Next Article in Journal
Exogenous Treatments to Enhance Splice-Grafted Watermelon Survival
Previous Article in Journal
Influence of Light Conditions and Medium Composition on Morphophysiological Characteristics of Stevia rebaudiana Bertoni In Vitro and In Vivo
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 7
Issue 7
10.3390/horticulturae7070196
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf

by
Yang Lu
1,2,†,
Shuangxia Luo
1,†,
Na Li
1,
Qiang Li
1,
Wenchao Du
1,
Weiwei Zhang
3,
Ping Yu
1,
Shuxin Xuan
1,
Yanhua Wang
1,
Jianjun Zhao
1,
Xueping Chen
1,* and
Shuxing Shen
1,*
1
Key Laboratory for Vegetable Germplasm Enhancement and Utilization of Hebei, Collaborative Innovation Center of Vegetable Industry in Hebei, College of Horticulture, Hebei Agricultural University, Baoding 071000, China
2
Hebei University R&D Center for Sericulture and Specialty Enabling Technologies, Institute of Sericulture, Chengde Medical University, Chengde 067000, China
3
College of Life Sciences, Hebei Agricultural University, Baoding 071000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2021, 7(7), 196; https://doi.org/10.3390/horticulturae7070196
Submission received: 17 May 2021 / Revised: 8 July 2021 / Accepted: 12 July 2021 / Published: 16 July 2021
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
Eggplant is a vegetable crop with high economic value that is cultivated worldwide. The dwarf mutant is an important germplasm material that has been extensively used in crop breeding. However, no eggplant dwarf mutants have been reported, and little is known regarding the genes responsible for dwarfism in eggplant. In this study, we isolated an eggplant dwarf mutant (dwf) from an ethyl methyl sulfonate (EMS)-induced mutant library. Genetic analysis revealed that dwf was caused by a single recessive gene. A candidate gene SmCPR1, encoding cytochrome P450 reductases (CPR1), was identified by bulked segregant analysis (BSA). Mutation from G to A at 8216 bp of SmCPR1 resulted in mutation of the amino acid from valine to isoleucine. The results of KASP and Sanger sequencing further support the conclusion that SmCPR1 is a candidate gene responsible for the dwarfism of dwf. Moreover, the activity of SmCPR1 was significantly increased in dwf, which might be a response to dwarfism in dwf.

1. Introduction

Eggplant (Solanum melongena L.) is a vegetable crop that is cultivated worldwide, and China is the largest eggplant producer in the world (http://www.fao.org/faostat/en/, 10 December 2020). Plant height of eggplant affects the planting density and fruit coloring especially under protected cultivation. Larger plants increase the cost of labor as well as water and fertilizer inputs in production management. Dwarfism is a desirable trait in eggplant breeding that confers higher lodging resistance and allows simplified management and harvest [1,2,3].
Dwarf mutants have been used as important germplasms in crop breeding since the Green Revolution. The cultivation of dwarf cultivars has been successfully applied in wheat [4,5], maize [6,7], rice [8,9], and other crops [10,11]. However, the use of dwarf germplasms for eggplant breeding has largely been lagging. Therefore, there is a great need to create or discover dwarf materials in eggplant.
Here, we isolated a dwarf mutant, dwf, from an ethyl methyl sulfonate (EMS) mutant library in inbred lines ‘14–345’. Genetic analysis showed that the dwarfism of dwf was controlled by a signal recessive gene. We discovered by Mutmap and KASP that the mutation responsible for the dwarfism might be a non-synonymous base pair change in SmCPR1. As compared with wild type, dwf had significantly increased NADPH-cytochrome P450 reductase (CPR1) activity.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

The dwarf mutant dwf was isolated from a mutant library generated by ethyl methane sulfonate (EMS) mutagenesis from the inbred line ‘14–345’. The plants were grown in the greenhouse of Hebei Agricultural University.

2.2. Genetic Analysis

The dwf mutant was crossed with ‘14–345’ reciprocally. F1 plants were self-pollinated to generate F2 populations for genetic analysis. The numbers of dwarf plants and plants with normal plant height were counted separately. The chi-square test was used for genetic analysis with SPSS.

