Next Article in Journal
Auraptene Acts as an Anti-Inflammatory Agent in the Mouse Brain
Previous Article in Journal
Functional Analysis of the Isopentenyl Diphosphate Isomerase of Salvia miltiorrhiza via Color Complementation and RNA Interference
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Molecules
Volume 20
Issue 11
10.3390/molecules201119687
molecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers

by
Zhiqiang Mei
1,†,
Boxu Zhou
1,†,
Chunli Wei
1,2,†,
Jingliang Cheng
1,
Saber Imani
1,3,
Hanchun Chen
4 and
Junjiang Fu
1,2,5,*
1
Research Center for Preclinical Medicine, Sichuan Medical University, Luzhou 646000, China
2
State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078, China
3
Chemical Injuries Research Center, Baqiyatallah University of Medical Sciences, Tehran 14359-44711, Iran
4
Department of Biochemistry, School of Life Sciences & the State Key Laboratory of Medical Genetics, Central South University, Changsha 410013, China
5
Judicial Authentication Center, Sichuan Medical University, Luzhou 646000, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Molecules 2015, 20(11), 20219-20229; https://doi.org/10.3390/molecules201119687
Submission received: 21 August 2015 / Revised: 18 October 2015 / Accepted: 3 November 2015 / Published: 10 November 2015
(This article belongs to the Section Molecular Diversity)
Browse Figures
Versions Notes

Abstract

:
The evergreen shrub, Gardenia jasminoides Ellis var. grandiflora Nakai is one of the most popular garden-plants, with significant ornamental importance. Here, we have cloned improved random amplified polymorphic DNA (RAPD) derived fragments into T-vector, and developed sequence-characterized amplified region (SCAR) markers. These markers have been deposited in GenBank database with the accession numbers KP641310, KP641311, KP641312 and KP641313 respectively. The BLAST search of database confirmed the novelty of these markers. The four SCAR markers, namely ZZH11, ZZH31, ZZH41 and ZZH51 can specifically recognize the genetic materials of G. jasminoides from other plant species. Moreover, SCAR marker ZZH31 can be used to distinguish G. jasminoides Ellis var. grandiflora Nakai from other G. jasminoides on the market. Together, this study has developed four stably molecular SCAR markers by improved RAPD-derived DNA markers for the genetic identification and authentication, and for ecological conservation of medicinal and ornamental plant G. jasminoides.

Graphical Abstract

1. Introduction

Gardenia jasminoides Ellis var. grandiflora Nakai (G. jasminoides Ellis var. grandiflora Nakai) is an evergreen shrub, commonly used as a garden-plant or house-plant of ornamental importance. G. jasminoides Ellis var. grandiflora Nakai is a variety of Gardenia jasminoides (G. jasminoides) with both ornamental and medicinal importance. Some studies have revealed that active ingredients isolated from different variety of G. jasminoides or extracts from this plant, are effective against inflammation, renal failure, metabolic and histological abnormalities in fatty liver disease, fibrosis, thrombosis, acute injuries of lungs, and some types of cancer, viral infections, depressions, and amyloid beta peptide cytotoxicity in Alzheimer’s disease [1,2,3,4,5,6,7,8,9,10,11].
G. jasminoides has commonly been found wild growing in several regions of the world, including China, for more than a thousand years. In spite of its ornamental and medicinal importance, very few studies have been conducted on proper genetic identification of G. jasminoides. Our previous study reported the genetic variations among G. jasminoides Ellis var. grandiflora Nakai collected from geographically different cities in China [12], suggesting this plant species is genetically vulnerable. Therefore, this plant species can likely be confused, if it is not genetically identified and characterized.
Molecular marker technologies are important bio-techniques, which are commonly used for the characterization, identification, and variety authentication of certain species of living organisms. Random amplified polymorphic DNA (RAPD) is a widely used technique, which was introduced three decades ago, and then developed for genetic characterization of organisms [13,14,15,16]. Although RAPD has gained popularity because of its advantages, it also has some disadvantages including low production and poor reproducibility. The sequence characterized amplified region (SCAR) markers are very stable, which are generally derived from the molecular cloning of RAPD fragments [17,18,19]. In our previous study [12], we have genetically characterized Gardenia jasminoides Ellis var. grandiflora Nakai by using an improved method RAPD analysis. On the basis of that study, here we have cloned the RAPD fragments, and developed some SCAR markers, which can specifically identify cultivars of G. jasminoides at the DNA level.

