 17 | + | + | + | + | + | + | + | + | + | + | + | + | + | − | − | + | – |
7 | 28 | + | − | + | + | + | + | − | + | + | + | + | + | − | − | − | + | F42.2 |
8 | 47 | + | − | + | − | + | + | + | − | − | − | + | + | − | − | − | − | Depression; anorexia |
9 | 51 | + | − | + | − | + | + | + | − | − | − | + | + | + | − | − | Alcoholism | |
11 | 33 | + | − | + | + | + | + | − | + | + | + | + | + | + | + | canabis | + | Narcissistic personality disorder |
12 | 18 | − | + | + | + | + | + | − | − | − | + | + | + | + | − | − | + | – |
13 | 26 | + | + | + | + | + | + | − | + | − | + | + | + | + | + | Amphe−tamine | + | F19; ADHS, Polytox |
14 | 24 | + | + | + | − | + | − | + | − | + | + | + | + | − | − | − | − | Pregnancy |
15 | 52 | + | − | − | + | + | + | + | + | − | − | − | + | + | + | Temesta | + | F60.30; F33.1; F10.21; Z56/Z59/Z63 |
16 | 23 | + | + | + | − | + | + | − | − | + | + | + | + | + | − | − | + | – |
17 | 24 | + | + | + | − | + | + | + | − | − | + | + | + | + | − | − | + | – |
18 | 26 | − | + | + | − | + | + | + | + | − | + | + | + | + | − | − | + | – |
19 | 45 | + | + | + | − | − | + | − | + | + | − | − | − | − | − | − | − | F61 |
21 | 22 | − | + | + | + | + | + | − | − | − | + | + | + | + | + | − | − | – |
22 | 36 | + | + | + | − | + | + | − | + | + | + | + | + | − | − | − | − | – |
23 | 22 | + | + | − | + | − | + | + | + | − | + | + | − | + | + | + | + | F33.1 |
24 | 49 | − | − | + | + | + | + | + | + | + | − | + | + | + | − | − | − | – |
25 | 38 | − | + | + | + | + | + | − | + | + | − | + | + | + | + | − | − | – |
26 | 20 | + | − | + | − | + | + | − | + | − | + | + | − | + | − | − | + | – |
3.2. Methylation Analysis
Primer | Sequence (5′–3′) | Region |
---|---|---|
PROL | GTTTTYGTTGTGAGTTAGGTAGAGTTT | rDNA promoter |
PROF/PROFBIO | AAAAAAACRTCCCCAACCTCC | rDNA promoter |
PROSEQ | GGTTTATGTGGGGGAGAGGTTGT | rDNA promoter |
FETS | GTAGGGTTTTTTTTTTTTTTTAGGgGTTTT | 5′ETS |
LETS | CTAAAAAAAACTTTTCTCACCcAAAATAAA | 5′ETS |
PRIMABSU | GGTTGGTTTTAAATGGGGGTTGTT | PRIMA1 |
PRIMABIO3 | ACCTCATTACRCACACTACAACATAAA | PRIMA1 |
3.3. Statistical Evaluation
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Leichsenring, F.; Leibing, E.; Kruse, J.; New, A.S.; Leweke, F. Borderline personality disorder. Lancet 2011, 377, 74–84. [Google Scholar] [CrossRef]
- Lieb, K.; Zanarini, M.C.; Schmahl, C.; Linehan, M.M.; Bohus, M. Borderline personality disorder. Lancet 2004, 364, 453–461. [Google Scholar] [CrossRef]
- Skodol, A.E.; Gunderson, J.G.; McGlashan, T.H.; Dyck, I.R.; Stout, R.L.; Bender, D.S.; Grilo, C.M.; Shea, M.T.; Zanarini, M.C.; Morey, L.C.; et al. Functional impairment in patients with schizotypal, borderline, avoidant, or obsessive-compulsive personality disorder. Am. J. Psychiatry 2002, 159, 276–283. [Google Scholar] [CrossRef] [PubMed]
- Zimmerman, M. Diagnosing personality disorders. A review of issues and research methods. Arch. Gen. Psychiatry 1994, 51, 225–245. [Google Scholar] [CrossRef] [PubMed]
- Zanarini, M.C.; Frankenburg, F.R.; Hennen, J.; Reich, D.B.; Silk, K.R. Prediction of the 10-year course of borderline personality disorder. Am. J. Psychiatry 2006, 163, 827–832. [Google Scholar] [CrossRef] [PubMed]
- Siever, L.J.; Torgersen, S.; Gunderson, J.G.; Livesley, W.J.; Kendler, K.S. The borderline diagnosis III: Identifying endophenotypes for genetic studies. Biol. Psychiatry 2002, 51, 964–968. [Google Scholar] [CrossRef]