2.3. Candidate Gene Identification Using BSA-Seq

The bulked segregation analysis (BSA) strategy was employed for quick identification of molecular markers linked with the dwarf phenotype. Young leaves of WT and dwf were sampled for DNA extraction using the CTAB-based method. Equal amounts of DNA from 30 dwarf and 30 wild-type plants were bulked to generate the dwarf bulk (aa) and normal bulk (AA or Aa). Paired-end sequencing was performed on an Illumina HiSeqTM PE150. High-quality clean reads were obtained from raw reads by removing the data ① with ≥10% unidentified nucleotides (N), ② with >50% bases having Phred quality <5, ③ with >10 nt aligned to the adapter, allowing ≤10% mismatches, and ④ putative PCR duplicates generated by PCR amplification during library construction. Then, the clean data were aligned to the reference genome (https://www.ncbi.nlm.nih.gov/genome/?term=Solanum+melongena, 28 August 2018) by (Burrows–Wheeler Aligner (BWA) [12]. The alignment files were converted to BAM files using SAMtools, GATK3.8, and ANNOVAR [13,14,15] and were used for SNP/InDel detection and annotation. We used the wild type as the reference and to determine the read number for the parent’s genotype or the dwarf genotype in the offspring pool. Then, the ratio of the number of different reads to the total number was calculated, which is the SNP/InDel index of the base sites. The average of all SNP/InDel indices in each window was used as the SNP/InDel index for this window. Usually, we applied a window size of 1 Mb and a step size of 1 kb as default settings to reflect the distribution of the SNP index. The difference in the SNP/InDel index of the two pools was calculated as the △(SNP/InDel index). At the 95% confidence level, △(SNP/InDel index) > 0.5 was used as the condition, and the genes that caused stop/loss, stop/gain, nonsynonymous mutation, or variable splicing were selected as candidate genes. The library preparation and sequencing were conducted by the Novogene Technology Company in Beijing, China.

2.4. Verification of the Candidate SNP Genotype

Sixty-four M3 plants, 118 F2 plants, 10 F1 plants, three dwf, and three WT were used in the genotypic assay by Kompetitive Allele-Specific PCR (KASP). Specific primers flanking the candidate SNPs were designed and used for confirmation of the candidate SNPs by Sanger sequencing. A fragment of 601 bp including the candidate SNP in the middle was used to perform PCR amplification (forward primer 5′→3′ AGAGAGATAAAGGATCAATGGAGTC; reverse primer 5′→3′ CTCTCCACTGTCTCACCTACTACC). The PCR product was purified using a kit (Sangon B518141) and sequenced at 3730XL (Life Technologies, South San Francisco, CA, USA). The data were analyzed using sequence analysis software and mapped using SeqMan software 12.2.

2.5. Validation of Selected Genes Using Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)

RNA from the leaves and stems of 4-leaf seedlings was analyzed by quantitative real-time RT-PCR. First-strand cDNA was synthesized using RevertAid Premium Reverse Transcriptase (Thermo Scientific™ EP0733, Waltham, MA, USA) according to the manufacturer’s instructions. GAPDH (GenBank JX448342.1) was used as the internal control [16], and primer sequences for the genes analyzed are listed in Table 1. qRT-PCRs were run in a Lightcycler 96 Real-time qPCR detection system (Roche, Indianapolis, IN, USA) with three biological replicates for each type of sample. The program used was as follows: 5 min at 95 °C, 40 cycles of 95 °C (10 s), 58 °C (10 s), and 72 °C (30 s). The 2−△△Ct method was used to calculate the relative expression levels of the target genes [17].

2.6. NADPH-Cytochrome P450 Reductase Activity Assay

The activity of NADPH-cytochrome P450 reductase (CPR) in stems was assayed using a Plant CPR ELISA kit (Yuanmu, Shanghai). The Stop Solution changes the color from blue to yellow, and the intensity of the color is measured at 450 nm using a spectrophotometer. To measure the concentration of CPR in the sample, the CPR ELISA Kit includes a set of calibration standards. The calibration standards were assayed at the same time as the samples and allowed the operator to produce a standard curve of optical density versus CPR concentration. Then, the concentration of CPR in the samples was determined by comparing the O.D. of the samples to the standard curve.