2. Results and Discussion

2.1. Results

2.1.1. Cloning of RAPD Amplification Fragments

The sources of the G. jasminoides Ellis var. grandiflora Nakai accessions used in the RAPD analysis are listed in Table 1. Two RAPD primers SBC-N5 (N5) and SBC-Q12 (Q12) were used for the RAPD amplification in six previous described samples of G. jasminoides Ellis var. grandiflora Nakai [12]. The localities of the samples of G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides are shown in Figure 1.
Table
Table 1. Sources of RAPD-SCAR samples for cultivars of G. jasminoides Ellis var. grandiflora Nakai and G. jasminoide.
Table 1. Sources of RAPD-SCAR samples for cultivars of G. jasminoides Ellis var. grandiflora Nakai and G. jasminoide.
SampleSpeciesSourceNo.
JXG. jasminoides Ellis var. grandiflora NakaiShangrao, Jiangxi1
FJG. jasminoides Ellis var. grandiflora NakaiFuzhou, Fujian2
GZG. jasminoides Ellis var. grandiflora NakaiAnshun, Guizhou3
SCG. jasminoides Ellis var. grandiflora NakaiLuzhou, Sichuan4
HNG. jasminoides Ellis var. grandiflora NakaiChangsha, Hunan5
ZJG. jasminoides Ellis var. grandiflora NakaiLishui, Zhejiang6
SC2G. jasminoides (G. jasminoides J. Ellis)Luzhou, Sichuan7
GDG. jasminoides Ellis var. grandiflora NakaiShenzhen, Guangdong8
FJ2G. jasminoides Ellis var. grandiflora NakaiQuanzhou, Fujian9
HN2G. jasminoides Ellis var. grandiflora NakaiChangsha, Hunan 10
AHG. jasminoides Ellis var. grandiflora NakaiHuainan, Aihui11
JX2G. jasminoides (G. jasminoides J. Ellis)Fuzhou, Jiangxi12
JSG. jasminoides (G. jasminoides J. Ellis)Nanjing, Jiangsu13
HN3G. jasminoides (G. jasminoides J. Ellis)Changsha, Hunan 14
SXG. jasminoides (G. jasminoides J. Ellis)Taiyuan, Shanxi15
Molecules 20 19687 g001 550
Figure 1. The localities of the samples of G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides from different regions in China. The spots in dark blue indicate the localities where the samples were collected, the lines in light blue indicate the Yangtze River and Yellow River.
Figure 1. The localities of the samples of G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides from different regions in China. The spots in dark blue indicate the localities where the samples were collected, the lines in light blue indicate the Yangtze River and Yellow River.
Molecules 20 19687 g001
The improved RAPD amplification results are shown in Figure 2, where red arrows indicate the bands labeled with by primer N5 (Figure 2A) and Q12 (Figure 2B). The arrow-indicated bands were cut from an agarose gel and further purified, and then ligated to T-vector by TA cloning. The blue/white screening method in LB agar plate was adopted firstly to screen the positive clones (data not shown). The white clones were then identified by polymerase chain reaction (PCR) amplification using SP6/T7 primer pair that is mentioned in the Experimental section. In Figure 3A the clone ZZH11 is shown in lane 7 as an expected inserted DNA-fragment with ~800 bp in size, whereas the clones ZZH31, ZZH41 and ZZH51 are shown in Figure 3B–D, as three inserted DNA-fragments with right length in sizes, respectively. Clones ZZH11, ZZH31, ZZH41 and ZZH51 were finally selected for Sanger sequencing.
Molecules 20 19687 g002 550
Figure 2. Amplification and recovery of improved random amplified polymorphic DNA (RAPD) fragments. Improve RAPD amplification from DNA samples of G. jasminoides Ellis var. grandiflora Nakai which listed in Table 1 (Nos. 1~6). (A) The primer SBC-N5 (N5); (B) The primers SBC-Q12 (Q12). The red arrows indicate bands before cut. Lane M indicates the DNA molecular weight marker DL2000 with the fragment size (bp) 2000, 1000, 750, 500, 250, 100.
Figure 2. Amplification and recovery of improved random amplified polymorphic DNA (RAPD) fragments. Improve RAPD amplification from DNA samples of G. jasminoides Ellis var. grandiflora Nakai which listed in Table 1 (Nos. 1~6). (A) The primer SBC-N5 (N5); (B) The primers SBC-Q12 (Q12). The red arrows indicate bands before cut. Lane M indicates the DNA molecular weight marker DL2000 with the fragment size (bp) 2000, 1000, 750, 500, 250, 100.
Molecules 20 19687 g002
Molecules 20 19687 g003 550
Figure 3. DNA cloning and identification of positive clones. (A) Clone identification of RAPD fragment 1. Lanes 6~12 indicate different clones; (B) Clone identification of RAPD fragment 3. Lanes 31~39 indicate different clones; (C) Clones identification of RAPD fragment 4. Lanes 41~44 indicate different clones; (D) Clone identification of RAPD fragment 5. Lanes 51~55 indicate different clones. The blue arrows indicate positive PCR products. Clones ZZH11, ZZH31, ZZH41 and ZZH51 in blue colors were sequencing. The blue arrows indicate expected PCR bands in size of different clones. Lane M indicates the DNA molecular weight marker DL2000 with the fragment size (bp).
Figure 3. DNA cloning and identification of positive clones. (A) Clone identification of RAPD fragment 1. Lanes 6~12 indicate different clones; (B) Clone identification of RAPD fragment 3. Lanes 31~39 indicate different clones; (C) Clones identification of RAPD fragment 4. Lanes 41~44 indicate different clones; (D) Clone identification of RAPD fragment 5. Lanes 51~55 indicate different clones. The blue arrows indicate positive PCR products. Clones ZZH11, ZZH31, ZZH41 and ZZH51 in blue colors were sequencing. The blue arrows indicate expected PCR bands in size of different clones. Lane M indicates the DNA molecular weight marker DL2000 with the fragment size (bp).
Molecules 20 19687 g003