- Skodol, A.E.; Siever, L.J.; Livesley, W.J.; Gunderson, J.G.; Pfohl, B.; Widiger, T.A. The borderline diagnosis II: Biology, genetics, and clinical course. Biol. Psychiatry 2002, 51, 951–963. [Google Scholar] [CrossRef]
- Torgersen, S.; Czajkowski, N.; Jacobson, K.; Reichborn-Kjennerud, T.; Roysamb, E.; Neale, M.C.; Kendler, K.S. Dimensional representations of DSM-IV cluster B personality disorders in a population-based sample of norwegian twins: A multivariate study. Psychol. Med. 2008, 38, 1617–1625. [Google Scholar] [CrossRef] [PubMed]
- Soloff, P.H.; Lynch, K.G.; Kelly, T.M. Childhood abuse as a risk factor for suicidal behavior in borderline personality disorder. J. Pers. Disord. 2002, 16, 201–214. [Google Scholar] [CrossRef] [PubMed]
- Sillivan, S.E.; Vaissiere, T.; Miller, C.A. Neuroepigenetic regulation of pathogenic memories. Neuroepigenetics 2015, 1, 28–33. [Google Scholar] [CrossRef] [PubMed]
- Bird, A.P. CpG-rich islands and the function of DNA methylation. Nature 1986, 321, 209–213. [Google Scholar] [CrossRef] [PubMed]
- Dammann, R.; Li, C.; Yoon, J.H.; Chin, P.L.; Bates, S.; Pfeifer, G.P. Epigenetic inactivation of a ras association domain family protein from the lung tumour suppressor locus 3p21.3. Nat. Genet. 2000, 25, 315–319. [Google Scholar] [PubMed]
- Teschler, S.; Richter, A.; Linder, B.; Dammann, R. Aberrant DNA methylation of ribosomal RNA genes in human cancer. Mol. Biol. 2015, 4, 2. [Google Scholar]
- Sabunciyan, S.; Aryee, M.J.; Irizarry, R.A.; Rongione, M.; Webster, M.J.; Kaufman, W.E.; Murakami, P.; Lessard, A.; Yolken, R.H.; Feinberg, A.P.; et al. Genome-wide DNA methylation scan in major depressive disorder. PLoS ONE 2012, 7, e34451. [Google Scholar] [CrossRef] [PubMed]
- Alisch, R.S.; Chopra, P.; Fox, A.S.; Chen, K.; White, A.T.; Roseboom, P.H.; Keles, S.; Kalin, N.H. Differentially methylated plasticity genes in the amygdala of young primates are linked to anxious temperament, an at risk phenotype for anxiety and depressive disorders. J. Neurosci. 2014, 34, 15548–15556. [Google Scholar] [CrossRef] [PubMed]
- Turecki, G. The molecular bases of the suicidal brain. Nat. Rev. Neurosci. 2014, 15, 802–816. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, M.; Miyagawa, K.; Takeda, H. Epigenetic regulation of resistance to emotional stress: Possible involvement of 5-HT1A receptor-mediated histone acetylation. J. Pharm. Sci. 2014, 125, 347–354. [Google Scholar] [CrossRef]
- Carrard, A.; Salzmann, A.; Malafosse, A.; Karege, F. Increased DNA methylation status of the serotonin receptor 5HTR1A gene promoter in schizophrenia and bipolar disorder. J. Affect. Disord. 2011, 132, 450–453. [Google Scholar] [CrossRef] [PubMed]
- Dammann, G.; Teschler, S.; Haag, T.; Altmuller, F.; Tuczek, F.; Dammann, R.H. Increased DNA methylation of neuropsychiatric genes occurs in borderline personality disorder. Epigenetics 2011, 6, 1454–1462. [Google Scholar] [CrossRef] [PubMed]
- Groleau, P.; Joober, R.; Israel, M.; Zeramdini, N.; DeGuzman, R.; Steiger, H. Methylation of the dopamine D2 receptor (DRD2) gene promoter in women with a bulimia-spectrum disorder: Associations with borderline personality disorder and exposure to childhood abuse. J. Psychiatr. Res. 2014, 48, 121–127. [Google Scholar] [CrossRef] [PubMed]
- Grosjean, B.; Tsai, G.E. Nmda neurotransmission as a critical mediator of borderline personality disorder. J. Psychiatry Neurosci. 2007, 32, 103–115. [Google Scholar] [PubMed]