2.7. Statistical Analysis

Statistical analyses were performed using Student’s t-test (SPSS 21.0) [18]. Summary statistics are presented as the mean ± standard deviation (SD). Asterisks denote significant differences (* p < 0.05 and ** p < 0.01).

3. Results

3.1. Inheritance of the Dwarf Phenotype in dwf

The dwf mutant, which showed a significantly dwarfed phenotype due to shortened internodes, was isolated from M2 populations derived from an EMS-mutagenized eggplant ‘14–345’ (WT) population [19]. To determine the inheritance pattern of dwarfism in dwfs, F1 plants that displayed similar plant heights to WT were obtained from crosses of dwfs with WT (Figure 1). The dwarf phenotype was segregated in the F2 populations. There were 43 plants with a dwarf phenotype and 123 plants with plant height similar or close to that of WT in the F2 population, which fit a 3:1 segregation ratio by the chi-square test (χ2 < χ20.05 = 3.84) (Table 2). These results suggested that the dwarf phenotype of dwf was controlled by a single nuclear recessive gene.

3.2. Identification of a Candidate Gene by BSA

BSA-seq was used to identify the candidate gene for dwf. Two bulk DNA samples, dwarf bulk (M-bulk) and normal bulk (W-bulk), were constructed by mixing equal amounts of DNAs from 30 dwarf plants and 30 normal plants from the M3 population, respectively. We obtained clean reads of 26.56 Gb (99.87% coverage) and 26.20 Gb (99.89% coverage) corresponding to the W-bulk and M-bulk, respectively; 97.71% and 96.74% of the reads from W-bulk and M-bulk were aligned to the reference genome (https://www.ncbi.nlm.nih.gov/genome/?term=Solanum+melongena, 28 August 2018). A total of 3077032 SNPs were identified between the M-bulk and W-bulk. △(SNP-index) > 0.5 was used as the threshold at the 95% confidence level, 13 SNPs including six nonsynonymous SNPs, a stop gain SNP, a splicing SNP, and seven upstream SNPs were obtained (Table 3).
To further confirm the candidate SNP responsible for the dwarf phenotype, the 13 SNPs were used in KASP to design a specific primer for genotyping analysis of the 64 M3 plants, 118 F2 plants, 10 F1 plants, three dwf, and three WT. The genotypic assay revealed that SNP 8216 of Sme2.5_01158.1 cosegregated with the phenotype in the M3, F2, F1 populations and parents. The dwarf plants had a A:A genotype, and the plants with a wild phenotype had a G:G or G:A genotype (Figure 2). Then, the candidate SNP Sme2.5_01158.1_g00001.1 was used to design a specific primer for genotyping analysis from ten F2 individuals by Sanger sequencing. The results showed that the SNP genotype of the dwarf phenotype was A:A, and the genotype of WT was G:A and G:G (Figure 3). Therefore, we confirmed that Sme2.5_01158.1_g00001.1 was a candidate gene related to dwarfism.
Sme2.5_01158.1_g00001.1, locating at 12663065-12667066 on chromosome 4 (Figure 4A), contains open reading frame of 3912 bp and encoding NADPH-cytochrome P450 reductase 1 (CPR1) of 1154 amino acids. Thus, we named Sme2.5_01158.1_g00001.1 as SmCPR1. In order to understand the effect of base mutation on protein, we used ORF finder (http://www.ncbi.nlm.nih.gov/orffinder/, 15 January 2020) to predict domain and MAFFT software to do the amino acid sequence homology alignment. We found the mutation that carried a G to A transition at nucleotide 8216 (Figure 4B) led to a transition at codon 77, resulting in replacement of a valine (Val) with isoleucine (Ile), and the substitution in the fourth site in front of the flavodoxin domain (Figure 4C). These results suggest that the mutation in SmCPR1 may cause the dwarf phenotype of mutant dwf. Additionally, we found that the amino acid mutation was located in 4 amino acids upstream of flavodoxin domain, which is a conserved domain of NADPH-cytochrome P450 reductase.