2.1.2. Sequencing and Characterization of G. jasminoides Ellis var. grandiflora Nakai Specific RAPD Fragments

After sequencing of the above mentioned four RAPD fragments clones of G. jasminoides, BLAST searches of the nucleotide sequences in GenBank database were performed and indicated that these clones have no significant identity to that of any species. The sequencing results revealed that clone ZZH11, consisting of 700 nucleotides, was deposited into GenBank with accession number KP641310 (Figure 4A); cloneZZH31, consisting of 699 nucleotides, was deposited into GenBank with accession number KP641311 (Figure 4B); clone ZZH41, consisting of 942 nucleotides, was deposited into GenBank with accession number KP641312 (Figure 4C); and clone ZZH51, consisting of 457 nucleotides, was deposited into GenBank with accession number KP641313.

2.1.3. Development of Specific SCAR Markers for G. jasminoides Ellis var. grandiflora Nakai, and Analysis of the PCR Amplicons at Different Species

In this study, we designed and synthesized four pairs of primers (for ZZH11, ZZH31, ZZH41 and ZZH51) to generate more stable G. jasminoides Ellis var. grandiflora Nakai-specific diagnostic SCAR markers based on our cloned sequences (Figure 4). The primers used in the RAPD analysis are listed in Table 2. The designed SCAR primer pairs were used to amplify the genomic DNA collected from 22 samples to test amplification species-specificity. The PCR amplification results are shown in Figure 5. The PCR results by SCAR markers ZZH11, ZZH31, ZZH41 and ZZH51 (Figure 5) indicated that the PCR products with expected size were observed only in samples of G. jasminoides, and no amplification in other species we tested. This indicates that the SCAR marker ZZH11, ZZH31, ZZH41 and ZZH51 are specific for G. jasminoides Ellis var. grandiflora Nakai. The lack of this specific amplicons in the samples from other species indicates the efficacy of this marker in distinguishing the samples of G. jasminoides Ellis var. grandiflora Nakai from other species. Negative controls without DNA template did not show any PCR product (data not shown). Therefore, we confirm that G. jasminoides-specific SCAR markers were successfully developed, which can be used for the authentication of these plants.
Molecules 20 19687 g004 550
Figure 4. The cloned sequences information by Sanger-sequencing. (A) The sequences of clone ZZH11; (B) The sequences of clone ZZH31; (C) The sequences of clone ZZH41; (D) The sequences of clone ZZH51.
Figure 4. The cloned sequences information by Sanger-sequencing. (A) The sequences of clone ZZH11; (B) The sequences of clone ZZH31; (C) The sequences of clone ZZH41; (D) The sequences of clone ZZH51.
Molecules 20 19687 g004
Molecules 20 19687 g005 550
Figure 5. Development of stable RAPD-sequence-characterized amplified region (SCAR) markers for ZZH11, ZZH31, ZZH41 and ZZH51. (A) A SCAR marker ZZH11; (B) A SCAR marker ZZH31; (C) A SCAR marker ZZH41; (D) A SCAR marker ZZH51. Lanes 1~6 indicate the different samples of G. jasminoides Ellis var. grandiflora Nakai listed in Table 1. Lanes 7 and 8 are two samples of Lonicera japonica from Hunan and Hubei; Lane 9 is one sample of Penthorum chinense; Lane 10 is one sample of Ganoderma lucidum; Lanes 11 and 12 are two samples of Litchi chinesis from Guangdong and Sichuan; Lanes 13 and 14 are two samples of Dimocarpus Longan from Fujian and Sichuan; Lane 15 is one sample of Dimocarpus confinis from Guangxi; Lanes 16 and 17 are two samples of Ginkgo Biloba from Sichuan and Hunan; Lanes 18 and 19 are two samples of Angelica sinensis from Sichuan and Gansu; Lane 20 is one sample of Gastrodia elata; Lanes 21 and 22 are two samples of Canarium album Guangdong and Sichuan; Lane 23 is negative control without DNA. The blue arrows indicate expected PCR products in size. Lane M indicates the DNA molecular weight marker DL2000.
Figure 5. Development of stable RAPD-sequence-characterized amplified region (SCAR) markers for ZZH11, ZZH31, ZZH41 and ZZH51. (A) A SCAR marker ZZH11; (B) A SCAR marker ZZH31; (C) A SCAR marker ZZH41; (D) A SCAR marker ZZH51. Lanes 1~6 indicate the different samples of G. jasminoides Ellis var. grandiflora Nakai listed in Table 1. Lanes 7 and 8 are two samples of Lonicera japonica from Hunan and Hubei; Lane 9 is one sample of Penthorum chinense; Lane 10 is one sample of Ganoderma lucidum; Lanes 11 and 12 are two samples of Litchi chinesis from Guangdong and Sichuan; Lanes 13 and 14 are two samples of Dimocarpus Longan from Fujian and Sichuan; Lane 15 is one sample of Dimocarpus confinis from Guangxi; Lanes 16 and 17 are two samples of Ginkgo Biloba from Sichuan and Hunan; Lanes 18 and 19 are two samples of Angelica sinensis from Sichuan and Gansu; Lane 20 is one sample of Gastrodia elata; Lanes 21 and 22 are two samples of Canarium album Guangdong and Sichuan; Lane 23 is negative control without DNA. The blue arrows indicate expected PCR products in size. Lane M indicates the DNA molecular weight marker DL2000.
Molecules 20 19687 g005
Table
Table 2. Sequences of SCAR primers, PCR condition and product size (bp).
Table 2. Sequences of SCAR primers, PCR condition and product size (bp).
SCAR5′-primerSequence (5′–3′)3′-primerSequence (5′–3′)SizeTm (°C)
ZZH11ZZH11-LTGCCAATGATCGAGGTTCTCZZH11-RGCACTACAACCACCCAAGGA38160
ZZH31ZZH31-LTTCCAAACCACAACAAGCCGTZZH31-RGCATGAGTTTGTCGGCGATTT24564
ZZH41ZZH41-LATGGCGTACCTTCCAATGTGZZH41-RAATGGCCAGACCATGTCAAG27960
ZZH51ZZH51-LACGCTAAGGAGGATCACGACAZZH51-RACTGACAAGACGGACTGCAAC29160
Then, to further test whether these four markers can be amplified in the sample of G. jasminoides we collected in the market from Luzhou of Sichuan (Table 1), the results in the Figure 6 showed that only SCAR marker ZZH31 were amplified in the sample from G. jasminoides Ellis var. grandiflora Nakai, not from G. jasminoides, whereas other three SCAR markers ZZH11, ZZH41and ZZH51 were amplified in the samples of both G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides. Again, four G. jasminoides samples and four G. jasminoides Ellis var. grandiflora Nakai samples were collected from different localities (Table 1, Nos. 8~15), all four makers can be amplified in samples of G. jasminoides and G. jasminoides Ellis var. grandiflora Nakai, except that marker ZZH31 can’t amplified in the samples of G. jasminoides, further supporting that SCAR marker ZZH31 is specific for G. jasminoides Ellis var. grandiflora Nakai (Figure 7).

