The Effect of Tomatine on Gene Expression and Cell Monolayer Integrity in Caco-2
Abstract
:1. Introduction
2. Results and Discussion
2.1. HPLC Analysis Confirmed the Presence of Tomatine after In Vitro Digestion
2.2. Caco-2 Monolayer Integrity is Influenced by Tomatine
2.3. Gene Expression Levels are Influenced by Tomatine
3. Materials and Methods
3.1. Cell Culture
3.2. Materials-Chemical
3.3. In Vitro Digestion
3.4. HPLC Analysis
3.5. Transepithelial Electrical Resistance (TEER) Assay
3.6. RNA Extraction and Retro-Transcription
3.7. qPCR Analysis
3.8. Statistical Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Friedman, M.; Levin, C.E. Glycoalkaloids and calystegine alkaloids in potatoes. In Advances in Potato Chemistry and Technology, 2nd ed.; Academic Press: Cambridge, MA, USA, 2016; pp. 167–194. [Google Scholar]
- Rudolf, K.; Rudolf, E. Antiproliferative effects of α-tomatine are associated with different cell death modalities in human colon cancer cells. J. Funct. Foods 2016, 27, 491–502. [Google Scholar] [CrossRef]
- Friedman, M. Analysis of biologically active compounds in potatoes (Solanum tuberosum), tomatoes (Lycopersicon esculentum), and jimson weed (Datura stramonium) seeds. J. Chromatogr. A 2004, 1054, 143–155. [Google Scholar] [CrossRef] [PubMed]
- Koh, E.; Kaffka, S.; Mitchell, A.E. A long-term comparison of the influence of organic and conventional crop management practices on the content of the glycoalkaloid α-tomatine in tomatoes. J. Sci. Food Agric. 2013, 93, 1537–1542. [Google Scholar] [CrossRef] [PubMed]
- Rick, C.M.; Uhlig, J.W.; Jones, A.D. High a-tomatine content in ripe fruit of Andean Lycopersicon esculentum var. cerasiforme: Developmental and genetic aspects. Proc. Nat. Acad. Sci. USA 1994, 91, 12877–12881. [Google Scholar] [PubMed]
- Itkin, M.; Rogachev, I.; Alkan, N.; Rosenberg, T.; Malitsky, S.; Masini, L.; Meir, S.; Iijima, Y.; Aoki, K.; de Vos, R.; et al. Glycoalkaloid metabolism1 is required for steroidal alkaloid glycosylation and prevention of phytotoxicity in tomato. Plant Cell 2011, 23, 4507–4525. [Google Scholar] [CrossRef] [PubMed]
- Omayio, D.G.; Abong, G.O.; Okoth, M.W. A review of occurrence of glycoalkaloids in potato and potato products. Curr. Res. Nutr. Food Sci. J. 2016, 4, 195–202. [Google Scholar] [CrossRef]
- Sucha, L.; Tomsik, P. The steroidal glycoalkaloids from Solanaceae: Toxic effect, antitumour activity and mechanism of action. Planta Med. 2016, 82, 379–387. [Google Scholar] [CrossRef] [PubMed]
- Silva-Beltrán, N.P.; Ruiz-Cruz, S.; Cira-Chávez, L.A.; Estrada-Alvarado, M.I.; Ornelas-Paz, J.D.J.; Lopez-Mata, M.A.; Del Toro Sanchez, C.L.; Ayala Zavala, J.F.; Marquez Rios, E. Total phenolic, flavonoid, tomatine, and tomatidine contents and antioxidant and antimicrobial activities of extracts of tomato plant. Int. J. Anal. Chem. 2015, 2015, 284071. [Google Scholar] [CrossRef] [PubMed]
- Langkilde, S.; Mandimika, T.; Schrøder, M.; Meyer, O.; Slob, W.; Peijnenburg, A.; Poulsen, M. A 28-day repeat dose toxicity study of steroidal glycoalkaloids, α-solanine and α-chaconine in the Syrian Golden hamster. Food Chem. Toxicol. 2009, 47, 1099–1108. [Google Scholar] [CrossRef] [PubMed]
- Yamashoji, S.; Onoda, E. Detoxification and function of immature tomato. Food Chem. 2016, 209, 171–176. [Google Scholar] [CrossRef] [PubMed]