3.3. Effect of SmCRP Mutation on Enzyme Activity

CPRs play a vital role in CYP metabolism in plants. Two CPR genes, SmCPR1 and SmCPR2, were identified in eggplant genome. In order to confirm the physiological function of SmCPR1, the relative transcription level of SmCPR1 and NADPH-cytochrome P450 reductase (CPR) activity were studied in stems of WT and dwf. As shown in Figure 5A, SmCPR2 showed very low expression in both leaves and stems. Although SmCPR1 was barely expressed in leaves, the expression of SmCPR1 was highly expressed in stems. The results indicated the important role of SmCPR1 in regulating the development of stem, which is the main factor determining plant height. The CPR activity was analyzed using CPR ELISA kit. CPR activity was significantly increased in the stems of dwf as compared with that of WT (Figure 5B), indicating the negative roles of SmCPR1 in regulating plant height in eggplant.

4. Discussion

Plant height is an important agronomic trait for crops and is highly associated with agricultural performance. Dwarfism or semi-dwarfism is widely used in plant breeding and is easier to manage and harvest, with considerable cost savings [20,21]. EMS mutagenesis is one of the effective methods to establish a mutant library; the advantages are inducing point mutation and easy to be stably inherited [22,23,24]. In this study, we established a mutant library by EMS with various phenotypes and isolated a dwarf mutant dwf from the mutant library. The F1 plants which were obtained from the crosses of dwf with WT displayed similar plant height with WT, and the F2 populations showed segregated phenotype and the ratio of wild type and dwarf type fit for 3:1, verifying that the dwarf phenotype was controlled by a single nuclear recessive gene.
BSA is a rapid method used to detect molecular markers associated with target traits in mapping populations [25]. In our study, we isolated the SmCPR1 gene as a candidate gene that regulate plant growth by BSA and verified this conclusion by KASP. The gene SmCPR1 carried the mutation at 8216 bp from G to A and resulted in the 77th mutage of Val to Ile, encodes a member of NADPH- cytochrome P450 reductase (CPR), CPR1. In Arabidopsis mutant cpr1, CPR1 related to dwarfism has been reported [26].
CPR contains cofactors and can transfer electrons to NAD+ or NADP+ to diverse cytochrome P450 monooxygenases [27,28] which participate in substance metabolism [29] associated with dwarfism such as endogenous hormone [30,31] and phenylpropanes [32]. We have reported that the GA3 level, internode length of stems, and the internode cell length of dwf were significantly decreased as compared with those of the WT, and confirmed that the dwarfism of dwf was associated with gibberellin (GA3) [19]. The SmCPR1 played a negative role in regulating the plant height in dwf, it might participate in the process of impeding the GA3 biosynthesis.Further study is needed to provide the direct evidence.
In this study, the expression of the mutant gene SmCPR1 was not changed, but the enzyme activity of CPR1 was significantly increased in dwf. We inferred that the mutant location of the amino acid was very close to the conserved domain, which might alter protein conformation and further affect enzyme activity.