2.2. Discussion

This investigation aimed to improve the authentication process of G. jasminoides Ellis var. grandiflora Nakai using a RAPD-derived SCAR molecular method. Authentication and characterization of any living organisms has been revolutionized with the development of molecular marker technologies. Over the last three decades, numerous molecular marker techniques have been developed, including RAPD, amplified fragment length polymorphism (AFLP) analysis, simple sequence repeat (SSR) analysis, inter-simple sequence repeat (ISSR) analysis and etc. [13,14,20,21]. It has been reported that the genetic identification and authentication of any species or cultivars become more specific and stable, when another bio-technique SCAR is combined with RAPD [16,18,19,22,23,24,25].
To develop the SCAR markers, in this study, we have at first collected six cultivars of G. jasminoides Ellis var. grandiflora Nakai, from different geographically isolated regions of China. The DNA materials of these plant leaves were extracted and amplified by an improved RAPD, which revealed the significant genetic variations among the cultivars [12]. We have then focused on the development of SCAR markers specific to G. jasminoides Ellis var. grandiflora Nakai, which can identify this species or cultivars from others. The RAPD fragments were cloned and then four SCAR markers ZZH11, ZZH31, ZZH41 and ZZH51 were developed, which are specific to all of the cultivars of G. jasminoides Ellis var. grandiflora Nakai species used in this study. Notably, DNA material from other species was not recognized by these four markers (Figure 5). Further investigation demonstrated that only SCAR marker ZZH31 were amplified in the sample from G. jasminoides Ellis var. grandiflora Nakai, not from G. jasminoides when tested by collecting five samples from different localities, whereas other three SCAR markers ZZH11, ZZH41 and ZZH51 were amplified in the samples of both G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides samples. In line with previous studies, this clearly indicates that these three SCAR markers ZZH11, ZZH41 and ZZH51 are specific to Gardenia family, whereas SCAR marker ZZH31 is strictly specific to G. jasminoides Ellis var. grandiflora Nakai cultivars. Thus, we could use SCAR marker ZZH31 to distinguish G. jasminoides Ellis var. grandiflora Nakai from G. jasminoides in our markets (Figure 6 and Figure 7).
Expectedly, in GenBank database, the BLAST searches of these four nucleotide sequences did not show significant identity to that of any species. This indicates that ZZH11, ZZH31, ZZH41 and ZZH51 are the novel biomarkers for the identification and authentication of G. jasminoides, particularly G. jasminoides Ellis var. grandiflora Nakai. In some previous studies, RAPD-SCAR marker techniques have been successfully developed for genetic identification of some other plants, like Lonicera japonica, Dimocarpus longan, and other etc. [18,19,21,22,23,24,25,26], however, as our best knowledge, this is the first study, which developed molecular SCAR markers for the authentication of G. jasminoides species. Although microsatellite markers for the studying species G. jasminoides have been developed very recently [27,28,29]. The results highlighted that development of these SCAR markers will be helpful for genetic and ecological preservation and conservation of this plant. We suggest that RAPD-SCAR technology could be useful for the identification and characterization of different Chinese herbal materials in the plant pharmaceutical industry or of ornamental importance.
Molecules 20 19687 g006 550
Figure 6. Genetic authentication of Gardenia jasminoides based on ZZH11 (A); ZZH31 (B); ZZH41 (C) and ZZH51 (D) SCAR markers. Lanes 1–6 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Jiangxi, Fujian, Guizhou, Sichuan, Hunan and Zhejiang respectively (Table 1). Lane 7 is a sample of G. jasminoides from Luzhou in Sichuan (No. 7 in Table 1). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
Figure 6. Genetic authentication of Gardenia jasminoides based on ZZH11 (A); ZZH31 (B); ZZH41 (C) and ZZH51 (D) SCAR markers. Lanes 1–6 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Jiangxi, Fujian, Guizhou, Sichuan, Hunan and Zhejiang respectively (Table 1). Lane 7 is a sample of G. jasminoides from Luzhou in Sichuan (No. 7 in Table 1). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
Molecules 20 19687 g006
Molecules 20 19687 g007 550
Figure 7. Genetic authentication of more Gardenia jasminoides sample based on ZZH11 (A); ZZH31 (B); ZZH41 (C) and ZZH51 (D) SCAR markers. Lanes 6, 8, 9, 10 and 11 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Zhejiang, Guangdong, Fujian, Hunan and Anhui respectively (Table 1, Nos. 6, 8, 9, 10 and 11). Lane 7, 12, 13, 14 and 15 are samples of G. jasminoides from Luzhou in Sichuan, Jiangsu, Jiangxi, Hunan and Shanxi respectively (Table 1, Nos., 7, 12, 13, 14 and 15). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
Figure 7. Genetic authentication of more Gardenia jasminoides sample based on ZZH11 (A); ZZH31 (B); ZZH41 (C) and ZZH51 (D) SCAR markers. Lanes 6, 8, 9, 10 and 11 are the DNA samples of G. jasminoides Ellis var. grandiflora Nakai from Zhejiang, Guangdong, Fujian, Hunan and Anhui respectively (Table 1, Nos. 6, 8, 9, 10 and 11). Lane 7, 12, 13, 14 and 15 are samples of G. jasminoides from Luzhou in Sichuan, Jiangsu, Jiangxi, Hunan and Shanxi respectively (Table 1, Nos., 7, 12, 13, 14 and 15). Lane M indicates the DNA molecular weight marker DL600 with the fragment size (bp).
Molecules 20 19687 g007

