Next Article in Journal
The Effects of Foliar Salicylic Acid and Zinc Treatments on Proline, Carotenoid, and Chlorophyll Content and Anti-Oxidant Enzyme Activity in Galanthus elwesii Hook
Previous Article in Journal
Evaluation of Productivity Components and Antioxidant Activity of Different Types of Garlic Depending on the Morphological Organs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 9
10.3390/horticulturae9091040
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Temporal Changes in Flavonoid Components, Free Radical Scavenging Activities and Metabolism-Related Gene Expressions during Fruit Development in Chinese Dwarf Cherry (Prunus humilis)

by
Hongyan Han
1,*,
Lingjuan Zhang
2,
Shan Liu
2,
Na Li
1,
Jianxin Huo
1 and
Xiaopeng Mu
1,2
1
Department of Biological Science and Technology, Jinzhong University, Yuci 030606, China
2
College of Horticulture, Shanxi Agricultural University, Taigu 030801, China
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(9), 1040; https://doi.org/10.3390/horticulturae9091040
Submission received: 27 August 2023 / Revised: 13 September 2023 / Accepted: 14 September 2023 / Published: 15 September 2023
(This article belongs to the Section Developmental Physiology, Biochemistry, and Molecular Biology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Temporal changes in total flavonoid content (TFC), composition, free radical scavenging activity and metabolism-related gene expression of three Prunus humilis cultivars with distinctively different fruit colors were investigated in this study. The highest fruit TFCs of all three cultivars were observed at the initial sampling stage (young-fruit stage, YFS), which then declined gradually until fruit ripening. The dark-red-fruited cultivar ‘Jinou 1’ had the highest TFC, followed by the yellow-red-fruited cultivar ‘Nongda 3’ and the yellow-fruited cultivar ‘Nongda 5’. Thirteen flavonoid compounds were found in the three cultivars by using high-performance liquid chromatography (HPLC), and the content of most flavonoid compounds gradually decreased throughout the fruit-ripening process, with the exception of cyanidin-3-O-glucoside (C3G). C3G, as the main anthocyanin in P. humilis fruits, increased drastically during the fruit-coloring process of cultivars ‘Jinou 1’ and ‘Nongda 3’, while it was not detected in the developing fruits of cultivar ‘Nongda 5’. The antioxidant activity assay (DPPH, FRAP and ABTS) revealed that fruits of all three cultivars at YFS also had the highest antioxidant activities, and cultivar ‘Jinou 1’ had the highest antioxidant activities. Correlation analysis revealed that the antioxidant activities were significantly positively correlated with the TFCs and contents of the main compounds such as catechin, proanthocyanidin B1 and phloretin-2′,4-O-diglucoside (p < 0.01). Moreover, gene expression analysis showed that the flavonoid biosynthetic genes had different expression patterns in the three cultivars. The expression levels of ChCHS, ChCHI, ChF3H, ChDFR, ChLDOX and ChUFGT increased gradually with fruit ripening in cultivar ‘Jinou 1’, while all flavonoid-related genes in cultivar ‘Nongda 5’ decreased gradually during fruit development. The results from our study could significantly contribute to the deeper understanding of flavonoid accumulation mechanisms in P. humilis fruits and also help facilitate the targeted cultivar development and the utilization as a functional food of this fruit species.

1. Introduction

Flavonoids are a class of polyphenols, which can be used as effective natural antioxidants to prevent free radical damage in the human body [1]. The steady intake of plant flavonoids reduces the effects of oxidative damage that could lead to many severe illnesses, such as cardiovascular diseases and diabetes [2]. Studies have revealed that fruit flavonoids can have a particularly potent effect on cognition and age-related memory decline in rats [3,4]. Other reports have shown that consuming flavonoid-rich foods, such as apples, pears, berries and peppers, may also help adults maintain body weight and help to prevent potential consequences of obesity [5,6]. In recent years, consumer demand and interest in the nutraceutical and functional values of plant flavonoids have increased, leading to comprehensive studies on a number of high-flavonoid fruits over the past two decades, such as apple, citrus, blueberry, blackberry, bilberry, raspberry, strawberry and sea buckthorn [7].
Prunus humilis, known as Chinese dwarf cherry or ‘Calcium fruit’, is a fruit-bearing shrub distributed throughout Northern China [8]. Its native habitat is typically the sunny sides of limestone mountains [9]. Several studies showed that P. humilis possesses strong drought tolerance and cold hardiness as well as good adaption to soils with moderate salinity and alkalinity [10]; therefore, P. humilis has been used as a key plant species in numerous soil improvement and water conservation projects in Northern China [11]. Besides its ecological value, fruits of P. humilis are rich in vitamins, mineral elements, organic acids and other nutrients [12,13]. Recently, the fruits of P. humilis were also proved to be flavonoid-rich and a promising source of natural antioxidants [14,15,16,17]. The flavonoid biosynthesis pathway in plants is quite conserved, and a number of key enzymes are involved [18,19], such as phenylalanine ammonia lyase (PAL), cinnamic acid 4-carboxylase (C4H), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), flavanol synthase (FLS), dihydroflavonol 4-reductase (DFR), leucoanthocyanidin dioxygenase (LDOX), UDP-glycose flavonoid glycosyltransferase (UGFT), leucoanthocyanidin reductase (LAR) and anthocyanidin reductase (ANR). Although P. humilis is flavonoid-rich and has a great potential in the healthcare industry, less is known about the flavonoid biosynthesis in P. humilis. Therefore, it is necessary to study the flavonoid accumulation in P. humilis extensively to boost breeding of high-flavonoid varieties and develop new health-promoting products.
In the present study, the fruits of three P. humilis cultivars, which are widely cultivated and processed in China, were collected at five different developmental stages. The changes in total flavonoid content, flavonoid compositions, free radical scavenging activities and flavonoid biosynthetic gene expressions were investigated in P. humilis fruits during their development. Our results can be readily used in the accelerated development and improvement of this commercially valuable species.