Author Contributions

Conceptualization, Y.L., S.L. and X.C.; methodology, Y.L., W.D., P.Y. and S.X.; validation, Y.L., S.L. and X.C.; formal analysis, Y.L. and S.L.; investigation, W.Z.; resources, X.C., J.Z., S.L. and Y.W.; data curation, Y.L. and X.C.; writing—original draft preparation, Y.L. and S.L.; writing—review and editing, Y.L., S.L., N.L., Q.L., J.Z and X.C.; visualization, Y.L.; supervision, X.C. and S.S.; project administration, X.C. and S.S.; funding acquisition, X.C. and S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Hebei Fruit Vegetables Seed Industry Science and Technology Innovation Team Project; the Key R & D Project of Hebei Province (Grant No. 20326344D); the Vegetable innovation team project of Hebei modern agricultural industrial technology system (Grant No. HBCT2018030203); the Vegetable Molecular Chromosome Engineering and New Variety Breeding Innovation Team of Hebei Agriculture University; and Technology Innovation Guidance Project-Science; and Technology Work Conference of Hebei Provincial Department of Science and Technology.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained in the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hedden, P. The genes of the green revolution. Trends Genet. 2003, 19, 5–9. [Google Scholar] [CrossRef]
  2. Peng, J.R.; Richards, D.E.; Hartley, N.M.; Murphy, G.P.; Devos, K.M.; Flintham, J.E.; Beales, J.; Fish, L.J.; Worland, A.J.; Pelica, F. ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature 1999, 400, 256–261. [Google Scholar] [CrossRef] [PubMed]
  3. Sasaki, A.; Ashikari, M.; Ueguchi-Tanaka, M.; Itoh, H.; Nishimura, A.; Swapan, D.; Ishiyama, K.; Saito, T.; Kobayashi, M.; Khush, G.S.; et al. A mutant gibberellin-synthesis gene in rice. Nature 2002, 416, 701–702. [Google Scholar] [CrossRef] [PubMed]
  4. Jin, X.J.; Sun, D.F.; Li, H.Y.; Sun, G.L. Characterization and molecular mapping of a dwarf mutant in wheat. Genet. Mol. Res. 2013, 12, 3555–3565. [Google Scholar] [CrossRef] [PubMed]
  5. Xu, T.; Bian, N.F.; Wen, M.M.; Xiao, J.; Yuan, C.X.; Cao, A.Z.; Zhang, S.Z.; Wang, X.E.; Wang, H.Y. Characterization of a common wheat (Triticum asetivum L.) high—tillering dwarf mutant. Theor. Appl. Genet. 2017, 130, 483–494. [Google Scholar] [CrossRef]
  6. Li, C.; Tang, J.; Hu, Z.Y.; Wang, J.W.; Yu, T.; Yi, H.Y.; Cao, M.Y. A novel maize dwarf mutant generated by Ty1-copia LTR- retrotransposon insertion in Brachytic2 after spaceflight. Plant Cell Rep. 2020, 39, 393–408. [Google Scholar] [CrossRef]
  7. Chen, Q.; Song, J.; Du, W.P.; Xu, L.Y.; Jiang, Y.; Zhang, J.; Xiang, X.L.; Yu, G.R. Identification and genetic mapping for rht-DM, a dominant dwarfing gene in mutant semi-dwarf maize using QTL-seq approach. Genes Genom. 2018, 40, 1091–1099. [Google Scholar] [CrossRef]
  8. Bae, K.-D.; Um, T.-Y.; Yang, W.-T.; Park, T.-H.; Hong, S.-Y.; Kim, K.-M.; Chung, Y.-S.; Yun, D.-J.; Kim, D.-H. Characterization of dwarf and narrow leaf (dnl-4) mutant in rice. Plant Signal Behav. 2021, 16, 1849490. [Google Scholar] [CrossRef]
  9. Wei, X.J.; Tang, S.Q.; Shao, G.N.; Chen, M.L.; Hu, Y.C.; Hu, P.S. Fine mapping and characterization of a novel dwarf and narrow-leaf mutant dnl1 in rice. Genet. Mol. Res. 2013, 12, 3845–3855. [Google Scholar] [CrossRef] [PubMed]
  10. Xing, M.M.; Su, H.N.; Liu, X.; Yang, L.M.; Zhang, Y.Y.; Wang, Y.; Fang, Z.Y.; Lv, H.H. Morphological, transcriptomics and phytohormone analysis shed light on the development of a novel dwarf mutant of cabbage (Brassica oleracea). Plant Sci. 2020, 290, 110283. [Google Scholar] [CrossRef]