3. Experimental Section

3.1. DNA Extraction from G. jasminoides

Firstly, six fresh young leaves of different cultivars of G. jasminoides Ellis var. grandiflora Nakai which was previous described [12], five more G. jasminoides Ellis var. grandiflora Nakai and five G. jasminoides were collected (Table 1, Figure 1). All the samples of G. jasminoides Ellis var. grandiflora Nakai were collected from gardens from different localities and all the samples of G. jasminoides were purchased in the pharmacy stores which indicated their originations clearly. The samples of G. jasminoides are dried fruits. Plant specimens were identified by the authors and all voucher specimens have been deposited at the Medicinal Botanical Association of Zhongshan Mountain (MBAZM), Sichuan Medical University. Then the plant genomic DNA materials were extracted as previously described slightly modified cetyltrimethylammonium bromide (CTAB) method [29]. DNA was then diluted with 1 × TE buffer to make the final concentration of 10 ng/μL, and stored at −20 °C until usage.

3.2. Amplification of DNA by Improved RAPD

DNA materials of different cultivars of G. jasminoides Ellis var. grandiflora Nakai samples were amplified with primers SBC-N5 and SBS-Q12 using Tiangen Biotech reagents (Beijing, China) according to the manipulation protocol. A total 10 μL PCR reaction system consisted of 5 μL 2 × Taq PCR MasterMix, 1 μL 2.5 μM primer, 1.5 μL genomic DNA, and 2.5 μL ddH2O. Amplification reactions were performed in an Applied Biosystems Veriti® 96-Well Thermal Cycler (Life Technology, Carlsbad, CA, USA) using the following program: initial denaturation at 95 °C for 90 s, followed by 40 cycles of denaturation at 94 °C for 40 s, annealing at 36 °C with the RAMP rate from annealing to extension adjusted to 0.125 °C/s (5% ramp rate) for 60 s, extension at 72 °C for 90 s, and a final extension step at 72 °C for 5 min [12]. PCR products were loaded into a 1.5% agarose gel for electrophoresis, along with 1 kb or 100 bp DNA ladder markers (Tiangen Biotech). Measurements were repeated three times in each well.