- Martin-Blanco, A.; Ferrer, M.; Soler, J.; Salazar, J.; Vega, D.; Andion, O.; Sanchez-Mora, C.; Arranz, M.J.; Ribases, M.; Feliu-Soler, A.; et al. Association between methylation of the glucocorticoid receptor gene, childhood maltreatment, and clinical severity in borderline personality disorder. J. Psychiatr. Res. 2014, 57, 34–40. [Google Scholar] [CrossRef] [PubMed]
- Perroud, N.; Paoloni-Giacobino, A.; Prada, P.; Olie, E.; Salzmann, A.; Nicastro, R.; Guillaume, S.; Mouthon, D.; Stouder, C.; Dieben, K.; et al. Increased methylation of glucocorticoid receptor gene (NR3C1) in adults with a history of childhood maltreatment: A link with the severity and type of trauma. Transl. Psychiatry 2011, 1, e59. [Google Scholar] [CrossRef] [PubMed]
- Perroud, N.; Salzmann, A.; Prada, P.; Nicastro, R.; Hoeppli, M.E.; Furrer, S.; Ardu, S.; Krejci, I.; Karege, F.; Malafosse, A. Response to psychotherapy in borderline personality disorder and methylation status of the bdnf gene. Transl. Psychiatry 2013, 3, e207. [Google Scholar] [CrossRef] [PubMed]
- Prados, J.; Stenz, L.; Courtet, P.; Prada, P.; Nicastro, R.; Adouan, W.; Guillaume, S.; Olie, E.; Aubry, J.M.; Dayer, A.; et al. Borderline personality disorder and childhood maltreatment: A genome-wide methylation analysis. Genes Brain Behav. 2015, 14, 177–188. [Google Scholar] [CrossRef] [PubMed]
- Steiger, H.; Labonte, B.; Groleau, P.; Turecki, G.; Israel, M. Methylation of the glucocorticoid receptor gene promoter in bulimic women: Associations with borderline personality disorder, suicidality, and exposure to childhood abuse. Int. J. Eating Disord. 2013, 46, 246–255. [Google Scholar] [CrossRef] [PubMed]
- Tadic, A.; Elsasser, A.; Victor, A.; von Cube, R.; Baskaya, O.; Wagner, S.; Lieb, K.; Hoppner, W.; Dahmen, N. Association analysis of serotonin receptor 1B (HTR1B) and brain-derived neurotrophic factor gene polymorphisms in borderline personality disorder. J. Neural Transm. 2009, 116, 1185–1188. [Google Scholar] [CrossRef] [PubMed]
- Teschler, S.; Bartkuhn, M.; Kunzel, N.; Schmidt, C.; Kiehl, S.; Dammann, G.; Dammann, R. Aberrant methylation of gene associated CpG sites occurs in borderline personality disorder. PLoS ONE 2013, 8, e84180. [Google Scholar] [CrossRef] [PubMed]
- Thaler, L.; Gauvin, L.; Joober, R.; Groleau, P.; de Guzman, R.; Ambalavanan, A.; Israel, M.; Wilson, S.; Steiger, H. Methylation of bdnf in women with bulimic eating syndromes: Associations with childhood abuse and borderline personality disorder. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2014, 54, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Massoulie, J. The origin of the molecular diversity and functional anchoring of cholinesterases. Neuro-Signals 2002, 11, 130–143. [Google Scholar] [CrossRef] [PubMed]
- Noureddine, H.; Schmitt, C.; Liu, W.; Garbay, C.; Massoulie, J.; Bon, S. Assembly of acetylcholinesterase tetramers by peptidic motifs from the proline-rich membrane anchor, prima: Competition between degradation and secretion pathways of heteromeric complexes. J. Biol. Chem. 2007, 282, 3487–3497. [Google Scholar] [CrossRef] [PubMed]