  11. Hou, S.S.; Niu, H.H.; Tao, Q.Y.; Wang, S.S.; Gong, Z.H.; Li, S.; Weng, Y.Q.; Li, Z. A mutant in the CsDET2 gene leads to a systemic brassinosteriod deficiency and super compact phenotype in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2017, 130, 1693–1703. [Google Scholar] [CrossRef] [PubMed]
  12. Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
  13. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 5, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
  14. McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [Green Version]
  15. Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throug hput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef] [PubMed]
  16. Barbierato, V.; Sala, T.; Rinaldi, P.; Bassolino, L.; Barchi, L.; Rotino, G.L.; Toppino, L. A spiking strategy facilitates housekeeping selection for RT-qPCR analysis under different biotic stresses in eggplant. Protoplasma 2017, 254, 2215–2223. [Google Scholar] [CrossRef]
  17. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  18. Mishra, P.; Singh, U.; Pandey, C.M.; Mishra, P.; Pandey, G. Application of student’s t-test, analysis of variance, and covariance. Ann. Card. Anaesth. 2019, 22, 407–411. [Google Scholar] [CrossRef]
  19. Lu, Y.; Luo, S.; Li, Q.; Li, N.; Du, W.; Yu, P.; Wang, X.; Zhang, W.; Xuan, S.; Zhou, X.; et al. Phenotypic Characterization and Differential Gene Expression Analysis Reveal That Dwarf Mutant dwf Dwarfifism Is Associated with Gibberellin in Eggplant. Horticulturae 2021, 7, 114. [Google Scholar] [CrossRef]
  20. Jia, Q.J.; Li, C.D.; Shang, Y.; Zhu, J.H.; Hua, W.; Wang, J.M.; Yang, J.M.; Zhang, G.P. Molecular characterization and functional analysis of barley semi-dwarf mutant Riso no. 9265. BMC Genom. 2015, 16, 927–938. [Google Scholar] [CrossRef] [Green Version]
  21. Sun, X.R.; Liu, L.; Zhi, X.N.; Bai, J.R.; Cui, Y.N.; Shu, J.S.; Li, J.M. Genetic analysis of tomato internode length via mixed major gene plus polygene inheritance model. Sci. Hortic. 2019, 246, 759–764. [Google Scholar] [CrossRef]
  22. Wu, Z.; Liu, Z.Z.; Chang, S.F.; Zhao, Y.X. An EMS mutant library for carrot and genetic analysis of some mutants. Breed Sci. 2020, 70, 540–546. [Google Scholar] [CrossRef]
  23. Sun, J.; Luu, N.S.; Chen, Z.H.; Chen, B.; Cui, X.A.; Wu, J.X.; Zhang, Z.G.; Lu, T.G. Generation and Characterization of a Foxtail Millet (Setaria italica) Mutant Library. Front. Plant Sci. 2019, 10, 369. [Google Scholar] [CrossRef] [Green Version]
  24. Kim, Y.; Schumaker, K.S.; Zhu, J.K. EMS mutagenesis of Arabidopsis. Methods Mol. Biol. 2006, 323, 101–103. [Google Scholar]
  25. Michelmore, R.W.; Paran, I.; Kesseli, R.V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 1991, 88, 9828–9832. [Google Scholar] [CrossRef] [Green Version]
  26. Stokes, T.L.; Richards, E.J. Induced in stability of two Arabidopsis constitutive pathogen-response alleles. Proc. Natl. Acad. Sci. USA 2002, 99, 7792–7796. [Google Scholar] [CrossRef] [Green Version]
  27. Laursen, T.; Jensen, K.; Moller, B.L. Conformational changes of the NADPH-dependent cytochrome P450 reductase in the course of electron transfer to cytochromes P450. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2011, 1814, 132–138. [Google Scholar] [CrossRef]
  28. Dae-Kyun Ro, D.-K.; Jürgen, E.; Douglas, C.J. Cloning, Functional Expression, and Subcellular Localization of Multiple NADPH-Cytochrome P450 Reductases from Hybrid Poplar. Plant Physiol. 2002, 130, 1837–1851. [Google Scholar]