- Friedman, M. Chemistry and anticarcinogenic mechanisms of glycoalkaloids produced by eggplants, potatoes, and tomatoes. J. Agric. Food Chem. 2015, 63, 3323–3337. [Google Scholar] [CrossRef] [PubMed]
- Woods, N.; Niwasabutra, K.; Acevedo, R.; Igoli, J.; Altwaijry, N.A.; Tusiimire, J.; Gray, A.I.; Watson, D.G.; Ferro, V.A. Natural Vaccine Adjuvants and Immunopotentiators Derived from Plants, Fungi, Marine Organisms, and Insects. In Immunopotentiators in Modern Vaccines, 2nd ed.; Academic Press: Cambridge, MA, USA, 2017; pp. 211–229. [Google Scholar]
- Heal, K.G.; Tylor-Robinson, A.W. Tomatine adjuvantation of protective immunity to a major pre-erythrocytic vaccine candidate of malaria is mediated via CD8+ cell release of IFN-γ. BioMed Res. Int. 2010, 2010, 834326. [Google Scholar] [CrossRef]
- Taylor-Robinson, A.W.; Morrow, J.W. Tomatine as an adjuvant in malaria vaccine development. Drugs Future 2002, 27, 391–402. [Google Scholar] [CrossRef]
- Yelken, B.Ö.; Balcı, T.; Süslüer, S.Y.; Kayabaşı, Ç.; Avcı, Ç.B.; Kırmızıbayrak, P.B.; Gündüz, C. The effect of tomatine on metastasis related matrix metalloproteinase (MMP) activities in breast cancer cell model. Gene 2017, 627, 408–411. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.H.; Lee, S.H.; Kim, H.J.; Lee, I.S.; Kozukue, N.; Levin, C.E.; Friedman, M. Changes in free amino acid, phenolic, chlorophyll, carotenoid, and glycoalkaloid contents in tomatoes during 11 stages of growth and inhibition of cervical and lung human cancer cells by green tomato extracts. J. Agric. Food Chem. 2010, 58, 7547–7556. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.T.; Wong, P.F.; Cheah, S.C.; Mustafa, M.R. Alpha-Tomatine induces apoptosis and inhibits nuclear factor-kapa B activation on human prostatic adenocarcinoma PC-3 cells. PLoS ONE 2011, 6, e18915. [Google Scholar] [CrossRef]
- Lee, L.C.; Wei, L.; Huang, W.C.; Hsu, Y.J.; Chen, Y.M.; Huang, C.C. Hypolipidemic effect of tomato juice in hamsters in high cholesterol diet-induced hyperlipidemia. Nutrients 2015, 7, 10525–10537. [Google Scholar] [CrossRef] [PubMed]
- Friedman, M.; Fitch, T.E.; Yokoyama, W.H. Feeding tomatoes to hamsters reduces their plasma low-density lipoprotein cholesterol and triglycerides. J. Food Sci. 2000, 65, 897–900. [Google Scholar] [CrossRef]
- Chiu, F.L.; Lin, J.K. Tomatidine inhibits iNOS and COX-2 through suppression of NF-κB and JNK pathways in LPS-stimulated mouse macrophages. FEBS Lett. 2008, 582, 2407–2412. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.W.; Onisko, B.; Johnson, E.A.; Reader, J.R.; Griffey, S.M.; Larson, A.E.; Tepp, W.H.; Stanker, L.H.; Brandon, D.L.; Carter, J.M. Effects of purification on the bioavailability of botulinum neurotoxin type A. Toxicology 2008, 249, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Friedman, M. Tomato glycoalkaloids: Role in the plant and in the diet. J. Agric. Food Chem. 2002, 50, 5751–5780. [Google Scholar] [CrossRef] [PubMed]
- Jazaeri, S.; Mohammadi, A.; Kermani, A.M.P.; Paliyath, G.; Kakuda, Y. Characterization of lycopene hydrocolloidal structure induced by tomato processing. Food Chem. 2018, 245, 958–965. [Google Scholar] [CrossRef] [PubMed]
- Arena, M.P.; Caggianiello, G.; Fiocco, D.; Russo, P.; Torelli, M.; Spano, G.; Capozzi, V. Barley β-glucans-containing food enhances probiotic performances of beneficial bacteria. Int. J. Mol. Sci. 2014, 15, 3025–3039. [Google Scholar] [CrossRef] [PubMed]
- Chow, H.H.; Hakim, I.A.; Vining, D.R.; Crowell, J.A.; Ranger-Moore, J.; Chew, W.M.; Celaya, C.A.; Rodney, S.R.; Hara, J.; Albert, D.S. Effects of dosing condition on the oral bioavailability of green tea catechins after single-dose administration of polyphenone in healthy individuals. Clin. Cancer Res. 2005, 11, 4627–4633. [Google Scholar] [CrossRef] [PubMed]
- Mandimika, T.; Baykus, H.; Vissers, Y.; Jeurink, P.; Poortman, J.; Garza, C.; Kuiper, H.; Peijnenburg, A. Differential gene expression in intestinal epithelial cells induced by single and mixtures of potato glycoalkaloids. J. Agric. Food Chem. 2007, 55, 10055–10066. [Google Scholar] [CrossRef] [PubMed]
- Ulluwishewa, D.; Anderson, R.C.; McNabb, W.C.; Moughan, P.J.; Wells, J.M.; Roy, N.C. Regulation of tight junction permeability by intestinal bacteria and dietary components. J. Nutr. 2011, 141, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Akbari, P.; Braber, S.; Alizadeh, A.; Verheijden, K.A.; Schoterman, M.H.; Kraneveld, A.D.; Johan Garssen, J.; Fink-Gremmels, J. Galacto-oligosaccharides protect the intestinal barrier by maintaining the tight junction network and modulating the inflammatory responses after a challenge with the mycotoxin deoxynivalenol in human Caco-2 cell monolayers and B6C3F1 mice. J. Nutr. 2015, 145, 1604–1613. [Google Scholar] [CrossRef] [PubMed]
- Hering, N.A.; Schulzke, J.D. Therapeutic options to modulate barrier defects in inflammatory bowel disease. Dig. Dis. 2009, 27, 450–454. [Google Scholar] [CrossRef] [PubMed]
- Balda, M.S.; Whitney, J.A.; Flores, C.; González, S.; Cereijido, M.; Matter, K. Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. J. Cell Biol. 1996, 134, 1031–1049. [Google Scholar] [CrossRef] [PubMed]
- Coico, R.; Sunshine, G.; Benjamini, E. Immunology: A Short Course; Wiley-Liss: New York, NY, USA, 2003; ISBN 0-471-22689-0. [Google Scholar]
- Jung, H.C.; Eckmann, L.; Yang, S.K.; Panja, A.; Fierer, J.; Morzycka-Wroblewska, E. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Investig. 1995, 95, 55–65. [Google Scholar] [CrossRef] [PubMed]
- Wichers, H. Immunomodulation by food promising concept for mitigating allergic disease? Anal. Bioanal. Chem. 2009, 395, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Eastaff-Leung, N.; Mabarrack, N.; Barbour, A.; Cummins, A.; Barry, S. Foxp3+ regulatory T cells, Th17 effector cells, and cytokine environment in inflammatory bowel disease. J. Clin. Immunol. 2010, 30, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Takai, T. TSLP Expression: Cellular sources, triggers, and regulatory mechanisms. Allergol. Int. 2012, 61, 3–17. [Google Scholar] [CrossRef] [PubMed]
- Rimoldi, M.; Chieppa, M.; Salucci, V.; Avogadri, F.; Sonzogni, A.; Sampietro, G.M.; Nespoli, A.; Viale, G.; Allavena, P.; Rescigno, M. Intestinal immune homeostasis is regulated by the crosstalk between epithelial cells and dendritic cells. Nat. Immunol. 2005, 6, 507–514. [Google Scholar] [CrossRef] [PubMed]