2. Materials and Methods

2.1. Plant Materials and Chemicals

Fruits of three P. humilis cultivars (‘Nongda 3’, ‘Jinou 1’ and ‘Nongda 5’) were harvested from July to September in the Experimental Garden of Jinzhong University in 2021. Pruning and pest control were conducted according to standard cultivation procedures for each cultivar. The five developmental stages were the young-fruit stage (YFS, 30 d after flowering), pit-hardening stage (PHS, 60 d after flowering), fruit-enlargement stage (FES, 105 d after flowering), color-changing stage (CCS, 120 d after flowering) and fruit-ripening stage (FRS, 130 d after flowering), respectively (Figure 1).
At each developmental stage, 100 fruits from each cultivar (2 per plant) were randomly selected and harvested by hand. After removing the kernel, fruit samples were cut into small pieces and then stored at −80 °C for subsequent experiments. Sampling was repeated thrice.
Methanol (HPLC-grade), water and flavonoid standards were purchased from Sigma-Aldrich (Saint Louis, MO, USA), and formic acid and acetonitrile were purchased from Alltech Scientific (Beijing, China). The following chemical reagents were acquired from Tianjin Guangfu Fine Chemical Co., Ltd. (Tianjin, China): acetic acid, ferric chloride, hydrochloric acid, methanol, sodium carbonate and sodium acetate.

2.2. Extraction and Determination of Flavonoids

Extraction of flavonoids was conducted using an improved ethanol flux method [20]. Two grams ground fruit sample was put in 60 mL of 60% ethanol, and the mixture was heated at 90 °C for 2 h. The extraction was repeated thrice, and the filtrates were pooled. Determination of the total flavonoid content (TFC) was carried out following a colorimetry method [21]. Absorbance (510 nm) of the flavonoid extracts was recorded with a UV–visible spectrophotometer (UV-2450, Shimadzu Corporation, Kyoto, Japan). The calibration curve was established with rutin as the standard. The TFC of samples was expressed in milligram rutin equivalents (RE) per gram of fresh fruit weight (FW, mg/g).

2.3. Flavonoid Composition Determination

Flavonoids were extracted following a method developed by Fu et al. [16] with some modifications. Fruit samples (1 g) from different stages of development were ground in liquid nitrogen and then mixed with a water–methanol–formic acid solution (80:1:19, v/v/v) immediately. The mixture was first sonicated for 45 min at 45 °C and then centrifuged for 10 min at 20 °C under 12,000 rpm; the supernatant was collected and mixed with 5 mL of a methanol–formic acid–water solution before filtering through a Millipore membrane.
Qualitative analysis of flavonoids was carried out using an HPLC-DAD system (Agilent 1200, Palo Alto, CA, USA), following the methods developed by Wang et al. [14]. To separate different flavonoid components, a C18 column (250 × 4.6 mm i.d.; particle size, 5 µm) was used. The binary mobile phase comprised acetic acid (2%, solvent A) and acetonitrile (solvent B). The gradient program was set as 0% to 40% solvent B for 60 min; 40% to 70% solvent B for 5 min; and 70% to 0% solvent B for 10 min. The injection volume was set as 20 µL. For simultaneous monitoring of different flavonoid compounds, the wavelengths of the detector were set at 280, 360 and 520 nm, respectively. The retention time and spectra were compared with known standards to identify individual flavonoids. The amounts of flavonoid content can be calculated using each standard calibration curve equation.

2.4. Antioxidant Determination

Flavonoid extracts from the ethanol flux method were used for antioxidant determination. The scavenging activities of DPPH (2,2-diphenyl-1-picrylhydrazyl) were measured according to Li et al. [22], and absorbance at 517 nm was then determined with a UV-2450 spectrophotometer calibrated with a trolox standard curve. The ferric-reducing antioxidant capacity (FRAP) was measured according to the method of Zheng et al. [23] by using TPTZ (2,4,6-tripyridyls-triazine) solution, and absorbance at 593 nm was then determined with the spectrophotometer, and the trolox was used as the standard. The ABTS total free radical scavenging ability was measured according to the method developed by Pereira et al. [24] by using the 2,2-azo-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), and absorbance at 734 nm was then determined with the spectrophotometer, and the trolox was used as the standard. Antioxidant activity determination was repeated three times. The weight of each gram of fresh sample is expressed in mg trolox equivalent (mg TE/g).

2.5. Gene Expression Analysis

Fruit transcriptome data of P. humilis cultivar ‘Jinou 1’ were downloaded from NCBI under the accession number PRJNA417674, and nine flavonoid-synthesis-related candidate genes (ChCHS, ChCHI, ChF3H, ChFLS, ChDFR, ChLDOX, ChUFGT, ChLAR and ChANR) were screened. RNAs were prepared using the fruits of three cultivars at 5 different developmental stages (YFS, PHS, FES, CCS and FRS) using a Trizol RNA Extraction Kit (TaKaRa, China). The cDNAs were then synthesized using a high-capacity RNA-to-cDNA Kit (Applied Biosystems, Shanghai, China). Primer sequences were designed using Premier 5.0 software (PREMIER Bio-soft International, Palo Alto, CA, USA) (Table 1). Quantitative real-time PCR was performed following the method described by Han et al. [25]. The relative expression of each gene was calculated by the 2−ΔΔCt method [26]. Three independent biological replicates for each sample were conducted in the qRT-PCR experiment.

2.6. Statistical Analysis

Microsoft Excel (Version 2013) was used for statistical analyses, and correlation analyses were performed using Origin 2021 (OriginLab Corporation, Northampton, MA, USA). The differences among means were evaluated using Tukey’s multiple comparison test, and differences at p < 0.05 were considered statistically significant. The figures were generated using GraphPad prism 8.

3. Results

3.1. Changes in Total Flavonoid Content during Fruit Development

As shown in Table 1, at the initial sampling stage (YFS), cultivar ‘Jinou 1’ had the highest TFC (47.21 ± 1.01 mg/g RE·FW), followed by cultivars ‘Nongda 3’ (22.33 ± 0.88 mg/g RE·FW) and ‘Nongda 5’ (12.33 ± 0.92 mg/g RE FW). The TFCs of the three cultivars all declined rapidly until fruit ripening, and significant variations (p < 0.05) were exhibited between fruit developmental stages (Table 2). The TFCs of ripe fruits of the three cultivars varied from 7.23 to 11.94 mg/g RE·FW, and ‘Jinou 1’ (a red-fruited cultivar) had the highest fruit TFC, while ‘Nongda 5’ (a yellow-fruited cultivar) had the lowest TFC.

