Development of New Polymorphic Microsatellite Loci for the Barley Stem Gall Midge, Mayetiola hordei (Diptera: Cecidomyiidae) from an Enriched Library
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgments
References
- Gagne, R.J.; Hatchett, J.H.; Lhaloui, S.; ElBouhssini, M. Hessian fly and barley stem gall midge, two different species of Mayetiola. (Diptera: Cecidomyiidae) in Morocco. Ann. Entomol. Soc. Am 1991, 84, 436–443. [Google Scholar]
- Makni, H.; Marrakchi, M.; Pasteur, N. Biochemical characterization of sibling species of Tunisian Mayetiola. (Diptera: Cecidomyiidae). Biochem. Syst. Ecol 2001, 28, 101–109. [Google Scholar]
- Hatchett, J.H.; Gallun, R.L. Genetics of the ability of Hessian fly, Mayetiola. destructor, to survive on wheat having different genes for resistance. Ann. Entomol. Soc. Am 1970, 63, 1400–1407. [Google Scholar]
- Gallun, R.L. Genetic basis of Hessian fly epidemics. Ann. N. Y. Acad. Sci 1977, 287, 223–229. [Google Scholar]
- Ratcliffe, R.H.; Safranski, G.G.; Patterson, F.L.; Ohm, H.W.; Taylor, P.L. Biotype status of Hessian fly (Diptera: Cecidomyiidae) populations from the eastern United States and their response to 14 Hessian fly resistance genes. J. Econ. Entomol 1994, 87, 1113–1121. [Google Scholar]
- Lhaloui, S.; Hatchett, J.H.; Wilde, G.E. Evaluation of New Zealand barleys for resistance to Mayetiola destructor and M. hordei (Diptera: Cecidomyiidae) and the effect of temperature on resistance expression to Hessian fly. J. Eco. Entomol 1996, 89, 562–567. [Google Scholar]
- Mezghani, M.; Vanlerberghe-Masutti, F.; Makni, M.; Chavigny, P.; Marrakchi, M.; Makni, H. Development of microsatellite markers for the barley stem gall midge, Mayetiola. hordei (Diptera: Cecidomyiidae). Mol. Ecol. Notes 2006, 6, 377–378. [Google Scholar]
- Raymond, M.; Rousset, F. Genepop: Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MicroChecker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaves tissue. Phytochem. Bull 1987, 19, 11–15. [Google Scholar]
- Glenn, T.C.; Schable, N.A. Isolating microsatellite DNA loci. Methods Enzymol 2005, 395, 202–222. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
Locus Name | Repeat motif | Primer sequence (5′→3′) | Ta (°C) | No. of alleles | Size range | HO | HE | p-Values | GenBank accession no. | Null allele frequency estimate |
---|---|---|---|---|---|---|---|---|---|---|
MhA6 | (CAAAAA)4 | MHA6F: AATTATGTAAACCGAACCGAAC MHA6R: CGAATCCAAAGAGGAAGTGG | 54 | 6 | 177–185 | 0.5789 | 0.6122 | 0.0976 | JN585338 | 14 |
MhA10 | (CAA)19 | MHA10F: CGTCGCAATCATTTCTTTCA MHA10R: TGCATTTGAGCCACATTTTC | 56 | 5 | 176–185 | 0.6667 | 0.5314 | 0.0017 | JN585339 | −1346 |
MhB2 | (CA)13 | MHB2F: TGGGCATAATTTTTCCGAAT MHB2R: TTCCAAAAACAGTTCGTTCAA | 54 | 6 | 149–159 | 0.1228 | 0.6850 | 0.0000 | JN585341 | 3961 |
MhC1-1 | (TG)26 | MHC1-1F: TGTGGGCTCAAATGGAAAAT MHC1-1R: GAAGGTTTCCAGTCGCACAC | 56 | 5 | 134–140 | 0.8772 | 0.6711 | 0.0000 | JN585343 | −1741 |
MhC2-1 | (GTT)8 | MHC2-1F: TGTTGAATCCTATAACAATTTCATGTT MHC2-1R: TCATAATCCGGGGCAATAAA | 56 | 2 | 121–124 | 0.2456 | 0.2155 | 0.5830 | JN585344 | −1314 |
MhC3 | (TG)16 | MHC3F: CGTCGCAATCATTTCTTTCA MHC3R: TGCATCTGAGCCACATCTTC | 56 | 2 | 177–179 | 0.0702 | 0.0997 | 0.1292 | JN585345 | 784 |
MhF11 | (CT)10 | MHF11F: TCCATATCCACATACGGATTCA MHF11R: TTTGCTGTTGTTGGAAGCAG | 56 | 4 | 141–145 | 0.2632 | 0.5339 | 0.0000 | JN585350 | 2273 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Mezghani-Khemakhem, M.; Bouktila, D.; Casse, N.; Maaroufi, H.; Makni, M.; Makni, H. Development of New Polymorphic Microsatellite Loci for the Barley Stem Gall Midge, Mayetiola hordei (Diptera: Cecidomyiidae) from an Enriched Library. Int. J. Mol. Sci. 2012, 13, 14446-14450. https://doi.org/10.3390/ijms131114446
Mezghani-Khemakhem M, Bouktila D, Casse N, Maaroufi H, Makni M, Makni H. Development of New Polymorphic Microsatellite Loci for the Barley Stem Gall Midge, Mayetiola hordei (Diptera: Cecidomyiidae) from an Enriched Library. International Journal of Molecular Sciences. 2012; 13(11):14446-14450. https://doi.org/10.3390/ijms131114446
Chicago/Turabian StyleMezghani-Khemakhem, Maha, Dhia Bouktila, Nathalie Casse, Houcine Maaroufi, Mohamed Makni, and Hanem Makni. 2012. "Development of New Polymorphic Microsatellite Loci for the Barley Stem Gall Midge, Mayetiola hordei (Diptera: Cecidomyiidae) from an Enriched Library" International Journal of Molecular Sciences 13, no. 11: 14446-14450. https://doi.org/10.3390/ijms131114446