- Kato, A.; Favoreto, S., Jr.; Avila, P.C.; Schleimer, R.P. TLR3- and Th2 cytokine-dependent production of thymic stromal lymphopoietin in human airway epithelial cells. J. Immunol. 2007, 179, 1080–1087. [Google Scholar] [CrossRef] [PubMed]
- Sims, J.E.; Smith, D.E. The IL-1 family: Regulations of immunity. Immunology 2010, 10, 89–102. [Google Scholar] [PubMed]
- Danis, V.A.; Franic, G.M.; Rathjen, D.A.; Brooks, P.M. Effects of granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-2, interferon-gamma (IFN-y), tumour necrosis factor-alpha (TNF-alpha) and IL-on the production of immunoreactive IL-1 and TNF-alpha by human monocytes. Clin. Exp. Immunol. 1991, 85, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Ferrante, A. Activation of neutrophils by interleukins-l and -2 and tumor necrosis factors. Immunol. Ser. 1992, 57, 417–436. [Google Scholar] [PubMed]
- Roebuck, K.A. Regulation of interleukin-8 gene expression. J. Interferon Cytokine Res. 1999, 19, 429–438. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.; Zhou, B.; Bao, L.; Yang, Y.; Guo, K. Alpha-tomatine exhibits anti-inflammatory activity in lipopolysaccharide-activated macrophages. Inflammation 2015, 38, 1769–1776. [Google Scholar] [CrossRef] [PubMed]
- Heal, K.G.; Sheikh, N.A.; Hollingdale, M.R.; Morrow, W.J.W.; Taylor-Robinson, A.W. Potentiation by a novel alkaloid glycoside adjuvant of a protective cytotoxic T cell immune response specific for a preerythrocytic malaria vaccine candidate antigen. Vaccine 2001, 19, 4153–4161. [Google Scholar] [CrossRef]
- Pinto, M. Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biol. Cell 1983, 47, 323–330. [Google Scholar]
- Baker, SS.; Baker, R.D. Antioxidant enzymes in the differentiated Caco-2 cell line. In Vitro Cell Dev. Biol. 1992, 28, 643–647. [Google Scholar] [CrossRef]
- Hidalgo, I.J.; Raub, T.J.; Borchardt, R.T. Characterization of the human colon carcinoma cell line (Caco-2) as a model system for intestinal epithelial permeability. Gastroenterology 1989, 96, 736–749. [Google Scholar] [CrossRef]
- Wilson, G.; Hassan, I.F.; Dix, C.J.; Williamson, I.; Mackay, M. Transport and permeability properties of human Caco-2 cells. An in vitro model for the intestinal epithelial cell barrier. J. Controll. Release 1990, 11, 25–40. [Google Scholar]
- Da Violante, G.; Zerrouk, N.; Richard, I.; Provot, G.; Chaumeil, J.C.; Arnaud, P. Evaluation of the cytotoxicity effect of dimethyl sulfoxide (DMSO) on Caco2/TC7 colon tumor cell cultures. Biol. Pharm. Bull. 2002, 25, 1600–1603. [Google Scholar] [CrossRef] [PubMed]
- Vreeburg, R.A.M.; va Wezel, E.E.; Ocaña-Calahorro, F.; Mes, J. Apple extract induces increased epithelial resistance and claudin 4 expression in caco-2 cells. J. Sci. Food Agric. 2012, 92, 439–444. [Google Scholar] [CrossRef] [PubMed]
- Kozukue, N.; Han, J.S.; Lee, K.R.; Friedman, M. Dehydrotomatine and α-tomatine content in tomato fruits and vegetative plant tissues. J. Agric. Food Chem. 2004, 52, 2079–2083. [Google Scholar] [CrossRef] [PubMed]
- Vreeburg, R.A.; Bastiaan-Net, S.; Mes, J.J. Normalization genes for quantitative RT-PCR in differentiated Caco-2 cells used for food exposure studies. Food Funct. 2011, 2, 124–129. [Google Scholar] [CrossRef] [PubMed]
- Spandidos, A.; Wang, X.; Wang, H.; Seed, B. PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucleic Acids Res. 2010, 38, D792–D799. [Google Scholar] [CrossRef] [PubMed]
- Yasumatsu, H.; Tanabe, S. The casein peptide Asn-Pro-Trp-Asp-Gln enforces the intestinal tight junction partly by increasing occludin expression in Caco-2 cells. Br. J. Nutr. 2010, 104, 951–956. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |
Sample Name | Description |
---|---|
P | DMSO-pure tomatine standard |
Pc | DMESO |
A | in vitro digested pure tomatine standard |
Ac | in vitro digested buffers |
T | in vitro digested tomato red fruit spiked with pure tomatine standard |
Tc | in vitro digested tomato red fruits |
Gene Name | Primer Name | Primer Sequences 5′-3′ | Amplicon Lenght (bp) | Gene ID |
---|---|---|---|---|
Caspase 3 | Caspase3 | Fw:GAGTGCTCGCAGCTCATACCT | 81 | NM_004346.3 |
Rev.:CCTCACGGCCTGGGATTT | ||||
Claudin 4 | F_CLDN4 | Fw:TTGTCACCTCGCAGACCATC | 92 | NM_001305.3 |
Rev:CAGCGAGTCGTACACCTTG | ||||
Interleukin 8 | F_IL8 | Fw:CTGATTTCTGCAGCTCTGTG | 98 | NM_000584.2 |
Rev:GGGTGGAAAGGTTTGGAGTATG | ||||
Interleukin 1 beta | F_IL1B | Fw:GTGGCAATGAGGATGACTTGTTC | 124 | GI:27894305 |
Rev:TAGTGGTGGTCGGAGATTCGTA | ||||
Glyceraldehyde-3-phosphate dehydrogenase | F_GAPDH | Fw:TGCACCACCAACTGCTTAGC | 87 | NM_02046 |
Rev:GGCATGGACTGTGGTCATGAG | ||||
Tumor Necrosis Factor alpha | F_TNFa | Fw:CTGCTGCACTTTGGAGTGAT | 93 | NM_000594 |
Rev:AGATGATCTGACTGCCTGGG | ||||
Thymic stromal lymphopoietin | F_TSLP | Fw:TCGGCCACATTGCCTTAC | 127 | AY037115.1, GI:14594701 |
Rev:ATAGCCTGGGCACCAGATAG | ||||
Sodium Glucose Transporter 1 | F_SGLT1 | Fw:GTGCAAGTCGAGGGACCATT | 114 | AL109659 |
Rev:GGCCGATGAACAAGCCACT | ||||
Proton-couple aminoacid Transporter | F_PAT1 | Fw:ACCTACGCACTCCAGTTCTAC | 91 | NM_078483 |
Rev:GGTCCACCACTAACTCACAGT | ||||
Low density lipoprotein receptor | F_LDLR | Fw:CGACAGATGCGAAAGAAACGA | 142 | NM_000527 |
Rev:CCCGGATTTGCAGGTGACA | ||||
Proliferating cell nuclear antigen | F_PCNA | Fw:CCTGCTGGGATATTAGCTCCA | 109 | NM_002592 |
Rev:CAGCGGTAGGTGTCGAAGC | ||||
Bcl-2 modifying factor | F_BMF | Fw:TTTATGGCAATGCTGGCTATCG | 115 | NM_033503 |
Rev:GCAATCTGTACCTCTGCTTGATG | ||||
Kluppel-like factor 6 | F_KLF6 | Fw:TTCTCCCACGGCCAAGTTTAC | 139 | NM_001160124 |
Rev:CACGCAACCCCACAGTTGA | ||||
Nuclear receptor subfamily 2, group F, | F_NR2F2 | Fw:TCATGGGTATCGAGAACATTTGC | 151 | NM_001145156 |
Rev:TTCAACACAAACAGCTCGCTC | ||||
Occludin 2 | F_OCLN2 | Fw:CCCATCTGACTATGTGGAAAGA | 77 | NM_002538 |
Rev:AAAACCGCTTGTCATTCACTTTG | ||||
Cyclin-dependent kinase inhibitor 1A | F_CDKN1A | Fw:TGTCCGTCAGAACCCATGC | 139 | NM_078467 |
Rev:AAAGTCGAAGTTCCATCGCTC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arena, M.P.; Govers, C.; Lotti, C.; Ricciardi, L.; Wichers, H.J.; Mes, J.J. The Effect of Tomatine on Gene Expression and Cell Monolayer Integrity in Caco-2. Molecules 2018, 23, 644. https://doi.org/10.3390/molecules23030644
Arena MP, Govers C, Lotti C, Ricciardi L, Wichers HJ, Mes JJ. The Effect of Tomatine on Gene Expression and Cell Monolayer Integrity in Caco-2. Molecules. 2018; 23(3):644. https://doi.org/10.3390/molecules23030644
Chicago/Turabian StyleArena, Mattia P., Coen Govers, Concetta Lotti, Luigi Ricciardi, Harry J. Wichers, and Jurriaan J. Mes. 2018. "The Effect of Tomatine on Gene Expression and Cell Monolayer Integrity in Caco-2" Molecules 23, no. 3: 644. https://doi.org/10.3390/molecules23030644