3.3. Cloning, Identification and Sequencing of DNA Fragments

The DNA Cloning, identification and sequencing were described previously [16,18]. Briefly, four different bright bands were excised from the agarose gel, and purified by using TIANgel Mini Purification Kit (DP209, Tiangen Biotech). The purified DNA fragments were ligated into pGM-T vector (No. VT202) (Tiangen Biotech), and transformed into DH5α E. coli competent cells. The recombinant clones were seeded overnight at 37 °C on LB agar plates, containing 100 μg/μL of ampicillin, 40 mg of X-gal and 160 μg of IPTG and kept at 37 °C for overnight. The white colonies were screened out by blue white screening method. The presence of right insert was verified by PCR by using T7/SP6 primer pairs (T7 primer: 5′-TAATACGACTCACTATAGGG-3′, SP6 primer: 5′-ATTTAGGTGACACTATAGAA-3′), then run on a 1% agarose gel electrophoresis [16,18]. The sequencing of the positive clones was performed by Sanger di-deoxy sequencing from Beijing ZiXi Biological Technology Co., Ltd. (Bejing, China) using ABI3500 sequencer (Applied Biosystems Inc., Foster City, CA, USA).

3.4. Bioinformatic Analysis by Online Program BLAST

To remove the vector sequences and verify whether the sequences of cloned RAPD fragments are novel, the online program BLAST [30] was used for the homology search of sequenced DNA from different species in GenBank database. Database searches of sequence homology were performed using the program BlastN set to general parameters (expect threshold was 10).

3.5. Design of SCAR Primers

The nucleotide sequence of each of the cloned RAPD fragment was used to design pairs of SCAR primers using online program Primer 3 v.0.4.0 [31]. The sequences of each primer, optimized PCR condition and amplification length are shown in Table 2.

3.6. Development SCAR Markers and SCAR Analysis

To develop SCAR markers, the PCR amplification was performed by using DNA template from 11 different species, including six cultivars of G. jasminoides Ellis var. grandiflora Nakai and another 10 medicinal plant species (16 samples in total) [12,13,14,15,16,18]. The content of 10 μL PCR reaction system was as follows: 5 μL 2 × Taq PCR MasterMix, 1 μL of 2.5 μM each pair of SCAR primers, and 1 μL genomic DNA (10 ng), with the remaining volumes filled by ddH2O. PCR was performed in an Applied Biosystems Veriti® 96-Well Thermal Cycler with an initial pre-denaturation for 90 s at 95 °C followed by 27~35 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C or 64 °C for 30 s, and extension at 72 °C for 40 s. The final extension step was performed at 72 °C for 5 min. The amplified PCR products were separated by electrophoresis on a 1.8% agarose gel in 1 × TAE buffer. Gels were then visualized by 0.5 μg/mL ethidium bromide staining and the images were documented using the ChemiDoc XRS (Bio-Rad, Hercules, CA, USA) [29].

4. Conclusions

We have cloned and sequenced four improved RAPD derived fragments which were deposited in the GenBank database with the accession numbers KP641310, KP641311, KP641312 and KP641313 respectively, and developed SCAR markers, named ZZH11, ZZH31, ZZH41 and ZZH51 which can specifically recognize the genetic materials of G. jasminoides from other plant species. Moreover, SCAR marker ZZH31 can be used to distinguish G. jasminoides Ellis var. grandiflora Nakai from G. jasminoides at the DNA level. Thus, this study has developed four stably molecular SCAR markers by improved RAPD-derived DNA markers for the genetic identification and authentication, and for ecological conservation of medicinal and ornamental plant G. jasminoides. We suggest that RAPD-SCAR technology could be useful for the identification and characterization of different Chinese herbal materials in the plant pharmaceutical industry or of ornamental importance.

Acknowledgments

This research was supported in part by the Science and Technology Innovation Team of Colleges and Universities in Sichuan Province (13TD0032), the Applied Basic Research Program of Science and Technology Department of Sichuan Province (14JC0797, 2015JY0038), Luzhou City Special Foundation (2013LZLY-J10) and Sichuan Medical University Foundation (2014QN-091). The authors thank people who provided samples.