- Siever, L.J.; Weinstein, L.N. The neurobiology of personality disorders: Implications for psychoanalysis. J. Am. Psychoanal. Assoc. 2009, 57, 361–398. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Marsa, M.; Macdowell, K.S.; Guemes, I.; Rubio, V.; Carrasco, J.L.; Leza, J.C. Activation of the cholinergic anti-inflammatory system in peripheral blood mononuclear cells from patients with borderline personality disorder. J. Psychiatr. Res. 2012, 46, 1610–1617. [Google Scholar] [CrossRef] [PubMed]
- Powell, M.A.; Mutch, D.G.; Rader, J.S.; Herzog, T.J.; Huang, T.H.; Goodfellow, P.J. Ribosomal DNA methylation in patients with endometrial carcinoma: An independent prognostic marker. Cancer 2002, 94, 2941–2952. [Google Scholar] [CrossRef] [PubMed]
- Pietrzak, M.; Rempala, G.; Nelson, P.T.; Zheng, J.J.; Hetman, M. Epigenetic silencing of nucleolar rRNA genes in Alzheimer’s disease. PLoS ONE 2011, 6, e22585. [Google Scholar] [CrossRef] [PubMed]
- McGowan, P.O.; Sasaki, A.; Huang, T.C.; Unterberger, A.; Suderman, M.; Ernst, C.; Meaney, M.J.; Turecki, G.; Szyf, M. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain. PLoS ONE 2008, 3, e2085. [Google Scholar] [CrossRef] [PubMed]
- Ghoshal, K.; Majumder, S.; Datta, J.; Motiwala, T.; Bai, S.; Sharma, S.M.; Frankel, W.; Jacob, S.T. Role of human ribosomal RNA (rRNA) promoter methylation and of methyl-CPG-binding protein MBD2 in the suppression of rRNA gene expression. J. Biol. Chem. 2004, 279, 6783–6793. [Google Scholar] [CrossRef] [PubMed]
- Bacalini, M.G.; Pacilli, A.; Giuliani, C.; Penzo, M.; Trere, D.; Pirazzini, C.; Salvioli, S.; Franceschi, C.; Montanaro, L.; Garagnani, P. The nucleolar size is associated to the methylation status of ribosomal DNA in breast carcinomas. BMC Cancer 2014, 14, 361. [Google Scholar] [CrossRef] [PubMed]
- Toyota, M.; Ho, C.; Ahuja, N.; Jair, K.W.; Li, Q.; Ohe-Toyota, M.; Baylin, S.B.; Issa, J.P. Identification of differentially methylated sequences in colorectal cancer by methylated cpg island amplification. Cancer Res. 1999, 59, 2307–2312. [Google Scholar] [PubMed]
- Yan, P.S.; Rodriguez, F.J.; Laux, D.E.; Perry, M.R.; Standiford, S.B.; Huang, T.H. Hypermethylation of ribosomal DNA in human breast carcinoma. Br. J. Cancer 2000, 82, 514–517. [Google Scholar] [CrossRef] [PubMed]
- Conconi, A.; Widmer, R.M.; Koller, T.; Sogo, J.M. Two different chromatin structures coexist in ribosomal RNA genes throughout the cell cycle. Cell 1989, 57, 753–761. [Google Scholar] [CrossRef]
- Grummt, I.; Langst, G. Epigenetic control of RNA polymerase i transcription in mammalian cells. Biochim. Biophys. Acta 2013, 1829, 393–404. [Google Scholar] [CrossRef] [PubMed]
- Preuss, S.; Pikaard, C.S. rRNA gene silencing and nucleolar dominance: Insights into a chromosome-scale epigenetic on/off switch. Biochim. Biophys. Acta 2007, 1769, 383–392. [Google Scholar] [CrossRef] [PubMed]
- Dammann, R.; Lucchini, R.; Koller, T.; Sogo, J.M. Transcription in the yeast rRNA gene locus: Distribution of the active gene copies and chromatin structure of their flanking regulatory sequences. Mol. Cell. Biol. 1995, 15, 5294–5303. [Google Scholar] [CrossRef] [PubMed]
- Stancheva, I.; Lucchini, R.; Koller, T.; Sogo, J.M. Chromatin structure and methylation of rat rRNA genes studied by formaldehyde fixation and psoralen cross-linking. Nucleic Acids Res. 1997, 25, 1727–1735. [Google Scholar] [CrossRef] [PubMed]
- Santoro, R.; Grummt, I. Molecular mechanisms mediating methylation-dependent silencing of ribosomal gene transcription. Mol. Cell 2001, 8, 719–725. [Google Scholar] [CrossRef]