3.2. Flavonoid Composition Variation during Fruit Development

Thirteen flavonoid compounds were detected in the fruit extracts of the three P. humilis cultivars using HPLC-DAD (Figure 2). Expressed in fresh weight, most flavonoid compounds were similar in their accumulation patterns. In all three cultivars, fruit development was associated with decreasing concentrations of catechin (C), proanthocyanidin B1 (PA-B1), proanthocyanidin B2 (PA-B2), phloretin-2′-O-glucoside (PG), phloretin-2′,4′-O-diglucoside (PGD), quercetin-7-O-glucoside (Q7G), quercetin-7-O-acetylglucoside (Q7acG), quercetin-3-arabinoside (Q3A), myricetin (M) and quercetin (Q). Epicatechin (EC) and phloretin-2-O-xyloglucoside (PXG) concentrations remained unchanged or increased slightly during early development, decreasing afterwards until fruit harvest. Cyanidin-3-O-glucoside (C3G) accumulation varied across cultivars, and it was not present in ‘Nongda 5’ from YFS to FRS, whereas C3G concentration in ‘Nongda 3’ and ‘Jinou 1’ decreased slightly during early development before increasing as the fruits matured. In the mature fruits of ‘Nongda 3’, ‘Jinou 1’ and ‘Nongda 5’, four compounds were found to be the main flavonoids, including PA-B1, PA-B2, PG and PDG.

3.3. Antioxidant Activity Variation during Fruit Development

As shown in Table 3, fruits of the three P. humilis cultivars at the YFS showed the highest values of DPPH, FRAP and ABTS, while these values were the lowest in fruits at the stage of FRS. From YFS to PHS, antioxidant activities (DPPH, FRAP and ABTS) in fruits of the three P. humilis cultivars decreased slightly, while these values dropped significantly from PHS to FES (p < 0.05). The antioxidant activities of P. humilis fruits at each developing stage were all in the following order: ‘Jinou 1’ > ‘Nongda 3’ > ‘Nongda 5’ (Table 3). For all three cultivars, ABTS scavenging ability had the highest values, followed by FRAP and DPPH.

3.4. Expression Analysis of Flavonoid Biosynthetic Genes during Fruit Development

In order to reveal the flavonoid accumulation differences of the three P. humilis cultivars during fruit development, the expression of flavonoid-metabolism-related genes was quantitatively verified at five different developmental stages (Figure 3). Expression of flavonoid biosynthetic genes showed different patterns in three cultivars. For yellow-fruited cultivar ‘Nongda 5’, expression of all nine flavonoid biosynthetic genes showed a downward trend during fruit development; for dark-red-fruited cultivar ‘Jinou 1’, the anthocyanin biosynthetic genes (ChCHS, ChCHI, ChF3H, ChDFR, ChLDOX and ChUFGT) were upregulated as fruit ripened, while the expressions of ChFLS, ChLAR and ChANR were downregulated. For yellow-red cultivar ‘Nongda 3’, the expression patterns of ChCHS, ChCHI and ChF3H decreased gradually from YFS to FES, which was similar to those of cultivar ‘Nongda 5’, while the expressions of these three genes increased gradually from CCS to FRS, which was similar to those of cultivar ‘Jinou 1’. From CCS to FRS, fruits of ‘Jinou 1’ and ‘Nongda 3’ started to accumulate C3G (Figure 1 and Figure 2); therefore, the expressions of ChDFR, ChLDOX and ChUFGT in these two cultivars were extremely upregulated (Figure 3). Interestingly, the expression level of ChUFGT at FRS in ‘Nongda 3’ was higher than that in ‘Jinou 1’; however, ‘Jinou 1’ accumulated more C3G than ‘Nongda 3’ (Figure 1 and Figure 2).

3.5. Correlation Analysis

By analyzing the correlations among the total flavonoid contents, flavonoid compositions, antioxidant abilities (DPPH, FRAP, ABTS) and expression of flavonoid biosynthetic genes (Figure 4), it was found that the TFCs of P. humilis fruits were very significantly positively correlated with antioxidant indices (DPPH, FRAP, ABTS) and the contents of catechin, PA-B1,PG, PDG and myricetin (p < 0.01). Except for the significant negative correlation with ChLAR, the TFCs had no significant correlation with the expression of most flavonoid-related genes. The expression of ChCHS was significantly positively correlated with ChCHI, ChF3H, ChDFR and ChLDOX. Moreover, the expression of ChF3H was very significantly positively correlated with catechin, PA-B1, PA-B2, Q7G and Q7acG.