  29. Szalai, G.; Tajti, J.; Hamow, K.A.; Ildikó, D.; Khalil, R.; Vanková, R.; Dobrev, P.; Mishueva, S.P.; Janda, T.; Pál, M. Molecular background of cadmium tolerance in Rht dwarf wheat mutant is related to a metabolic shift from proline and polyamine to phytochelatin synthesis. Environ. Sci. Pollut. Res. Int. 2020, 27, 23664–23676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Nelissen, H.; Rymen, B.; Jikumaru, Y.; Demuynck, K.; Lijsebettens, M.V.; Kamiya, Y.; Inzé, D.; Beemster, G.T.S. A local maximum in gibberellin levels regulates maize leaf growth by spatial control of cell division. Curr. Biol. 2012, 22, 1183–1187. [Google Scholar] [CrossRef] [Green Version]
  31. Bishop, G.J. Brassinosteroid mutants of crops. J. Plant Growth Regul. 2003, 22, 325–335. [Google Scholar] [CrossRef]
  32. Muro-Villanueva, F.; Mao, X.; Chapple, C. Linking phenylpropanoid metabolism, lignin deposition, and plant growth inhibition. Curr. Opin. Biotechnol. 2019, 56, 202–208. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 07 00196 g001 550
Figure 1. Comparisons of plant height and width of dwf, WT, and F1 plants. ** Significantly different at p = 0.01 by the t test. (A) The plants of dwf and WT; (B) The plant height of the dwf, WT and F1; (C)The plant width of the dwf, WT and F1.
Figure 1. Comparisons of plant height and width of dwf, WT, and F1 plants. ** Significantly different at p = 0.01 by the t test. (A) The plants of dwf and WT; (B) The plant height of the dwf, WT and F1; (C)The plant width of the dwf, WT and F1.
Horticulturae 07 00196 g001
Horticulturae 07 00196 g002 550
Figure 2. Verification of Sme2.5_01158.1_g00001.1 by KASP, the four charts represent four plates respectively. Red points indicate genotype A:A, green points indicate A:G, and blue points indicate G:G: (A) 10F1 plants with the genotype A:G, 20 dwarf plants with genotype A:A of the F2 population; (B) 4 dwarf plants with the genotype A:A of the F2 population and 90 wild plants with the genotype A:G and G:G of the F2 population; (C) 3 WT plants, 3 dwf plants, 14 dwarf plants with the genotype A:A of the M3 population; (D) 16 dwarf plants with the genotype A:A of the M3 population, 21 wild plants with A:G and 13 with G:G of the M3 population, and 4 A:G of the F2 population.
Figure 2. Verification of Sme2.5_01158.1_g00001.1 by KASP, the four charts represent four plates respectively. Red points indicate genotype A:A, green points indicate A:G, and blue points indicate G:G: (A) 10F1 plants with the genotype A:G, 20 dwarf plants with genotype A:A of the F2 population; (B) 4 dwarf plants with the genotype A:A of the F2 population and 90 wild plants with the genotype A:G and G:G of the F2 population; (C) 3 WT plants, 3 dwf plants, 14 dwarf plants with the genotype A:A of the M3 population; (D) 16 dwarf plants with the genotype A:A of the M3 population, 21 wild plants with A:G and 13 with G:G of the M3 population, and 4 A:G of the F2 population.
Horticulturae 07 00196 g002
Horticulturae 07 00196 g003 550
Figure 3. Sanger sequencing revealed the genotype of the Sme2.5_01158.1_g00001.1 mutation site. The top figure shows the dwarf phenotype in which the genotype was A:A. The middle and bottom figures show the wild-type phenotype, and the genotypes were G:G and A:G.
Figure 3. Sanger sequencing revealed the genotype of the Sme2.5_01158.1_g00001.1 mutation site. The top figure shows the dwarf phenotype in which the genotype was A:A. The middle and bottom figures show the wild-type phenotype, and the genotypes were G:G and A:G.
Horticulturae 07 00196 g003
Horticulturae 07 00196 g004 550