- Dammann, R.; Lucchini, R.; Koller, T.; Sogo, J.M. Chromatin structures and transcription of rDNA in yeast saccharomyces cerevisiae. Nucleic Acids Res. 1993, 21, 2331–2338. [Google Scholar] [CrossRef] [PubMed]
- Zentner, G.E.; Saiakhova, A.; Manaenkov, P.; Adams, M.D.; Scacheri, P.C. Integrative genomic analysis of human ribosomal DNA. Nucleic Acids Res. 2011, 39, 4949–4960. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.Q.; Choi, R.C.; Leung, K.W.; Chen, V.P.; Chu, G.K.; Tsim, K.W. Transcriptional regulation of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase in neuron: An inductive effect of neuron differentiation. Brain Res. 2009, 1265, 13–23. [Google Scholar] [CrossRef] [PubMed]
- Perrier, N.A.; Kherif, S.; Perrier, A.L.; Dumas, S.; Mallet, J.; Massoulie, J. Expression of prima in the mouse brain: Membrane anchoring and accumulation of 'tailed' acetylcholinesterase. Eur. J. Neurosci. 2003, 18, 1837–1847. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.Q.; Liang, D.; Leung, K.W.; Chen, V.P.; Zhu, K.Y.; Chan, W.K.; Choi, R.C.; Massoulie, J.; Tsim, K.W. Targeting acetylcholinesterase to membrane rafts: A function mediated by the proline-rich membrane anchor (PRiMA) in neurons. J. Biol. Chem. 2010, 285, 11537–11546. [Google Scholar] [CrossRef] [PubMed]
- Dobbertin, A.; Hrabovska, A.; Dembele, K.; Camp, S.; Taylor, P.; Krejci, E.; Bernard, V. Targeting of acetylcholinesterase in neurons in vivo: A dual processing function for the proline-rich membrane anchor subunit and the attachment domain on the catalytic subunit. J. Neurosci. Off. J. Soc. Neurosci. 2009, 29, 4519–4530. [Google Scholar] [CrossRef] [PubMed]
- Shaikh, S.; Verma, A.; Siddiqui, S.; Ahmad, S.S.; Rizvi, S.M.; Shakil, S.; Biswas, D.; Singh, D.; Siddiqui, M.H.; Shakil, S.; et al. Current acetylcholinesterase-inhibitors: A neuroinformatics perspective. CNS Neurol. Disord. Drug Targets 2014, 13, 391–401. [Google Scholar] [CrossRef] [PubMed]
- Steinberg, B.J.; Trestman, R.; Mitropoulou, V.; Serby, M.; Silverman, J.; Coccaro, E.; Weston, S.; de Vegvar, M.; Siever, L.J. Depressive response to physostigmine challenge in borderline personality disorder patients. Neuropsychopharmacology 1997, 17, 264–273. [Google Scholar] [CrossRef]
- First, M.B.; Gibbon, M.; Spitzer, R.L. User's Guide for the Structured Clinical Interview for DSM-IV Axis II Personality Disorders: Scid-II; American Psychiatric Publishing: Arlington, VA, USA, 1997. [Google Scholar]
- APA. Diagnostic and Statistical Manual of Mental Disorders, 4th ed.; APA: Washington, DC, USA, 1994; p. 886. [Google Scholar]
- Tost, J.; Gut, I.G. DNA methylation analysis by pyrosequencing. Nat. Protoc. 2007, 2, 2265–2275. [Google Scholar] [CrossRef] [PubMed]
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teschler, S.; Gotthardt, J.; Dammann, G.; Dammann, R.H. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder. Int. J. Mol. Sci. 2016, 17, 67. https://doi.org/10.3390/ijms17010067
Teschler S, Gotthardt J, Dammann G, Dammann RH. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder. International Journal of Molecular Sciences. 2016; 17(1):67. https://doi.org/10.3390/ijms17010067
Chicago/Turabian StyleTeschler, Stefanie, Julia Gotthardt, Gerhard Dammann, and Reinhard H. Dammann. 2016. "Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder" International Journal of Molecular Sciences 17, no. 1: 67. https://doi.org/10.3390/ijms17010067