4. Discussion

Flavonoids are polyphenol compounds important in plant–environment interactions, and the biosynthesis of flavonoids is upregulated in response to various biotic (pathogens, wildlife, etc.) and abiotic (UV radiation, nitrogen/phosphorus depletion, cold, salinity, drought, etc.) stresses [27,28]. In this study, the fruit TFCs of three cultivars declined rapidly from YFS to FRS. Our results agree with those from several previous studies on other fruits, which demonstrated the rapid accumulation of major flavonoids during early development before a drastic decrease in the later stages [29,30,31]. P. humilis fruits appear before the emergence of leaves and new shoots; thus, the fruits at YFS are exposed to intensive sunlight, and a high TFC in the young fruit might serve as a main factor that can protect the fruit against damage by UV light. Other reports suggested that high content of flavonoids in young fruits might also serve as a deterrent to animal feeding, since pits or seeds have not been fully developed yet and are not ready for dispersal [32]. Fruit ripening refers to changes that make fruits attractive to humans and other seed-dispersing animals, including the decline in fruit TFC [33].
The fruit TFCs exhibited significant cultivar variations (p < 0.05) at every fruit developmental stage examined in this study. Overall, ‘Jinou 1’ (a red-fruited cultivar) had the highest fruit TFC, while ‘Nongda 5’ (a yellow-fruited cultivar) had the lowest TFC. Generally speaking, cultivars with dark fruit color (purple, red or black) have significantly higher TFC than light-colored cultivars (green, yellow or white) [34,35]. Although more research is necessary to determine the exact cause of such differences, phenotype is a potential selection criterion for high-TFC P. humilis cultivars.
The TFCs of mature P. humilis fruits were higher than those of sweet cherry (Prunus avium) cultivars and tart cherries (Prunus cerasus) (0.5–0.7 mg/g RE·FW) [36]. Flavonoids are the main contributors of plant antioxidant capacity and have considerable applications in the development of nutraceutical products [37]. Thus, the high flavonoid content of P. humilis fruit suggests that this is a promising source of natural antioxidants. Moreover, the characterization of TFC variation throughout fruit development will help to optimize fruit harvest time of P. humilis for maximum production of flavonoids in fruits and subsequent extraction for the food and nutraceutical industries.
Thirteen flavonoid compounds in total were detected in fruits of P. humilis, and twelve of them decreased during fruit development in all three cultivars; the exception was C3G. C3G was not present in cultivar ‘Nongda 5’ from YFS to FRS, while it accumulated in ripe fruits of cultivar ‘Nongda 3’ and ‘Jinou 1’. C3G, as a major anthocyanin in mature fruits, is involved in plant–animal interactions, helping to attract animals to fruits by providing visual and olfactory signals [33]. C3G is also found in many other similarly colored fruits, such as blackberries, blueberries, cherries, grapes and plums [38]. Given the fact that ‘Nongda 5’ fruits are completely yellow, both the yellow-red ‘Nongda 3’ and the dark-red ‘Jinou 1’ fruits were expected to have relatively higher C3G concentrations.
DPPH, ABTS and FRAP methods were commonly used to determine the antioxidant activities of P. humilis fruit extracts. From the correlation analysis, it was found that the antioxidant abilities were very significantly correlated with the TFCs and the content of catechin, PA-B1, PG, PDG and M; therefore, these flavonoid compounds contribute the most to the antioxidant abilities and TFCs of P. humilis fruit. Similar results were reported in a newly published article, which stated that the proanthocyanidins (mostly PA-B1) were the main antioxidant active components of P. humilis fruit [39]. PG and PDG are powerful antioxidants in apple and can modulate inflammatory responses, lower blood glucose levels and also promote other aspects of health [40]. However, due to the limitation of antioxidant assay in vitro, further studies need to be conducted in vivo to verify the antioxidant abilities and other health-promoting functions of this species.
Gene expression analysis revealed that the flavonoid biosynthetic genes had different expression patterns in the three cultivars. In the red-fruited cultivar ‘Jinou 1’, the expression levels of ChCHS, ChCHI, ChF3H, ChDFR, ChLDOX and ChUFGT increased gradually with fruit ripening, while all flavonoid-related genes in the yellow-fruited cultivar ‘Nongda 5’ decreased throughout the whole process of fruit ripening. Similar results were found in sweet cherries during fruit development, and in that study, UFGT was suggested to be the key gene causing color differences between red and yellow cherry fruits [41]. In addition, another report revealed that the anthocyanin content in mature P. humilis fruit was significantly positively correlated with ChCHS, ChFLS and ChUFGT expression [42]. Our findings were inconsistent with the previous results that expression of CHS and CHI genes was positively correlated with flavonoid accumulation in citrus and apricot [43,44]. Although ‘Nongda 5’ had low expression of flavonoid biosynthetic genes and relatively lower total flavonoid contents compared to ‘Jinou 1’ and ‘Nongda 3’, its antioxidant abilities were higher than many fruit species [45], suggesting there might be some other bioactive compounds that contribute to its high antioxidant abilities.

5. Conclusions

In this study, comparative analysis revealed that the total flavonoid contents and antioxidant activities of fruits from three P. humilis cultivars decreased gradually during fruit development, together with the content of most flavonoid compounds. Thirteen flavonoid compounds were found in fruits of three cultivars; furthermore, cyanidin-3-O-glucoside contributed to the coloration of P. humilis fruits, and it accumulated only in the red-fruited cultivars ‘Jinou 1’ and ‘Nongda 3’, while it was not detected in the developing fruits of the yellow-fruited cultivar ‘Nongda 5’. The antioxidant capacities (DPPH, FRAP and ABTS) of P. humilis fruits showed significantly positive correlation with the TFCs and the concentrations of the main flavonoid compounds such as catechin, proanthocyanidin B1, PD and PDG. Moreover, the flavonoid biosynthetic genes had different expression patterns in the three cultivars. The expression levels of all flavonoid-related genes in cultivar ‘Nongda 5’ decreased gradually during fruit development, while most flavonoid-related genes increased gradually in the developing fruits of cultivar ‘Jinou 1’. The results from our study will be useful for a deeper understanding of the molecular mechanisms of flavonoid accumulation and for facilitating targeted breeding of this fruit species for superior cultivars.