Figure 4. Location and structure of the candidate gene SmCPR1 and its amino acid sequence: (A) SmCPR1 is located on chromosome 4, and the red frame indicates SmCPR1; (B) structure and mutation site of SmCPR1, black rectangles indicate exons and gray lines indicate introns, the mutation occurred in the first exon and the mutation base was from G to A; (C) the black line indicates the amino sequence, and the red, yellow, and green rectangles indicate the conserved domain database. FAD, flavin adenine dinucleotide. NAD, nicotinamide adenine dinucleotide.
Figure 4. Location and structure of the candidate gene SmCPR1 and its amino acid sequence: (A) SmCPR1 is located on chromosome 4, and the red frame indicates SmCPR1; (B) structure and mutation site of SmCPR1, black rectangles indicate exons and gray lines indicate introns, the mutation occurred in the first exon and the mutation base was from G to A; (C) the black line indicates the amino sequence, and the red, yellow, and green rectangles indicate the conserved domain database. FAD, flavin adenine dinucleotide. NAD, nicotinamide adenine dinucleotide.
Horticulturae 07 00196 g004
Horticulturae 07 00196 g005 550
Figure 5. Relative expression and enzyme activity: (A) Expression pattern of SmCPR1 and SmCPR2 in leaves and stems; (B) CPR enzyme activity assayed in the stems of WT and dwf.
Figure 5. Relative expression and enzyme activity: (A) Expression pattern of SmCPR1 and SmCPR2 in leaves and stems; (B) CPR enzyme activity assayed in the stems of WT and dwf.
Horticulturae 07 00196 g005
Table
Table 1. The primer sequences for qRT-PCR.
Table 1. The primer sequences for qRT-PCR.
Gene IDForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
GAPDHGTACGACAACGAATGGGGTTATCATATCAGCAGCACCAGCA
SmCPR1CGAGTGGCCCAATCAACAGATCCGTCCTCCTCCTCCTCCAAAACCG
CPR2GAAAGAACCACTATGCGTATAAACATCCACCGTGTTTGTTTGTTTGTG
Table
Table 2. The segregation ratio of F2.
Table 2. The segregation ratio of F2.
GenerationWT PhenotypeDwarf PhenotypeTheoretical Segregation Ratioχ2
F2123432.86:10.823
Table
Table 3. Candidate SNP sites.
Table 3. Candidate SNP sites.
Gene IDVariantScaffoldPositionReferenceAlter
Sme2.5_01158.1_g00001.1NonsynonymousSme2.5_01158.18216GA
Sme2.5_00670.1_g00001.1NonsynonymousSme2.5_00670.11811CA
Sme2.5_06691.1_g00001.1NonsynonymousSme2.5_06691.11988TC
Sme2.5_11667.1_g00003.1NonsynonymousSme2.5_11667.128,891CT
Sme2.5_16807.1_g00001.1NonsynonymousSme2.5_16807.11476CT
Sme2.5_19952.1_g00001.1NonsynonymousSme2.5_19952.12943GT
Sme2.5_21615.1_g00001.1Stop gainSme2.5_21615.12478CT
Sme2.5_08332.1_g00001.1SplicingSme2.5_08332.13974CT
Sme2.5_01689.1_g00001.1UpstreamSme2.5_01689.14262AT
Sme2.5_01689.1_g00001.1UpstreamSme2.5_01689.14265CG
Sme2.5_06855.1_g00002.1UpstreamSme2.5_06855.110,623CT
Sme2.5_19942.1_g00002.1UpstreamSme2.5_19942.111,896TC
Sme2.5_22728.1_g00001.1UpstreamSme2.5_22728.14016GA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lu, Y.; Luo, S.; Li, N.; Li, Q.; Du, W.; Zhang, W.; Yu, P.; Xuan, S.; Wang, Y.; Zhao, J.; et al. Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf. Horticulturae 2021, 7, 196. https://doi.org/10.3390/horticulturae7070196

AMA Style

Lu Y, Luo S, Li N, Li Q, Du W, Zhang W, Yu P, Xuan S, Wang Y, Zhao J, et al. Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf. Horticulturae. 2021; 7(7):196. https://doi.org/10.3390/horticulturae7070196

Chicago/Turabian Style

Lu, Yang, Shuangxia Luo, Na Li, Qiang Li, Wenchao Du, Weiwei Zhang, Ping Yu, Shuxin Xuan, Yanhua Wang, Jianjun Zhao, and et al. 2021. "Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf" Horticulturae 7, no. 7: 196. https://doi.org/10.3390/horticulturae7070196

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop