Effects of Polymorphisms in Pepsinogen (PEP), Amylase (AMY) and Trypsin (TRY) Genes on Food Habit Domestication Traits in Mandarin Fish
Abstract
:1. Introduction
2. Results
2.1. Genetic Polymorphism of PEP, AMY and TRY Gene
2.2. Analysis of Genotype Frequencies, Allele Frequencies and Genetic Diversity Parameter at Each SNPs in PEP and TRY Gene
2.3. Associations of Genotypes and Diplotypes with Food Habit Domestication Traits
3. Discussion
4. Experimental Section
4.1. Fish and DNA Samples
4.2. SNP Discovery
4.3. Genotyping of SNPs
4.4. Statistical Analysis
5. Conclusions
PEP T2477C | |||||||||
---|---|---|---|---|---|---|---|---|---|
Groups | Sample size | Genotype frequencies | Allelic frequencies | HWE | PIC | He | |||
CC | CT | TT | C | T | |||||
Feeders | 120 | 0.0000(0) | 0.2167(26) | 0.7833(94) | 0.1083 | 0.8917 | X2 = 1.6970 | 0.1745 | 0.1940 |
p = 0.1927 | |||||||||
Nonfeeders | 120 | 0.0000(0) | 0.2917(35) | 0.7083(85) | 0.1458 | 0.8542 | X2 = 3.3862 | 0.2181 | 0.2502 |
p = 0.0657 | |||||||||
PEPC2528T | |||||||||
Groups | Sample size | Genotype frequencies | Allelic frequencies | HWE | PIC | He | |||
CC | CT | TT | C | T | |||||
Feeders | 120 | 0.6667(80) | 0.2750(33) | 0.0583(7) | 0.8042 | 0.1958 | X2 = 2.0823 | 0.2653 | 0.3163 |
p = 0.1490 | |||||||||
Nonfeeders | 120 | 0.5583(67) | 0.3417(41) | 0.1000(12) | 0.7292 | 0.2708 | X2 = 2.3333 | 0.3169 | 0.3966 |
p = 0.1266 | |||||||||
TRYG648A | |||||||||
Groups | Sample size | Genotype frequencies | Allelic frequencies | HWE | PIC | He | |||
AA | AG | GG | A | G | |||||
Feeders | 120 | 0.2250(27) | 0.4750(57) | 0.3000(36) | 0.4625 | 0.5375 | X2 = 0.2859 | 0.3734 | 0.4993 |
p = 0.5928 | |||||||||
Nonfeeders | 120 | 0.2083(25) | 0.5333(64) | 0.2583(31) | 0.4750 | 0.5250 | X2 = 0.5095 | 0.3744 | 0.5008 |
p = 0.4754 |
Diplotype | SNPs site | Frequency | ||
---|---|---|---|---|
T2477C | C2528T | feeders | nonfeeders | |
Dip1 | CT | CC | 0.1525 | 0.1709 |
Dip2 | CT | CT | 0.0508 | 0.1026 |
Dip3 | TT | CC | 0.5254 | 0.4017 |
Dip4 | TT | CT | 0.2288 | 0.2479 |
Dip5 | TT | TT | 0.0424 | 0.0769 |
Diplotype | Feeders | Nonfeeders | p Value |
---|---|---|---|
Dip1 | 80 | 20 | 0.000 |
Non-Dip1 | 38 | 97 | |
Dip2 | 6 | 12 | 0.136 |
Non-Dip2 | 112 | 105 | |
Dip3 | 62 | 47 | 0.057 |
Non-Dip3 | 56 | 70 | |
Dip4 | 27 | 29 | 0.732 |
Non-Dip4 | 91 | 88 | |
Dip5 | 45 | 9 | 0.000 |
Non-Dip5 | 73 | 108 |
Primer pair name | Primer sequence | Annealing Temperature (°C) | Amplified region |
---|---|---|---|
PEP-01F | TTACCAGTTAGCACCTTCAGCATG | 59 | 5′ flanking-Intron 1 |
PEP-01R | TTGAGCCTGTACTCCTCCCATAGA | ||
PEP-02F | AAAAGGCAATGTAGCCGAACG | 57 | Exon 2-Exon 4 |
PEP-02R | TGTCATATCCAAGGTAGCCAGTCA | ||
PEP-03F | AGGCAAGAGCAGCACCTACAGAAA | 55 | Exon 4-Intron 6 |
PEP-03R | TGCAAGCCACAACCTGACCATT | ||
PEP-04F | TGGTGTTGACCCCAACCACTACTA | 58 | Exon 6-Exon 9 |
PEP-04R | ATAATTACAGTAGCACTG | ||
AMY-01F | GTTGCTGCTGAATCCTTG | 57 | 5′ flanking-Intron 2 |
AMY-01R | GGTAGATGCAGGATTGTA | ||
AMY-02F | CTGTGTTGTTGCTCAGA | 57 | Exon 2-Exon 4 |
AMY-02R | TGAGCTGAAGCCACTAA | ||
AMY-03F | GAGTGGATGCCTGCAAG | 60 | Exon 4-Exon 5 |
AMY-03R | CAGTGACCCTTCCCAGATG | ||
AMY-04F | GTGCAGTTAATCTAACCCAT | 58 | Exon 5-Exon 6 |
AMY-04R | ATCTTGTAGAGCCTGGAAT | ||
AMY-05F | CAACCACGACAACCAGAGAG | 57 | Exon 6-Exon 9 |
AMY-05R | CACCTGTTTCCTTCCTTC | ||
TRY-01F | TTGTTCTGCACCACATCC | 59 | 5′ flanking |
TRY-01R | GTGGTGTGCCATGATGC | ||
TRY-02F | TAGAGAGTTGTCAGTCAATGC | 59 | 5′ flanking-Exon 1 |
TRY-02R | AGGAACTTACAGGCTGCA | ||
TRY-03F | GTACGCTCAGTAGGTG | 55 | Exon 1-Exon 5 |
TRY-03R | CAGGAGTTGTAGTTGCAGACC |
Gene | SNPs locus | Genotyping primer | |
---|---|---|---|
PEP | T2477C | forward | AGTGTTGTGACCTTCGGTGG |
C2528T | reverse | ACTCGTCTTTCTTGGCGCTT | |
TRY | G648A | forward | TAAGGTCATCCGTCACCCCA |
reverse | CATACCCCGACGTGTACCAA |
Acknowledgments
Conflicts of Interest
References
- Liu, Y.L.; Cui, X.Q. The research of Siniperca chuatsi. Reserv. Fish 1989, 4, 49–52. [Google Scholar]
- Liang, X.F.; Oku, H.; Ogata, H.Y.; Liu, J.; He, X. Weaning Chinese perch Siniperca chuatsi (Basilewsky) onto artificial diets based upon its specific sensory modality in feeding. Aquac. Res 2001, 32, 76–82. [Google Scholar]
- Purnell, M.A.; Bell, M.A.; Baines, D.C.; Hart, P.J.; Travis, M.P. Correlated evolution and dietary change in fossil stickleback. Science 2007, 317, 1887. [Google Scholar]
- Beaver, K.M.; Flores, T.; Boutwell, B.B.; Gibson, C.L. Genetic influences on adolescent eating habits. Health Educ. Behav 2012, 39, 142–151. [Google Scholar]
- Snow, J.R. An Exploratory Attempt to Rear Largemouth Bass Fingerlings in a Controlled Environment. Proceeding of the Annual Conference Southeastern Association of Game and Fish Commissioners, Biloxi, MS, USA, October 1960; pp. 253–257.
- Snow, J.R. Results of Further Experiments on Rearing Largemouth Bass Fingerlings under Controlled Conditions. Proceeding of the Annual Conference Southeastern Association of Game and Fish Commissioners, Hot Springs, AR, USA, October 1963; pp. 191–203.
- Snow, J.R. The Oregon moist pellet as a diet for largemouth bass. Progress. Fish-Cult 1968, 30, 235. [Google Scholar]
- Snow, J.R.; Maxwell, J.I. Oregon moist pellet as a production ration for largemouth bass. Progress. Fish-Cult 1970, 32, 101–102. [Google Scholar]
- Williamson, J.H. Comparing training success of two strains of largemouth bass. Progress. Fish-Cult 1983, 45, 3–7. [Google Scholar]
- Barreiro, L.B.; Laval, G.; Quach, H.; Patin, E.; Quintana-Murci, L. Natural selection has driven population differentiation in modern humans. Nat. Genet 2008, 40, 340–345. [Google Scholar]
- Smith, L.S. Digestion in teleost fish. In Lectures Presented at the FAO/UNPD Training Course in Fish Feed Technology; United Nations Development Programme: Seattle, WA, USA, 1980; pp. 3–17. [Google Scholar]
- Reimer, G. The influence of diet on the digestive enzymes of the Amazon fish Matrincha, Bricon cf. melanopterus. J. Fish. Biol 1982, 21, 637–642. [Google Scholar]
- Ugolev, A.M.; Kuzmina, V.V. Fish enterocyte hydrolases. Nutrition adaptations. Comp. Biochem. Physiol 1994, 107, 187–193. [Google Scholar]
- Hidalgo, M.C.; Urea, E.; Sanz, A. Comparative study of digestive enzymes in fish with different nutritional habitus. Proteolytic and amylase activities. Aquaculture 1999, 170, 267–283. [Google Scholar]
- Tengjaroenkul, B.; Smith, B.J.; Caceci, R.; Smith, S.A. Distribution of intestinal enzyme activities along the intestinal tract of cultured Nile tilapia Oreochromis niloticus L. Aquaculture 2000, 182, 317–327. [Google Scholar]
- Lundstedt, L.M.; Melo, J.F.B.; Santos, N.C.; Moraes, G. Diet Influences Proteolytic Enzyme Profile of the South American Catfish Rhamdia Quelen. Proceedings of the International Congress on the Biology of Fish, Biochemical and Physiological Advances in Finfish Aquaculture, Vancouver, Canada, July 2005; pp. 65–71.
- Corring, T.; Juste, C.; Lhoste, E.F. Nutritional regulation of pancreatic and biliary secretions. Nutr. Res. Rev 1989, 2, 161–180. [Google Scholar]
- Le Huerou-Luron, I.; Lhoste, E.; Wicker-Planquart, C.; Dakka, N.; Toullec, R.; Corring, T.; Guilloteau, P.; Puigserver, A. Molecular aspects synthesis in the exocrine pancreas with emphasis on development and nutritional regulation. Proc. Nutr. Soc 1993, 52, 301–313. [Google Scholar]
- Foltmann, B. Gastric proteinases-structure, function, evolution and mechanism of action. Essays Biochem 1981, 17, 52–84. [Google Scholar]
- Marcuschi, M.; Esposito, T.S.; Machado, M.F.M.; Hirata, I.Y.; Machado, M.F.M.; Silva, M.V.; Carvalho, L.B.; Oliveira, V.; Bezerra, R.S. Purification, characterization and substrate specificity of a trypsin from the Amazonian fish tambaqui (Colossoma macropomum). Biochem. Biophys. Res. Commun 2010, 396, 667–673. [Google Scholar]
- Dabrowski, K.R. Problems in the Determination of Nitrogen Compounds when Applied to Fish Feeding Experiments; Proceedings of the World Symposium on Finfish Nutrition and Fishfeed Technology, Heinemann Berlin, Germany, June 1979, Halver, J.E., Tiews, K., Eds.; Volume II, pp. 519–527.
- Weihs, D. Energetic significance of changes in swimming modes during growth of larval anchovy, Engraulis mordax. U.S. Natl. Mar. Fish. Serv. Fish. Bull 1980, 77, 597–604. [Google Scholar]
- Drysdale, C.M.; McGraw, D.W.; Stack, C.B.; Stephens, J.C.; Judson, R.S.; Nandabalan, K.; Liggett, S.B. Complex promoter and coding region β2-adrenergic receptor haplotypes alter receptor expression and predict in vivo responsiveness. Proc. Natl. Acad. Sci. USA 2000, 97, 10483–10488. [Google Scholar]
- Qian, G.Y. Change of digestive enzyme active cities in intestinal canal of domesticated mandarin fish. J. Zhejiang Agric. Univ 1998, 24, 207–210. [Google Scholar]
- Shete, S.; Tiwari, H.; Elston, R.C. On estimating the heterozygosity and polymorphism information content value. Theor. Popul. Boil 2000, 57, 265–271. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet 1980, 32, 314–331. [Google Scholar]
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Yi, T.; Sun, J.; Liang, X.; He, S.; Li, L.; Wen, Z.; Shen, D. Effects of Polymorphisms in Pepsinogen (PEP), Amylase (AMY) and Trypsin (TRY) Genes on Food Habit Domestication Traits in Mandarin Fish. Int. J. Mol. Sci. 2013, 14, 21504-21512. https://doi.org/10.3390/ijms141121504
Yi T, Sun J, Liang X, He S, Li L, Wen Z, Shen D. Effects of Polymorphisms in Pepsinogen (PEP), Amylase (AMY) and Trypsin (TRY) Genes on Food Habit Domestication Traits in Mandarin Fish. International Journal of Molecular Sciences. 2013; 14(11):21504-21512. https://doi.org/10.3390/ijms141121504
Chicago/Turabian StyleYi, Tilin, Jian Sun, Xufang Liang, Shan He, Ling Li, Zhengyong Wen, and Dan Shen. 2013. "Effects of Polymorphisms in Pepsinogen (PEP), Amylase (AMY) and Trypsin (TRY) Genes on Food Habit Domestication Traits in Mandarin Fish" International Journal of Molecular Sciences 14, no. 11: 21504-21512. https://doi.org/10.3390/ijms141121504
APA StyleYi, T., Sun, J., Liang, X., He, S., Li, L., Wen, Z., & Shen, D. (2013). Effects of Polymorphisms in Pepsinogen (PEP), Amylase (AMY) and Trypsin (TRY) Genes on Food Habit Domestication Traits in Mandarin Fish. International Journal of Molecular Sciences, 14(11), 21504-21512. https://doi.org/10.3390/ijms141121504