Author Contributions

Conceptualization, H.H.; methodology, X.M.; investigation, S.L. and L.Z.; resources, H.H.; writing—original draft, H.H.; writing—review and editing, N.L. and X.M.; project administration, J.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Jinzhong University Doctoral Research Fund (2020JZU01).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All the data relevant to this work are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hossain, M.A.; Rahman, S.M.M. Total phenolics, flavonoids and antioxidant activity of tropical fruit pineapple. Food Res. Int. 2011, 44, 672–676. [Google Scholar] [CrossRef]
  2. Makita, C.; Chimuka, L.; Steenkamp, P.; Cukrowska, E.; Madala, E. Comparative analyses of flavonoid content in Moringa oleifera and Moringa ovalifolia with the aid of UHPLC-qTOF-MS fingerprinting. South Afr. J. Bot. 2016, 105, 116–122. [Google Scholar] [CrossRef]
  3. Spencer, J.P.E. The impact of fruit flavonoids on memory and cognition. Br. J. Nutr. 2010, 104, S40. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, Y.; Haskell-Ramsay, C.; Gallegos, J.L.; Lodge, J.K. Effects of chronic consumption of specific fruit (berries, cherries and citrus) on cognitive health: A systematic review and meta-analysis of randomised controlled trials. Eur. J. Clin. Nutr. 2022, 77, 7–22. [Google Scholar] [CrossRef] [PubMed]
  5. Bertoia, M.L.; Rimm, E.B.; Mukamal, K.J.; Hu, F.B.; Willett, W.C.; Cassidy, A. Dietary flavonoid intake and weight maintenance: Three prospective cohorts of 124086 US men and women followed for up to 24 years. BMJ 2016, 352, i17. [Google Scholar] [CrossRef]
  6. Wu, E.; Ni, J.; Zhou, W.; You, L.; Tao, L.; Xie, T. Consumption of fruits, vegetables, and legumes are associated with overweight/obesity in the middle- and old-aged Chongqing residents: A case-control study. Medicine 2022, 101, e29749. [Google Scholar] [CrossRef]
  7. Hassanpour, H.; Yousef, H.; Jafar, H.; Mohammad, A. Antioxidant capacity and phytochemical properties of cornelian cherry (Cornus mas L.) genotypes in Iran. Sci. Hortic. 2011, 129, 459–463. [Google Scholar] [CrossRef]
  8. Wang, P.; Mu, X.; Gao, Y.G.; Zhang, J.; Du, J. Successful induction and the systematic characterization of tetraploids in Cerasus humilis for subsequent breeding. Sci Hortic. 2020, 256, 109216. [Google Scholar] [CrossRef]
  9. Mu, X.; Wang, P.; Du, J.; Gao, Y.G.; Zhang, J. Comparison of fruit organic acids and metabolism-related gene expression between Cerasus humilis (Bge.) Sok and Cerasus glandulosa (Thunb.) Lois. PLoS ONE 2018, 13, e0196537. [Google Scholar] [CrossRef]
  10. Song, X.S.; Shang, Z.W.; Yin, Z.P.; Ren, J.; Sun, M.C.; Ma, X.L. Mechanism of xanthophyll-cycle-mediated photoprotection in Cerasus humilis seedlings under water stress and subsequent recovery. Photosynthetica 2011, 49, 523–530. [Google Scholar] [CrossRef]
  11. Dong, X.; Liu, L.; Li, J.; Du, J.; Wang, P.; Zhang, J. Soil and Water Conservation Function of Cerasus humilis in Hilly-gully Region of Loess Plateau. Bull. Soil Water Conserv. 2016, 36, 242–247. [Google Scholar]
  12. Guo, C.; Wang, P.; Zhang, J.; Guo, X.; Mu, X.; Du, J. Organic acid metabolism in Chinese dwarf cherry [Cerasus humilis (Bge.) Sok.] is controlled by a complex gene regulatory network. Front. Plant Sci. 2022, 13, 982112. [Google Scholar] [CrossRef] [PubMed]
  13. Li, W.D.; Li, O.; Mo, C.; Jiang, Y.S.; He, Y.; Zhang, A.R.; Chen, L.M.; Jin, J.S. Mineral element composition of 27 Chinese dwarf cherry (Cerasus humilis (Bge.) Sok.) genotypes collected in China. J. Hortic. Sci. Biotechnol. 2014, 89, 674–678. [Google Scholar] [CrossRef]
  14. Wang, P.; Mu, X.; Du, J.; Gao, Y.G.; Bai, D.; Jia, L.T.; Zhang, J.; Ren, H.; Xue, X. Flavonoid content and radical scavenging activity in fruits of Chinese dwarf cherry (Cerasus humilis) genotypes. J. For. Res. 2018, 29, 55–63. [Google Scholar] [CrossRef]
  15. Fu, H.; Qiao, Y.; Wang, P.; Mu, X.; Zhang, J.; Fu, B.; Du, J. Changes of bioactive components and antioxidant potential during fruit development of Prunus humilis Bunge. PLoS ONE 2021, 16, e0251300. [Google Scholar] [CrossRef]
  16. Fu, H.; Mu, X.; Wang, P.; Zhang, J.; Fu, B.; Du, J. Fruit quality and antioxidant potential of Prunus humilis Bunge accessions. PLoS ONE 2020, 15, e0244445. [Google Scholar] [CrossRef]
  17. Li, W.D.; Li, O.; Zhang, A.; Li, L.; Hao, J.H.; Jin, S.J.; Yin, S.J. Genotypic diversity of phenolic compounds and antioxidant capacity of Chinese dwarf cherry (Cerasus humilis (Bge.) Sok.) in China. Sci. Hortic. 2014, 175, 208–213. [Google Scholar] [CrossRef]
  18. Qiao, F.; Zhang, K.M.; Zhou, L.Y.; Qiu, Q.S.; Chen, Z.N.; Lu, Y.H.; Wang, L.H.; Geng, G.G.; Xie, H.C. Analysis of flavonoid metabolism during fruit development of Lycium chinense. J. Plant Physiol. 2022, 279, 153856. [Google Scholar] [CrossRef]
  19. Nabavi, S.M.; Šamec, D.; Tomczyk, M.; Milella, L.; Russo, D.; Habtemariam, S.; Suntar, I.; Rastrelli, L.; Daglia, M.; Xiao, J.; et al. Flavonoid biosynthetic pathways in plants: Versatile targets for metabolic engineering. Biotechnol. Adv. 2020, 38, 107316. [Google Scholar] [CrossRef]
