Development of 20 Microsatellite Markers for Solenocera crassicornis and Their Cross-Species Application in Solenocera melantho
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. DNA Extraction
3.2. Microsatellite-Enriched Library Construction
3.3. Isolation of Microsatellite-Containing DNA Fragments
3.4. PCR Amplification and Genotyping
3.5. Genetic Data Analysis
4. Conclusions
Acknowledgments
References
- Liu, R.Y. Regional character of economic shrimp species in Yellow Sea and East China Sea (in Chinese). Oceanol. Limnol. Sin 1959, 2, 35–42. [Google Scholar]
- Song, H.T.; Yao, G.Z.; Yu, C.G.; Xue, L.J. Species composition and quantitative distribution of shrimps in East China Sea (in Chinese). Acta Oceanol. Sin 2003, 25(Suppl 1), S171–179. [Google Scholar]
- Song, H.T.; Yao, G.Z.; Yu, C.G.; Xue, L.J. Study on the biomass distribution and biological characteristics of Solenocera crassiocornis in East China Sea (in Chinese). J. Zhejiang Ocean Univ. Sci. A 2003, 22, 305–320. [Google Scholar]
- Ye, S.Z.; Zhang, Z.L.; Ye, Q.T. Quantitative distribution and biological characteristics of Solenocera crassicornis in northeast Fujian outer-sea (in Chinese). South China Fish. Sci 2012, 1, 24–29. [Google Scholar]
- Cheng, J.H.; Dai, G.J.; Ling, J.Z.; Liu, M. Discussion on management countermeasure of economic shrimps in East China Sea (in Chinese). China Fish 2003, 1, 74–75. [Google Scholar]
- Sukumaran, K.K. Studies on the fishery and biology of Solenocera crassicornis (H. Milne Edwards) from Bombay waters. J. Mar. Biol. Assoc. India 1978, 20, 32–39. [Google Scholar]
- Yuan, Y.J.; Liu, S.F.; Bai, C.C.; Liu, H.B.; Zhuang, Z.M. Isolation and characterization of new 24 microsatellite DNA markers for golden cuttlefish (Sepia esculenta). Int. J. Mol. Sci 2012, 13, 1154–1160. [Google Scholar]
- Liao, M.J.; Wang, Y.G.; Rong, X.J.; Zhang, Z.; Li, B. Development of new microsatellite DNA markers from Apostichopus japonicus and their cross-species application in Parastichopus parvimensis and Pathallus mollis. Int. J. Mol. Sci 2011, 12, 5862–5870. [Google Scholar]
- Adams, B.K.; Hutchings, J.A. Microgeographic population structure of brook charr: A comparison of microsatellite and mark-recapture data. J. Fish Biol 2003, 62, 517–533. [Google Scholar]
- Wennevik, V.; Skaala, O.; Titov, S.; Studyonov, I.; Naevdal, G. Microsatellite variation in populations of Atlantic salmon from north Europe. Environ. Biol. Fishes 2004, 69, 143–152. [Google Scholar]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Li, Q.; Wan, J.M. SSRHunter: Development of a local searching software for SSR sites (in Chinese). Hereditas 2005, 27, 808–810. [Google Scholar]
- Rousset, F. Genepop’007: A complete re-implementation of the Genepop software for Windows and Linux. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
| Loci | Genbank accession No. | Repeat motif | Primer sequence (5′–3′) | Size range (bp) | Tm (°C) | NA | HO | HE | PHW | Cross-amplified in Solenocera melantho |
|---|---|---|---|---|---|---|---|---|---|---|
| ZG-1 | JQ954744 | (AC)5…(CA)8…(CA)6 | F: TTGCCTTCCAAGCACATTCA R: ATCCCTGTTAGCTCATTCCACA | 340–430 | 55 | 16 | 0.9318 | 0.9135 | 0.0927 | + |
| ZG-6 | JQ954745 | (AC)6…(AC)7…(AC)7…(AC)8 | F: AGGTTTATTTGGTTTATG R: ATATCTCGCTATCTCATT | 240–480 | 55 | 14 | 0.8974 | 0.8944 | 0.1973 | + |
| ZG-7 | JQ954746 | (TC)7…(CA)14…(AC)36…(AG)11 | F: TCTGTATTTCGTCTTGGA R: GATAGCGGGTTGAGGT | 300–410 | 55 | 19 | 0.9545 | 0.9122 | 0.8769 | + |
| ZG-9 | JQ954747 | (TG)5…(GT)5 | F: TACACGAATGAGGCATAG R: GTGGTAACAGACAGACAATC | 300–370 | 55 | 15 | 0.8181 | 0.8657 | 0.1215 | + |
| ZG-10 | JQ954748 | (CA)6…(AT)6 | F: TCGGAAGTAACATTCAGGAC R: GGAAGGAAATTCTACGCTAT | 330–360 | 55 | 7 | 0.8409 | 0.7996 | 0.8719 | + |
| ZG-18 | JQ954749 | (AT)5…(AC)5…(CA)5…(AC)5…(CA)29 | F: CTTTATCTGGTCGGGTTT R: GACGAAGTGAATAGACTGTG | 310–500 | 55 | 19 | 0.4000 | 0.9395 | 0.0000* | − |
| ZG-20 | JQ954750 | (TG)7…(GT)5 | F: AAAATGGAATGCGATAGAT R: TTATAGCGAACCAACACCT | 230–260 | 45 | 11 | 0.7954 | 0.8853 | 0.0149 | + |
| ZG-27 | JQ954751 | (AC)7 | F: GCTTCTCAAGGGAGGCACA R: GCGGGAAGGATGGAGGTA | 270–310 | 55 | 6 | 0.7500 | 0.7526 | 0.3399 | − |
| ZG-29 | JQ954752 | (AC)17 | F: GATATGGCGGTTGAGTGA R: TACGTGGTTTATGTTGCTTA | 310–350 | 55 | 10 | 0.8181 | 0.8791 | 0.3072 | + |
| ZG-36 | JQ954753 | (CA)38 | F: AGAGTGACGGTCAAACTGA R: TAAACGCATTAGGAGACG | 300–400 | 55 | 17 | 0.8809 | 0.9185 | 0.2256 | − |
| ZG-38 | JQ954754 | (GT)12 | F: GTCTGCACGGGATTTGTTCT R: CGCTCGTCCAATTAGGGTAT | 260–290 | 55 | 7 | 0.4545 | 0.7988 | 0.0000 * | − |
| ZG-40 | JQ954755 | (AGAC)18 | F: ATTGCGTTGGAAATGTATC R: GTCCCTTTTATTGTCTATCTGT | 300–450 | 55 | 15 | 0.8409 | 0.8874 | 0.1864 | − |
| ZG-47 | JQ954756 | (AC)5…(AC)6…(CA)8…(AC)5 | F: TTTTGTATTCTTGTTCTGGAT R: TGATTCGTTGTTTCATTTG | 180–210 | 55 | 10 | 0.5814 | 0.8768 | 0.0000* | + |
| ZG-61 | JQ954737 | (AC)5…(CT)5 | F: GACGAGGAACAAATCAGA R: TTGAAGAATAAGAGGGACT | 320–410 | 45 | 12 | 0.9772 | 0.8892 | 0.9555 | + |
| ZG-66 | JQ954738 | (AC)14 | F: TTCCATCCTATTTCTACTG R: ATAAGACGTTTACCTACAT | 280–330 | 55 | 15 | 0.9772 | 0.9148 | 0.9964 | + |
| ZG-67 | JQ954739 | (AT)5…(TG)5 | F: TGGAAGTAACAACTAAACTTTG R: CAACCCAGAGGTGTCAGA | 330–360 | 55 | 7 | 0.5909 | 0.6091 | 0.2619 | + |
| ZG-71 | JQ954740 | (CA)61 | F: AAAGGCTGAAATCAAGAAG R: GAGGAAGAATGAGCGTTAG | 220–300 | 45 | 13 | 0.9772 | 0.8902 | 0.9736 | + |
| ZG-75 | JQ954741 | (AC)33 | F: CCGAACTGGCACCACTAT R: AACGGATTCCTATTACAGACAA | 210–260 | 55 | 12 | 0.8863 | 0.8605 | 0.0513 | − |
| ZG-85 | JQ954742 | (TG)51…(GT)6 | F: AATGACAACTCTACAGGCTA R: TCAATTCCAAGTGAATGC | 310–400 | 55 | 16 | 0.909 | 0.9192 | 0.4320 | + |
| ZG-90 | JQ954743 | (GT)13 | F: ACACTTTCTACATTCCAC R: GTCACTCATCCATTCAC | 180–200 | 45 | 6 | 0.4772 | 0.7816 | 0.0003* | + |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Liu, S.; Liu, H.; Lin, L.; Yuan, Y.; Dai, F.; Zhuang, Z. Development of 20 Microsatellite Markers for Solenocera crassicornis and Their Cross-Species Application in Solenocera melantho. Int. J. Mol. Sci. 2012, 13, 9218-9224. https://doi.org/10.3390/ijms13079218
Liu S, Liu H, Lin L, Yuan Y, Dai F, Zhuang Z. Development of 20 Microsatellite Markers for Solenocera crassicornis and Their Cross-Species Application in Solenocera melantho. International Journal of Molecular Sciences. 2012; 13(7):9218-9224. https://doi.org/10.3390/ijms13079218
Chicago/Turabian StyleLiu, Shufang, Hongbo Liu, Lin Lin, Yanjiao Yuan, Fangqun Dai, and Zhimeng Zhuang. 2012. "Development of 20 Microsatellite Markers for Solenocera crassicornis and Their Cross-Species Application in Solenocera melantho" International Journal of Molecular Sciences 13, no. 7: 9218-9224. https://doi.org/10.3390/ijms13079218
APA StyleLiu, S., Liu, H., Lin, L., Yuan, Y., Dai, F., & Zhuang, Z. (2012). Development of 20 Microsatellite Markers for Solenocera crassicornis and Their Cross-Species Application in Solenocera melantho. International Journal of Molecular Sciences, 13(7), 9218-9224. https://doi.org/10.3390/ijms13079218
