Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability
Abstract
:1. Introduction
2. Results and Discussion
Locus | Repeat Motif | Primer Sequence (5′-3′) | Ta (°C) | Size (bp) | GenBank Accession No. |
---|---|---|---|---|---|
Ssa 47 | (GT)5 | F: GGAGAAGAGAGAAGAGAGGATG | 55 | 109 | KP742353 |
R: CACCGTCAAGTAATTCAGTATAAAT | |||||
Ssa 30 | (GT)7 | F: TGGGTGGATTATTGATGAGG | 55 | 112 | KP742354 |
R: GCTTCCTACTCAATGCAAAACC | |||||
Ssa 92 | (TG)11 | F: TGGAGTGAGTTTTAGGTTTT | 51 | 70 | KP742355 |
R: CACTGGAAGTGGTACGATAC | |||||
Ssa 46 | (TG)10 | F: AGTGAGTTTTAGGTTTTTGTGT | 51 | 59 | KP742356 |
R: AAGTGGTACGATACTATTCGC | |||||
Ssa 64 | (TG)11 | F: AATGGAGTGAGTTTTAGGT | 51 | 70 | KP742357 |
R: CTGGAAGTGGTACGATAC | |||||
Ssa 17 | (CA)7 | F: TCAGGCTCCATAGTAACCC | 57 | 173 | KP742358 |
R: AAGTCGTGTCAGGAAGGC | |||||
Ssa 66B | (CA)11 | F: CTGGAAGTGGTACGATAC | 55 | 67 | KP742359 |
R: GGAGTGAGTTTTAGGTTTT | |||||
Ssa 56 | (CA)12 | F: TATTTCGATACTTCAATCACAC | 51 | 105 | KP742360 |
R: TGTTTATTATTGACATTGAATTG | |||||
Ssa 32 | (CA)10 | F: GGAAGGAGGTTTGGTAGAT | 51 | 118 | KP742361 |
R: TCATCCTGTGACCCCTGT | |||||
Ssa 10 | (CA)7–(CA)13 | F: ACTGGAAGTGGTACGATACTATT | 52 | 223 | KP742362 |
R: GAAATGTGTACTTACCTTATCCA | |||||
Ssa 66A | (GT)7 | F: GGTTGCATTGCATAGCC | 52 | 234 | KP742363 |
R: AGAATCTTCTCTCCAGAGTCA | |||||
Ssa 83 | (GT)8 | F: AGGAAGGCGAATGAGTGT | 55 | 153 | KP742364 |
R: AAGAAGGTGAAATGTATAGCA | |||||
Ssa 60 | (TGTTGTG)6 | F: GCTTCTTGCTGAAAGTGACA | 55 | 243 | KP742366 |
R: ACGACAGGTTTCCCGACT | |||||
Ssa 90 | (TG)5 | F: AACAACAGGTTATACCACTTCG | 54 | 128 | KP742365 |
R: CCACACAAACACACGCAC |
Locus | Sedum sarmentosum (n = 48) | Sedum lineare (n = 12) | ||||||
---|---|---|---|---|---|---|---|---|
A | HO | HE | PHWE | A | HO | HE | PHWE | |
Ssa 47 | 6 | 0.5892 | 0.5833 | 0.6073 | – | |||
Ssa 30 | 5 | 0.4583 | 0.5052 | 0.0612 | 1 | |||
Ssa 92 | 8 | 0.6458 | 0.6516 | 0.8734 | 4 | 0.2033 | 0.2964 | 0.0312 |
Ssa 46 | 6 | 0.5833 | 0.6038 | 0.9824 | 1 | |||
Ssa 64 | 7 | 0.6471 | 0.5882 | 0.6667 | 5 | 0.45 | 0.5018 | 0.3506 |
Ssa 17 | 15 | 0.8750 | 0.9011 | 0.1823 | 7 | 0.5 | 0.6012 | 0.2021 |
Ssa 66B | 5 | 0.4512 | 0.3958 | 0.4612 | 6 | 0.4583 | 0.5821 | 0.0000 |
Ssa 56 | 10 | 0.8333 | 0.9063 | 0.0672 | 6 | 0.4167 | 0.5623 | 0.0313 |
Ssa 32 | 4 | 0.4167 | 0.4920 | 0.7343 | 1 | |||
Ssa 10 | 3 | 0.0833 | 0.2168 | 0.0000 | 1 | |||
Ssa 66A | 8 | 0.5833 | 0.6328 | 0.1273 | – | |||
Ssa 83 | 7 | 0.5417 | 0.6027 | 0.4263 | 1 | |||
Ssa 60 | 4 | 0.2500 | 0.4328 | 0.0003 | 1 | |||
Ssa 90 | 9 | 0.7033 | 0.7108 | 0.6230 | 3 | 0.3333 | 0.3367 | 0.0421 |
Sedum Species | ||||||
---|---|---|---|---|---|---|
S. sarmentosum | S. lineare | S. emarginatum | S. bulbiferum | S. aizoo | S. ellacombianum | |
(n = 12) | (n = 12) | (n = 3) | (n = 3) | (n = 3) | (n = 3) | |
Transferability (%) | 100 | 85.7 | 78.6 | 71.4 | 71.4 | 64.3 |
3. Experimental Section
3.1. Plant Materials and Genomic DNA Extraction
3.2. Construction of an SSR-Enriched Library and Primer Design
3.3. Amplification of SSR, Polymorphism Detection and Data Analysis
3.4. Detection of the Transferability of SSR Primers and Date Analysis
4. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Wang, D.R. A Survey of “Chuipencao” and the other ethnomedicines from the same genus (Sedum L.). Lishizhen Med. Mat. Med. Res. 2007, 18, 1853–1855. [Google Scholar]
- Wu, X.N. Update therapy of chronic hepatitis B in China: Recent progress. China Natl. J. New Gas. 1996, 2, 65–68. [Google Scholar]
- Kang, T.H.; Pae, H.O.; Yoo, J.C.; Kim, N.Y.; Kim, Y.C.; Ko, G.I.; Chung, H.T. Antiproliferative effects of alkaloids from Sedum sarmentosum on murine and human hepatoma cell lines. J. Ethnopharmacol. 2000, 70, 177–182. [Google Scholar] [CrossRef]
- Jung, H.J.; Kang, H.J.; Song, Y.S.; Park, E.H.; Kim, Y.M.; Lim, C.J. Anti-inflammatory, anti-angiogenic and anti-nociceptive activities of Sedum sarmentosum extract. J. Ethnopharmacol. 2008, 116, 138–143. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.Z.; Luo, K.; Yao, H.; Liu, P. Authentication of sedum sarmentosum and its adulterants by application of ITS2 sequences. Mod. Chin. Med. 2011, 13, 29–31. [Google Scholar]
- Xie, D.M.; Huang, L.Q.; Qin, M.J.; Wang, D.Q.; Jiang, C.; Yuan, Y. AS-PCR amplification in identification of Sedum sarmentosum with its relative species. J. Chin. Med. Mat. 2014, 37, 1768–1772. [Google Scholar]
- Wu, F.X. Authentication of Sedum sarmentosum and its adulterants. Yunnan J. Tradit. Chin. Med. Mater. Med. 2008, 29. [Google Scholar] [CrossRef]
- Lu, L.Q.; Mei, Q.; Wan, D.R.; Yang, X.Z.; Qiao, S.; Zhao, Y.D. HPLC characteristic fingerprints of sedi linearis herba and sedi herba. J. Chin. Med. Mat. 2014, 37, 583–587. [Google Scholar]
- Chung, M.Y.; López-Pujol, J.; Chung, M.G. Comparative genetic structure between Sedum ussuriense and Sedum kamtschaticum (Crassulaceae), two stonecrops co-occurring on rocky cliffs. Am. J. Bot. 2014, 101, 946–956. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.J.; Xu, R.; Wan, D.R.; Chen, Y. Genetic diversity analysis on the medicinal plants of Sedum L. by RAPD. J. Huazhong Agric. Univ. 2008, 27, 782–786. [Google Scholar]
- Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Sharma, P.C.; Grover, A.; Kahl, G. Mining microsatellites in eukaryotic genomes. Trends Biotechnol. 2007, 25, 490–498. [Google Scholar] [CrossRef] [PubMed]
- Glenn, T.C.; Schable, N.A. Isolating microsatellite DNA loci. Method Enzymol. 2005, 395, 202–222. [Google Scholar]
- Techen, N.; Arias, R.S.; Pan, Z.; Khan, I.A.; Scheffler, B.E. Optimized construction of microsatellite-enriched libraries. Mol. Ecol. Res. 2010, 10, 508–515. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.A.; Song, J.Y.; Choi, H.R.; Chung, J.W.; Jeon, Y.A.; Lee, J.R.; Ma, K.H.; Lee, M.C. Novel microsatellite markers acquired from Rubus coreanus Miq. and cross-amplification in other Rubus species. Molecules 2015, 20, 6432–6442. [Google Scholar] [CrossRef] [PubMed]
- Cuc, L.M.; Mace, E.S.; Crouch, J.H.; Quang, V.D.; Long, T.D.; Varshney, R.K. Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea). BMC Plant Biol. 2008, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwon, S.W.; Chung, J.W.; Park, J.W.; Lee, G.A.; Ma, K.H.; Lee, M.C.; Park, Y.J. Microsatellite variations and population structure in an on-farm collection of Japanese apricot (Prunus mume Sieb. et Zucc.). Biochem. Syst. Ecol. 2012, 42, 99–112. [Google Scholar] [CrossRef]
- Wang, H.; Chen, N.F.; Zheng, J.Y.; Wang, W.C.; Pei, Y.Y.; Zhu, G.P. Isolation and characterization of eleven polymorphic microsatellite loci for the valuable medicinal plant Dendrobium huoshanense and cross-species amplification. Int. J. Mol. Sci. 2012, 13, 16779–16784. [Google Scholar] [CrossRef] [PubMed]
- You, J.L.; Liu, W.S.; Zhao, Y.; Zhu, Y.Q.; Zhang, W.J.; Wang, Y.G.; Lu, F.; Song, Z.P. Microsatellite markers in Rhodiola (Crassulaceae), a medicinal herb genus widely used in traditional Chinese medicine. Appl. Plant Sci. 2013, 1. [Google Scholar] [CrossRef]
- Zhang, Y.S.; Hou, B.W.; Zhang, W.M.; Ding, X.Y. Isolation and characterization of novel microsatellite markers for Bletilla striata and inter-specific amplification in 2 congeneric species. Conserv. Genet. Resour. 2015, 7, 483–485. [Google Scholar] [CrossRef]
- Nève, G.; Meglécz, E. Microsatellite frequencies in different taxa. Trends Ecol. Evol. 2000, 15, 376–377. [Google Scholar] [CrossRef]
- Meglécz, E.; Petenian, F.; Danchin, E.; Coeur d’Acier, A.; Rasplus, J.Y.; Faure, E. High similarity between flanking regions of different microsatellites detected within each of two species of Lepidoptera: Parnassius apollo and Euphydryas aurinia. Mol. Ecol. 2004, 13, 1693–1700. [Google Scholar] [CrossRef] [PubMed]
- Nantón, A.; Arias-Pérez, A.; Méndez, J.; Freire, R. Characterization of nineteen microsatellite markers and development of multiplex PCRs for the wedge clam Donax trunculus (Mollusca: Bivalvia). Mol. Biol. Rep. 2014, 41, 5351–5357. [Google Scholar] [CrossRef] [PubMed]
- Geng, Q.F.; Liu, J.; Sun, L.; Liu, H.; Ou-Yang, Y.; Cai, Y.; Tang, X.S.; Zhang, H.W.; Wang, Z.S.; An, S.Q. Development and characterization of polymorphic microsatellite markers (SSRs) for an endemic plant, Pseudolarix amabilis (Nelson) Rehd. (Pinaceae). Molecules 2015, 20, 2685–2692. [Google Scholar] [CrossRef] [PubMed]
- Zouros, E.; Foltz, D.W. Possible explanations of heterozygote deficiency in Bivalve mollusks. Malacologia 1984, 25, 583–591. [Google Scholar]
- Chapuis, M.P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.B.; Xie, Y.H.; Sun, X.M. Development and characterization of polymorphic Genic-SSR markers in Larix kaempferi. Molecules 2015, 20, 6060–6067. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Cai, C.F.; Cheng, F.Y.; Cui, H.L.; Zhou, H. Characterisations and development of EST-SSR markers in tree peony using transcriptome sequences. Mol. Breed. 2014, 34, 1853–1866. [Google Scholar] [CrossRef]
- Wang, H.X.; Walla, J.A.; Zhong, S.B.; Huang, D.Q.; Dai, W.H. Development and cross-species/genera transferability of microsatellite markers discovered using 454 genome sequencing in chokecherry (Prunus virginiana L.). Plant Cell Rep. 2012, 31, 2047–2055. [Google Scholar] [CrossRef] [PubMed]
- Lian, C.L.; Hogetsu, T.; Matsushita, N.; Guerin-Laguette, A.; Suzuki, K.; Yamada, A. Development of microsatellite markers from an ectomycorrhizal fungus, Tricholoma matsutake, by an ISSR-suppression-PCR method. Mycorrhiza 2003, 13, 27–31. [Google Scholar] [CrossRef] [PubMed]
- Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [PubMed]
- Abd-Elsalam, K.A. Bioinformatic tools and guideline for PCR primer design. Afr. J. Biotechnol. 2003, 2, 91–95. [Google Scholar] [CrossRef]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar]
- Sample Availability: Samples are available from the authors.
© 2015 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, J.; Hou, F.-Y.; Wan, D.-R.; Wang, S.; Xu, D.-M.; Yang, G.-Z. Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability. Molecules 2015, 20, 19929-19935. https://doi.org/10.3390/molecules201119669
Xu J, Hou F-Y, Wan D-R, Wang S, Xu D-M, Yang G-Z. Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability. Molecules. 2015; 20(11):19929-19935. https://doi.org/10.3390/molecules201119669
Chicago/Turabian StyleXu, Jing, Fu-Yuan Hou, Ding-Rong Wan, Sha Wang, Dong-Mei Xu, and Guang-Zhong Yang. 2015. "Development and Characterization of Polymorphic Microsatellite Markers for Sedum sarmentosum (Crassulaceae) and Their Cross-Species Transferability" Molecules 20, no. 11: 19929-19935. https://doi.org/10.3390/molecules201119669