Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Development of Microsatellite Markers
3.2. Primer Validation
4. Conclusions
Locus | Repeat | Primer sequence (5′–3′) | TA (°C) | Expected Size (bp) | NA | Allele Range (bp) | HO | HE | GenBank Accession No. |
---|---|---|---|---|---|---|---|---|---|
SL-SHIRO 5 | (CA)4CG(CA)5(CG)3(CGCA)3 | F: ACGACCTCGTCAAAAGCACT R: NED-GCTCGTCACGACTCTTGAAA | 62 | 197 | 5 | 181–197 | 0.333 | 0.368 | AB821297 |
SL-SHIRO 8 | (GT)28 | F: CCAACTCCGAATAAAAGCAG R: HEX-CTGTCACATCCGTGAAATGG | 62 | 178 | 16 | 159–193 | 0.875 | 0.939 | AB821298 |
SL-SHIRO 10 | (CA)4TA(CA)11 | F: FAM-ACAAAACGAAGGAGGGAGGT R: CATCCCACCTATTTCACAGTATCA | 62 | 214 | 5 | 203–233 | 0.667 | 0.573 | AB821299 |
SL-SHIRO 15 | (GT)26AAGAAAGAGTA(GA)7 | F: TTCCGCAAATTTTATGTAGCA R: HEX-TTCAGTCGAAATGAGGTAGCAG | 54 | 215 | 19 | 189–235 | 0.958 | 0.947 | AB821300 |
SL-SHIRO 16 | (GTGTGA)2(GT)30 | F: AAACCCGCCTGACTTCAGTT R: HEX-GGGACTCTTCCGTGACACAT | 62 | 205 | 15 | 170–210 | 0.292 | 0.937 | AB821301 |
SL-SHIRO 20 | (TA)11 | F: NED-CGAGTCGAGCCACACTGAAG R: TTCGGTCACCCTCGAATAAG | 62 | 106 | 5 | 102–112 | 0.667 | 0.624 | AB821302 |
SL-SHIRO 22 | (TA)13 | F: TCACGAGTCTTGCCTCACTG R: HEX-CCTATGTGACCGGTTTTGTTG | 62 | 175 | 5 | 167–175 | 0.625 | 0.602 | AB821303 |
SL-SHIRO 23 | (CTTT)13 | F: HEX-TCCTCTCTGCCACTTCCTTC R: GACAAAATGAGAGGGATACGTG | 62 | 186 | 8 | 167–195 | 0.917 | 0.872 | AB821304 |
SL-SHIRO 27 | (TATG)(TATC)30 | F: NED-GACAAGAGGTTTATTGGCATTGA R: ACCAACTCAAATAGTGTGCGTA | 54 | 112 | 13 | 101–161 | 0.750 | 0.861 | AB821305 |
SL-SHIRO 29 | (GAAA)13 | F: FAM-CTGGTGGAGGTGGGTGTTAC R: GGGTGCCTATCTGATTGCAG | 54 | 216 | 10 | 201–233 | 0.875 | 0.863 | AB821306 |
SL-SHIRO 30 | (CA)12 | F: TGTGTAGAAATTGTCCAAACGTC R: FAM-CAAGACACCAAGGTTTTATGGA | 54 | 115 | 8 | 109–129 | 0.708 | 0.800 | AB821307 |
Acknowledgments
Conflicts of Interest
References
- Roper, C.F.E.; Sweeney, M.J.; Nauen, C.E. Cephalopods of the World. An Annotated and Illustrated Catalogue of Species of Interest to Fisheries, FAO Fisheries Synopsis, Rome, Italy, 1984; 3, pp. 109–111.
- Izuka, T.; Segawa, S.; Okutani, T. Biochemical study of the population heterogeneity and distribution of the oval squid Sepioteuthis lessoniana complex in southwestern Japan. Am. Malac. B 1996, 12, 129–135. [Google Scholar]
- Aoki, M.; Imai, H.; Naruse, T.; Ikeda, Y. Low genetic diversity of oval squid, Sepioteuthis cf. lessoniana (Cephalopoda: Loliginidea), in Japanese waters inferred from a mitochondrial DNA non-coding region. Pac. Sci 2008, 62, 403–411. [Google Scholar]
- Yokogawa, K.; Ueta, Y. Genetic analysis of oval squid (Sepioteuthis lessoniana) around Japan. Venus 2000, 59, 45–55. [Google Scholar]
- Imai, H.; Aoki, M. Genetic Diversity and Genetic Heterogeneity of Bigfin Reef Squid “Sepioteuthis lessoniana” Species Complex in Northwestern Pacific Ocean. In Analysis of Genetic Variation in Animals; Caliskan, M., Ed.; InTech: Rijeka, Croatia, 2012; pp. 151–166. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, NY, USA, 1989. [Google Scholar]
- Goudet, J. FSTAT (version 1.2): A computer program to calculate F-statistics. J. Hered 1995, 86, 485–486. [Google Scholar]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2005, 1, 47–50. [Google Scholar]
- Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Tomano, S.; Ahmad-Syazni, K.; Ueta, Y.; Ohara, K.; Umino, T. Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type). Int. J. Mol. Sci. 2013, 14, 19971-19975. https://doi.org/10.3390/ijms141019971
Tomano S, Ahmad-Syazni K, Ueta Y, Ohara K, Umino T. Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type). International Journal of Molecular Sciences. 2013; 14(10):19971-19975. https://doi.org/10.3390/ijms141019971
Chicago/Turabian StyleTomano, Satoshi, Kamarudin Ahmad-Syazni, Yukio Ueta, Kenichi Ohara, and Tetsuya Umino. 2013. "Eleven Novel Polymorphic Microsatellite Loci for Oval Squid Sepioteuthis Lessoniana (Shiro-Ika Type)" International Journal of Molecular Sciences 14, no. 10: 19971-19975. https://doi.org/10.3390/ijms141019971