Author Contributions

J.F. was in charge of idea and concept of the paper; Z.M., B.Z., C.W., J.C. were in charge of samples collection, experimental design, PCR, and cloning study; S.I., H.C. and J.F. were in charge of language revision.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Choi, S.J.; Kim, M.J.; Heo, H.J.; Hong, B.; Cho, H.Y.; Kim, Y.J.; Kim, H.K.; Lim, S.T.; Jun, W.J.; Kim, E.K.; et al. Ameliorating effect of Gardenia jasminoides extract on amyloid beta peptide-induced neuronal cell deficit. Mol. Cells 2007, 24, 113–118. [Google Scholar] [PubMed]
  2. Chen, Y.H.; Lan, T.; Li, J.; Qiu, C.H.; Wu, T.; Gou, H.J.; Lu, M.Q. Gardenia jasminoides attenuates hepatocellular injury and fibrosis in bile duct-ligated rats and human hepatic stellate cells. World J. Gastroenterol. 2012, 18, 7158–7165. [Google Scholar] [CrossRef] [PubMed]
  3. Kim, E.S.; Jeong, C.S.; Moon, A. Genipin, a constituent of Gardenia jasminoides Ellis, induces apoptosis and inhibits invasion in MDA-MB-231 breast cancer cells. Oncol. Rep. 2012, 27, 562–572. [Google Scholar]
  4. Yang, Q.; Wu, B.; Shi, Y.; Du, X.; Fan, M.; Sun, Z.; Cui, X.; Huang, C. Guided fractionation and analysis of compounds with anti-influenza virus activity from Gardenia jasminoides Ellis. Arch. Pharm. Res. 2012, 35, 9–17. [Google Scholar] [CrossRef] [PubMed]
  5. Xiaofeng, Y.; Qinren, C.; Jingping, H.; Xiao, C.; Miaomiao, W.; Xiangru, F.; Xianxing, X.; Meixia, H.; Jing, L.; Jingyuan, W.; et al. Geniposide, an iridoid glucoside derived from Gardenia jasminoides, protects against lipopolysaccharide-induced acute lung injury in mice. Planta Med. 2012, 78, 557–564. [Google Scholar] [CrossRef] [PubMed]
  6. Wang, Y.; Yan, J.; Xi, L.; Qian, Z.; Wang, Z.; Yang, L. Protective effect of crocetin on hemorrhagic shock-induced acute renal failure in rats. Shock 2012, 38, 63–67. [Google Scholar] [CrossRef] [PubMed]
  7. Ishizuka, F.; Shimazawa, M.; Umigai, N.; Ogishima, H.; Nakamura, S.; Tsuruma, K.; Hara, H. Crocetin, a carotenoid derivative, inhibits retinal ischemic damage in mice. Eur. J. Pharmacol. 2013, 703, 1–10. [Google Scholar] [CrossRef] [PubMed]
  8. Tan, Y.; Lao, W.; Xiao, L.; Wang, Z.; Kamal, M.A.; Seale, J.P.; Qu, X. Managing the combination of nonalcoholic fatty liver disease and metabolic syndrome with Chinese herbal extracts in high-fat-diet fed rats. Evid. Based Complement. Altern. Med. 2013, 2013, 306738. [Google Scholar] [CrossRef] [PubMed]
  9. Zhang, H.Y.; Liu, H.; Yang, M.; Wei, S.F. Antithrombotic activi ueous extract from Gardenia jasminoides and its main constituent. Pharm. Biol. 2013, 51, 221–225. [Google Scholar] [CrossRef] [PubMed]
  10. Sung, Y.Y.; Lee, A.Y.; Kim, H.K. The Gardenia jasminoides extract and its constituent, geniposide, elicit anti-allergic effects on atopic dermatitis by inhibiting histamine in vitro and in vivo. J. Ethnopharmacol. 2014, 156, 33–40. [Google Scholar] [CrossRef] [PubMed]
  11. Chen, J.Y.; Wu, H.; Li, H.; Hu, S.L.; Dai, M.M.; Chen, J. Anti-inflammatory effects and pharmacokinetics study of geniposide on rats with adjuvant arthritis. Int. Immunopharmacol. 2015, 24, 102–109. [Google Scholar] [CrossRef] [PubMed]
  12. Mei, Z.; Khan, M.A.; Yang, L.; Yang, M.; Fu, J. Genetic characterization and authentication of Gardenia jasminoides in different regions of China by using improved RAPD analysis. Indian J. Exp. Biol. 2015, 53, 164–169. [Google Scholar] [PubMed]
  13. Fu, J.; Yang, L.; Khan, M.A.; Mei, Z. Genetic characterization and authentication of Lonicera japonica Thunb. by using improved RAPD analysis. Mol. Biol. Rep. 2013, 40, 5993–5999. [Google Scholar] [CrossRef] [PubMed]
  14. Desai, P.; Gajera, B.; Mankad, M.; Shah, S.; Patel, A.; Patil, G.; Narayanan, S.; Kumar, N. Comparative assessment of genetic diversity among Indian bamboo genotypes using RAPD and ISSR markers. Mol. Biol. Rep. 2015, 42, 1265–1273. [Google Scholar] [CrossRef] [PubMed]
  15. Long, Y.; Cheng, J.; Mei, Z.; Zhao, L.; Wei, C.; Fu, S.; Khan, M.A.; Fu, J. Genetic analysis of litchi (Litchi chinensis Sonn.) in southern China by improved random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR). Mol. Biol. Rep. 2015, 42, 159–166. [Google Scholar] [CrossRef] [PubMed]
  16. Cheng, J.; Long, Y.; Khan, M.A.; Wei, C.; Fu, S.; Fu, J. Development and significance of RAPD-SCAR markers for Litchi chinensis Sonn. variety authentication by improved RAPD amplification and molecular cloning. Electron. J. Biotechnol. 2015, 18, 35–39. [Google Scholar] [CrossRef]
  17. Li, S.F.; Tang, S.J.; Cai, W.Q. RAPD-SCAR Markers for Genetically improved NEW GIFT Nile Tilapia (Oreochromis niloticus niloticus L.) and their application in strain identification. Zool. Res. 2010, 31, 147–153. [Google Scholar] [CrossRef] [PubMed]
  18. Yang, L.; Khan, M.A.; Mei, Z.; Yang, M.; Zhang, T.; Wei, C.; Yang, W.; Zhu, L.; Long, Y.; Fu, J. Development of RAPD-SCAR markers for Lonicera japonica Thunb. (Caprifolicaceae) variety authentication by improved RAPD and DNA cloning. Rev. Biol. Trop. 2014, 62, 1649–1657. [Google Scholar] [CrossRef] [PubMed]
  19. Xin, G.Z.; Lam, Y.C.; Maiwulanjiang, M.; Chan, G.K.; Zhu, K.Y.; Tang, W.L.; Dong, T.T.; Shi, Z.Q.; Li, P.; Tsim, K.W. Authentication of Bulbus Fritillariae cirrhosae by RAPD-derived DNA markers. Molecules 2014, 19, 3450–3459. [Google Scholar] [CrossRef] [PubMed]
  20. Williams, J.G.; Kubelik, A.R.; Livak, K.J.; Rafalski, J.A.; Tingey, S.V. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 1990, 18, 6531–6535. [Google Scholar] [CrossRef] [PubMed]
  21. Noormohammadi, Z.; Hasheminejad-Ahangarani, F.Y.; Sheidai, M.; Ghasemzadeh-Baraki, S.; Alishah, O. Genetic diversity analysis in Opal cotton hybrids based on SSR, ISSR, and RAPD markers. Genet. Mol. Res. 2013, 12, 256–269. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, L.; Fu, S.; Khan, M.A.; Zeng, W.; Fu, J. Molecular cloning and development of RAPD-SCAR markers for Dimocarpus longan variety authentication. Springerplus 2013, 2, 501. [Google Scholar] [CrossRef] [PubMed]
  23. Saju, J.M.; Németh, S.; Szűcs, R.; Sukumaran, R.; Lim, Z.; Wong, L.; Orbán, L.; Bercsényi, M. PCR-based identification of Adriatic specimen of three scorpionfish species (Scorpaenidae, Teleostei). Acta Biol. Hung. 2014, 65, 132–143. [Google Scholar] [CrossRef] [PubMed]
  24. Fu, J.; Khan, M.A.; Mei, Z.; Tania, M.; Yang, L.; Cheng, J. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning. Genet. Mol. Res. 2015, 14, 5667–5676. [Google Scholar] [CrossRef] [PubMed]
  25. Kao, K.W.; Lin, C.Y.; Peng, S.F.; Cheng, Y.M. Characterization of four B-chromosome-specific RAPDs and the development of SCAR markers on the maize B-chromosome. Mol. Genet. Genom. 2015, 90, 431–441. [Google Scholar] [CrossRef] [PubMed]
  26. Luzio, A.; Coimbra, A.M.; Benito, C.; Fontaínhas-Fernandes, A.A.; Matos, M. Screening and identification of potential sex-associated sequences in Danio rerio. Mol. Reprod. Dev. 2015, 82, 756–764. [Google Scholar] [CrossRef] [PubMed]
  27. Xu, Y.Q.; Wei, G.Y.; Zhou, Y.; Ge, F.; Luo, G.M. Isolation and characterization of twenty-two polymorphic microsatellite markers from Gardenia jasminoides (Rubiaceae). J. Genet. 2014, 93, e22–e24. [Google Scholar] [CrossRef] [PubMed]
  28. Deng, S.Y.; Wang, X.R.; Zhu, P.L.; Wen, Q.; Yang, C.X. Development of polymorphic microsatellite markers in the medicinal plant Gardenia jasminoides (Rubiaceae). Biochem. Syst. Ecol. 2015, 58, 149–155. [Google Scholar] [CrossRef]
  29. Fu, J.J. Short Protocols in Medical Molecular Biology; China Medical Science Press: Beijing, China, 2012. [Google Scholar]
  30. BLAST Algorithm, 2nd ed.An Algorithm for Comparing Primary Biological Sequence Information; National Center of Biotechnology Information: Bethesda, MD, USA, 2002. Available online: http://www.ncbi.nlm.nih.gov/BLAST/ (accessed on 20 March 2015).
  31. Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer 3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
  • Sample Availability: Samples of the G. jasminoides Ellis var. grandiflora Nakai and G. jasminoides are available from the authors.

Share and Cite

MDPI and ACS Style

Mei, Z.; Zhou, B.; Wei, C.; Cheng, J.; Imani, S.; Chen, H.; Fu, J. Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers. Molecules 2015, 20, 20219-20229. https://doi.org/10.3390/molecules201119687

AMA Style

Mei Z, Zhou B, Wei C, Cheng J, Imani S, Chen H, Fu J. Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers. Molecules. 2015; 20(11):20219-20229. https://doi.org/10.3390/molecules201119687

Chicago/Turabian Style

Mei, Zhiqiang, Boxu Zhou, Chunli Wei, Jingliang Cheng, Saber Imani, Hanchun Chen, and Junjiang Fu. 2015. "Genetic Authentication of Gardenia jasminoides Ellis var. grandiflora Nakai by Improved RAPD-Derived DNA Markers" Molecules 20, no. 11: 20219-20229. https://doi.org/10.3390/molecules201119687

Article Metrics

Back to TopTop