  20. Van Acker, S.A.; Van Den, D.J.; Tromp, M.N.; Bast, A. Structural aspects of antioxidant activity of flavonoids. Free Radic. Biol. Med. 2011, 35, 331–342. [Google Scholar] [CrossRef]
  21. Sabli, F.; Mohamed, M.; Rahmat, A.; Ibrahim, H.A.; Bakar, M.F.A. Antioxidant properties of selected Etlingera and Zingiber species (Zingiberaceae) from Borneo Island. Int. J. Biochem. 2012, 6, 1–9. [Google Scholar] [CrossRef]
  22. Li, J.E.; Fan, S.T.; Qiu, Z.H.; Li, C.; Nie, S.P. Total flavonoids content, antioxidant and antimicrobial activities of extracts from Mosla chinensis Maxim. cv. Jiangxiangru. LWT Food Sci. Technol. 2015, 64, 1022–1027. [Google Scholar] [CrossRef]
  23. Zheng, H.Z.; Kim, Y.I.; Chung, S.K. A profile of physicochemical and antioxidant changes during fruit growth for the utilisation of unripe apples. Food Chem. 2012, 131, 106–110. [Google Scholar] [CrossRef]
  24. Pereira, C.; López-Corrales, M.; Serradilla, M.J.; Villalobos, M.G.; Ruiz-Moyano, S.; Martín, A. Influence of ripening stage on bioactive compounds and antioxidant activity in nine fig (Ficus carica L.) varieties grown in Extremadura, Spain. J. Food Compos. Anal. 2017, 64, 203–212. [Google Scholar] [CrossRef]
  25. Han, H.; Mu, X.; Wang, P.; Wang, Z.; Fu, H.; Gao, Y.G.; Du, J. Identification of LecRLK gene family in Cerasus humilis through genomic-transcriptomic data mining and expression analyses. PLoS ONE 2021, 16, e0254535. [Google Scholar] [CrossRef]
  26. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  27. Gould, K.S.; Lister, C. Flavonoid function in plants. In Flavonoids: Chemistry, Biochemistry and Applications; Andersen, M., Markham, K.R., Eds.; CRC Press: Boca Raton, FL, USA, 2006; pp. 397–441. [Google Scholar]
  28. Ferdinando, M.D.; Brunetti, C.; Fini, A.; Tattini, M. Flavonoids as Antioxidants in Plants Under Abiotic Stresses. In Abiotic Stress Responses in Plants: Metabolism, Productivity and Sustainability; Parvaiz, A., Prasad, M.N.V., Eds.; Springer Press: New York, NY, USA, 2012; pp. 159–179. [Google Scholar]
  29. Dragović-Uzelac, V.; Levaj, B.; Mrkic, V.; Bursac, D.; Boras, M. The Content of Polyphenols and Carotenoids in Three Apricot Cultivars Depending on Stage of Maturity and Geographical Region. Food Chem. 2007, 102, 966–975. [Google Scholar] [CrossRef]
  30. Choi, S.H.; Ahn, J.B.; Kim, H.J.; Im, N.K.; Kozukue, N.; Levin, C.E.; Friedman, M. Changes in Free Amino Acid, Protein, and Flavonoid Content in Jujube (Ziziphus jujube) Fruit during Eight Stages of Growth and Antioxidative and Cancer Cell Inhibitory Effects by Extracts. J. Agric. Food Chem. 2012, 60, 10245–10255. [Google Scholar] [CrossRef] [PubMed]
  31. Elmastas, M.; Demir, A.; Gen, N.; Dlek, Ü.; Güne, M. Changes in flavonoid and phenolic acid contents in some Rosa species during ripening. Food Chem. 2017, 235, 154–159. [Google Scholar] [CrossRef]
  32. Simmonds, M.S.J. Flavonoid-insect interactions: Recent advances in our knowledge. Phytochemistry 2003, 64, 21–30. [Google Scholar] [CrossRef]
  33. Taiz, L.; Zeiger, E.; Møller, I.M.; Murphy, A. Plant Physiology and Development, 6th ed.; Oxford University Press: Oxford, UK, 2014; pp. 625–664. [Google Scholar]
  34. Liu, Y.; Liu, X.Y.; Zhong, F.; Tian, R.; Zhang, K.C.; Zhang, X.M.; Li, T.H. Comparative Study of Phenolic Compounds and Antioxidant Activity in Different Species of Cherries. J. Food Sci. 2011, 76, 633–638. [Google Scholar] [CrossRef] [PubMed]
  35. Harzallah, A.; Bhouri, A.M.; Amri, Z.; Soltana, H.; Hammami, M. Phytochemical Content and Antioxidant Activity of Different Fruit Parts Juices of Three Figs (Ficus carica L.) varieties grown in Tunisia. Ind. Crops Prod. 2016, 83, 255–267. [Google Scholar] [CrossRef]
  36. Prvulovic, D.; Popovic, M.; Malencic, D.; Ljubojevic, M.; Barac, G.; Ognjanov, V. Phenolic content and antioxidant capacity of sweet and sour cherries. Stud. Univ. Babes-Bolyai Chem. 2012, 57, 175–181. [Google Scholar]
  37. Celli, G.B.; Pereira-Netto, A.B.; Beta, T. Comparative analysis of total phenolic content, antioxidant activity, and flavonoids profile of fruits from two varieties of Brazilian cherry (Eugenia uniflora L.) throughout the fruit developmental stages. Food Res. Int. 2011, 44, 2442–2451. [Google Scholar] [CrossRef]
  38. Qin, L.; Zhang, J.; Qin, M. Protective effect of cyanidin 3-O-glucoside on beta-amyloid peptide-induced cognitive impairment in rats. Neurosci. Lett. 2013, 534, 285–288. [Google Scholar] [CrossRef]
  39. Zhang, Y.; Cui, Q.; Guo, C.; Zhang, X.; Liu, S.; Wang, X.; Zhao, J.; Zhao, Z.; Li, W. A rapid chemometrics model for antioxidant substance mining of Chinese dwarf cherry [Cerasus humilis (Bge.) Sok.] based on polyphenol profile and antioxidant capacity of 30 germplasms. Food Biosci. 2023, 53, 102795. [Google Scholar] [CrossRef]
  40. Gosch, C.; Halbwirth, H.; Stich, K. Phloridzin: Biosynthesis, Distribution and Physiological Relevance in Plants. Phytochemistry 2010, 71, 838–843. [Google Scholar] [CrossRef]
  41. Wang, Q.; Jing, L.; Xu, Y.; Zheng, W.; Zhang, W. Transcriptomic Analysis of Anthocyanin and Carotenoid Biosynthesis in Red and Yellow Fruits of Sweet Cherry (Prunus avium L.) during Ripening. Horticulturae 2023, 9, 516. [Google Scholar] [CrossRef]
  42. Yang, R.; Yang, Y.; Hu, Y.; Yin, L.; Qu, P.; Wang, P.; Mu, X.; Zhang, S.; Xie, P.; Cheng, C.; et al. Comparison of Bioactive Compounds and Antioxidant Activities in Differentially Pigmented Cerasus humilis Fruits. Molecules 2023, 28, 6272. [Google Scholar] [CrossRef]
  43. Wang, Y.; Li, J.; Xia, R. Expression of chalcone synthase and chalcone isomerase genes and accumulation of corresponding flavonoids during fruit maturation of Guoqing No. 4 satsuma mandarin (Citrus unshiu Marcow). Sci. Hortic. 2010, 125, 110–116. [Google Scholar] [CrossRef]
  44. Chen, Y.; Li, W.; Jia, K.; Liao, K.; Liu, L.; Fan, G.; Zhang, S.; Wang, Y. Metabolomic and transcriptomice analyses of flavonoid biosynthesis in apricot fruits. Front. Plant Sci. 2023, 14, 1210309. [Google Scholar] [CrossRef] [PubMed]
  45. Gu, C.; Howell, K.; Dunshea, F.R.; Suleria, H.A.R. LC-ESI-QTOF/MS Characterisation of Phenolic Acids and Flavonoids in Polyphenol-Rich Fruits and Vegetables and Their Potential Antioxidant Activities. Antioxidants 2019, 8, 405. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 09 01040 g001
Figure 1. Fruits from three Prunus humilis cultivars, ‘Nongda 3’ (A), ‘Jinou 1’ (B) and ‘Nongda 5’ (C), at five different developmental stages: YFS, young-fruit stage; PHS, pit-hardening stage; FES, fruit-enlargement stage; CCS, color-changing stage; and FRS, fruit-ripening stage. Bar = 2.0 cm.
Figure 1. Fruits from three Prunus humilis cultivars, ‘Nongda 3’ (A), ‘Jinou 1’ (B) and ‘Nongda 5’ (C), at five different developmental stages: YFS, young-fruit stage; PHS, pit-hardening stage; FES, fruit-enlargement stage; CCS, color-changing stage; and FRS, fruit-ripening stage. Bar = 2.0 cm.
Horticulturae 09 01040 g001
Horticulturae 09 01040 g002
Figure 2. Accumulation of different flavonoid components in the fruits of the three Prunus humilis cultivars at five different developmental stages: 1, YFS (young-fruit stage); 2, PHS (pit-hardening stage); 3, FES (fruit-enlargement stage); 4, CCS (color-changing stage); and 5, FRS (fruit-ripening stage). The values are shown as the means ± S.D. (n = 3). Error bars represent standard deviations of means.
Figure 2. Accumulation of different flavonoid components in the fruits of the three Prunus humilis cultivars at five different developmental stages: 1, YFS (young-fruit stage); 2, PHS (pit-hardening stage); 3, FES (fruit-enlargement stage); 4, CCS (color-changing stage); and 5, FRS (fruit-ripening stage). The values are shown as the means ± S.D. (n = 3). Error bars represent standard deviations of means.
Horticulturae 09 01040 g002
Horticulturae 09 01040 g003
Figure 3. The flavonoid biosynthetic pathway. Enzyme names are shown in red letters, and the heatmap of coding genes was built based on their relative expression levels. Red boxes represent high expression and blue boxes represent low expression. CHS, CHI, F3H, FLS, DFR, LDOX, UFGT, LAR and ANR represent chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase, flavanol synthase, dihydroflavonol 4-reductase, leucoanthocyanidin dioxygenase, UDP-glycose flavonoid glycosyltransferase, leucoanthocyanidin reductase and anthocyanidin reductase, respectively. YFS, PHS, FES, CCS and FRS, represent young-fruit stage, pit-hardening stage, fruit-enlargement stage, color-changing stage and fruit-ripening stage, respectively.
Figure 3. The flavonoid biosynthetic pathway. Enzyme names are shown in red letters, and the heatmap of coding genes was built based on their relative expression levels. Red boxes represent high expression and blue boxes represent low expression. CHS, CHI, F3H, FLS, DFR, LDOX, UFGT, LAR and ANR represent chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase, flavanol synthase, dihydroflavonol 4-reductase, leucoanthocyanidin dioxygenase, UDP-glycose flavonoid glycosyltransferase, leucoanthocyanidin reductase and anthocyanidin reductase, respectively. YFS, PHS, FES, CCS and FRS, represent young-fruit stage, pit-hardening stage, fruit-enlargement stage, color-changing stage and fruit-ripening stage, respectively.
Horticulturae 09 01040 g003
Horticulturae 09 01040 g004
Figure 4. Correlation analysis results of the total flavonoid contents, flavonoid components, antioxidant abilities (DPPH, FRAP, ABTS) and expression of flavonoid biosynthetic genes. C3G: cyanidin-3-O-glucoside; C: catechin; EC: epicatechin; PA-B1: proanthocyanidin B1; PA-B2: proanthocyanidin B2; PXG: phloretin-2-O-xyloglucoside; PG: phloretin-2-O-glucoside; PDG: phloretin-2′,4′-O-diglucoside; Q3G: quercetin-3-O-glucoside; Q7G: quercetin-7-O-glucoside; Q7AcG: quercetin-7-O-acetylglucoside; Q3A: quercetin-3-O-arabinoside; M: myricetin; Q: quercetin; ChCHS: chalcone synthase; ChCHI: chalcone isomerase; ChF3H: flavanone 3-hydroxylase; ChDFR: dihydroflavonol 4-reductase; ChLDOX: leucoanthocyanidin dioxygenase; ChUFGT: UDP-glycose flavonoid glycosyltransferase; ChFLS: flavanol synthase; ChLAR: leucoanthocyanidin reductase; ChANR: anthocyanidin reductase; DPPH: 1,1-diphenyl-2-picryl-hydrazyl; FRAP: ferric-reducing antioxidant power; ABTS: 2,2’-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid; TFC: total flavonoid content.
Figure 4. Correlation analysis results of the total flavonoid contents, flavonoid components, antioxidant abilities (DPPH, FRAP, ABTS) and expression of flavonoid biosynthetic genes. C3G: cyanidin-3-O-glucoside; C: catechin; EC: epicatechin; PA-B1: proanthocyanidin B1; PA-B2: proanthocyanidin B2; PXG: phloretin-2-O-xyloglucoside; PG: phloretin-2-O-glucoside; PDG: phloretin-2′,4′-O-diglucoside; Q3G: quercetin-3-O-glucoside; Q7G: quercetin-7-O-glucoside; Q7AcG: quercetin-7-O-acetylglucoside; Q3A: quercetin-3-O-arabinoside; M: myricetin; Q: quercetin; ChCHS: chalcone synthase; ChCHI: chalcone isomerase; ChF3H: flavanone 3-hydroxylase; ChDFR: dihydroflavonol 4-reductase; ChLDOX: leucoanthocyanidin dioxygenase; ChUFGT: UDP-glycose flavonoid glycosyltransferase; ChFLS: flavanol synthase; ChLAR: leucoanthocyanidin reductase; ChANR: anthocyanidin reductase; DPPH: 1,1-diphenyl-2-picryl-hydrazyl; FRAP: ferric-reducing antioxidant power; ABTS: 2,2’-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid; TFC: total flavonoid content.
Horticulturae 09 01040 g004
Table 1. Primers for quantitative real-time PCR.
Table 1. Primers for quantitative real-time PCR.
P. humilis Gene IDP. humilis Gene NameForward PrimerReverse Primer
CL2555.Contig1ChCHSTACCAACAAGGGTGTTTCGCGTGATCTCCGAGCACACAAC
Unigene14928ChCHIGAGGAGGAAGCCTTGGAGAATCCTCCTTCCCTTCAGTGTG
Unigene3562ChF3HTACAGGGAGAAGCTGTGCAATCACCTCTCTCCATCCCTCA
Unigene6640ChDFRTGTCGAAGAGCACCAGAAGTGGCCAATCACAAGAGTTGGG
Unigene14860ChLDOXGGAAGGCTGGAGAAGGAAGTTGAGCTTCAACACCAAGTGC
Unigene6233ChUFGTTGTTTGATGTGGCTGATGGCCGTCGGTAATCAAGCAGGTG
Unigene5990ChLARTGGCATCTCTGTGGGAGAAGTTTCCGGTATGCGGTTCTCT
Unigene7152ChANRGAGGACCCTGAGAACGACATTCGTTCTCGTCTGTGACCAA
Unigene17057ChFLSGAGTTGAGGTCGTCATTGCCTCAAGGACCCTCCCATGAAC
-ChActinGCAGCGACTGAAGACATACAGTGGCATTAGCAAGTTCCTC
Table 2. Total flavonoid changes in Prunus humilis fruits during fruit growth.
Table 2. Total flavonoid changes in Prunus humilis fruits during fruit growth.
Developmental StagesNongda 3
(mg/g RE·FW)		Jinou 1
(mg/g RE·FW)		Nongda 5
(mg/g RE·FW)
YFS22.33 ± 0.88 a47.21 ± 1.01 a12.33 ± 0.92 a
PHS16.98 ± 0.99 b24.33 ± 1.56 b9.97 ± 1.05 b
FES12.56 ± 0.67 c20.65 ± 0.93 c9.56 ± 0.98 b
CCS11.43 ± 0.33 cd13.23 ± 1.23 d9.21 ± 0.65 b
FRS10.00 ± 0.42 e11.94 ± 0.26 de7.23 ± 0.32 c
YFS, PHS, FES, CCS and FRS represent young-fruit stage, pit-hardening stage, fruit-enlargement stage, color-changing stage and fruit-ripening stage, respectively. The values are shown as the means ± S.D. (n = 3). The different lowercase letters within the same columns represent significant differences at p < 0.05.
Table 3. Antioxidant activity changes in Prunus humilis fruits during fruit growth.
Table 3. Antioxidant activity changes in Prunus humilis fruits during fruit growth.
CultivarDevelopmental StagesDPPH (mg TE/g)FRAP (mg TE/g) ABTS (mg TE/g)
Nongda 3YFS28.25 ± 0.39 a53.54 ± 0.77 a78.03 ± 1.01 a
PHS23.22 ± 0.41 b45.02 ± 0.59 b68.41 ± 0.74 b
FES6.13 ± 0.20 c14.73 ± 0.34 c31.23 ± 0.57 c
CCS4.10 ± 0.16 d10.88 ± 0.44 d9.82 ± 0.46 d
FRS3.33 ± 0.18 e9.07 ± 0.50 e8.18 ± 0.37 e
Jinou 1YFS36.21 ± 0.53 a88.14 ± 1.28 a121.02 ± 2.04 a
PHS35.88 ± 0.62 a87.92 ± 1.52 a120.41 ± 1.98 a
FES7.23 ± 0.14 b18.31 ± 0.55 b43.23 ± 0.63 b
CCS5.12 ± 0.11 c16.80 ± 0.47 c14.82 ± 0.58 c
FRS4.04 ± 0.22 d11.23 ± 0.53 d12.18 ± 0.49 d
Nongda 5YFS23.72 ± 0.60 a27.21 ± 0.57 a60.01 ± 1.04 a
PHS19.65 ± 0.59 b25.76 ± 0.55 b57.65 ± 0.89 b
FES5.72 ± 0.23 c12.23 ± 0.45 c23.31 ± 0.58 c
CCS3.53 ± 0.14 d7.92 ± 0.43 d7.44 ± 0.45 d
FRS2.84 ± 0.12 e6.88 ± 0.46 e6.57 ± 0.46 e
YFS, PHS, FES, CCS and FRS represent young-fruit stage, pit-hardening stage, fruit-enlargement stage, color-changing stage and fruit-ripening stage, respectively. The values are shown as the means ± S.D. (n = 3). The different lowercase letters within the same columns represent significant differences at p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Han, H.; Zhang, L.; Liu, S.; Li, N.; Huo, J.; Mu, X. Temporal Changes in Flavonoid Components, Free Radical Scavenging Activities and Metabolism-Related Gene Expressions during Fruit Development in Chinese Dwarf Cherry (Prunus humilis). Horticulturae 2023, 9, 1040. https://doi.org/10.3390/horticulturae9091040

AMA Style

Han H, Zhang L, Liu S, Li N, Huo J, Mu X. Temporal Changes in Flavonoid Components, Free Radical Scavenging Activities and Metabolism-Related Gene Expressions during Fruit Development in Chinese Dwarf Cherry (Prunus humilis). Horticulturae. 2023; 9(9):1040. https://doi.org/10.3390/horticulturae9091040

Chicago/Turabian Style

Han, Hongyan, Lingjuan Zhang, Shan Liu, Na Li, Jianxin Huo, and Xiaopeng Mu. 2023. "Temporal Changes in Flavonoid Components, Free Radical Scavenging Activities and Metabolism-Related Gene Expressions during Fruit Development in Chinese Dwarf Cherry (Prunus humilis)" Horticulturae 9, no. 9: 1040. https://doi.org/10.3390/horticulturae9091040

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop