Dietary Complex Probiotic Supplementation Changed the Composition of Intestinal Short-Chain Fatty Acids and Improved the Average Daily Gain of Growing Pigs
by
and
Juan Wang
1,
Shuwei Li
2,
Wenjie Tang
2,
Hui Diao
2,
Hongfu Zhang
3,
Honglin Yan
1 and
Jingbo Liu
1,* 1
School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang 621010, China
2
Sichuan Academy of Animal Science, Chengdu 610066, China
3
State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing 100193, China
*
Author to whom correspondence should be addressed.
Vet. Sci. 2023, 10(2), 79; https://doi.org/10.3390/vetsci10020079
Submission received: 14 December 2022
/
Revised: 14 January 2023
/
Accepted: 19 January 2023
/
Published: 21 January 2023
(This article belongs to the Special Issue The Regulatory Mechanism of Nutrient Metabolism on Porcine Intestinal Health)
Abstract
:Simple Summary
In this research, we studied the effects of complex probiotic (Bacillus licheniformis, Bacillus subtilis, Lactobacillus acidophilus and Saccharomyces cerevisiae) on growth performance, nutrient digestibility, blood characteristics, fecal microbiota, fecal short-chain fatty acids, fecal score and fecal gas emissions in growing pigs. Dietary complex probiotic supplementation changed the composition of intestinal short-chain fatty acids, improved growth performance and reduced harmful gas emissions in growing pigs. This study provides basic data for the use of compound probiotic.
Abstract
At present, probiotics are being extensively evaluated for their efficacy as an alternative to antibiotics, and their safety in livestock production. In this study, 128 (Duroc, Yorkshire and Landrace) pigs with an average initial body weight of 28.38 ± 0.25 kg were allocated to four dietary treatments in a randomized complete-block design. There were eight pens per treatment, with four pigs per pen (two barrows and two gilts). Dietary treatments included: (1) control diet; (2) control diet + 0.05% complex probiotic; (3) control diet + 0.1% complex probiotic; (4) control diet + 0.2% complex probiotic. During the 28-day experimental period, the feeding of 0.1% complex probiotic in the diet increased body weight and average daily gain (p < 0.05). The addition of complex probiotics decreased total cholesterol and glucose concentrations in the blood (p < 0.01). Acetate concentrations in the blood increased from 0.1% complex probiotic in the diet (p < 0.05), while NH3 and H2S emissions in the feces decreased (p < 0.05) from 0.1% or 0.2% complex probiotic in the diet. In conclusion, dietary complex probiotic supplementation changed the composition of intestinal short-chain fatty acids and improved growth performance for growing pigs.
1. Introduction
As an active microbial complex, probiotics can effectively enhance the positive effects of gut microbes on the host, regulate gut health and improve production performance [1,2]. The microorganisms in probiotics can produce vitamins, amino acids, organic acids, enzymes, and other substances, through their own metabolism. These substances can boost nutrient absorption, improve gut health and have antibacterial properties. In recent years, probiotics have attracted extensive attention as a dietary alternative to feeding antibiotics and nutritional additives [1,2,3,4,5,6]. In addition, adding probiotics can reduce the emissions of harmful fecal gases and the pollution problem from intensive farming [7].
The type and dose of probiotics, the mechanism of action for microbial strains, and the interactions with the host are important to determine the effects of probiotics [8,9]. The strains currently used as probiotic additives mainly include Bacillus licheniformis, Bacillus subtilis, Lactobacillus acidophilus and Saccharomyces cerevisiae. Some selected specific strains are also used for the preparation of probiotics [10,11], such as Lactobacillus casei, Lactobacillus plantarum and Lactobacillus johnsonii BS15. There have been several studies adding one microbial species or a combination of several microbial species as a probiotic [12,13,14]. However, there are few studies examining the effects of the previously mentioned microbial species (Bacillus licheniformis, Bacillus subtilis, Lactobacillus acidophilus, and Saccharomyces cerevisiae.) for probiotic supplementation in growing pigs. Therefore, the objective of this study was to evaluate the effects of different concentrations of complex probiotic (contains four mixed probiotics) on growth performance, nutrient digestibility, blood profile, fecal microbiota, fecal short-chain fatty acids (SCFAs), fecal score and fecal gas emissions in growing pigs.
2. Materials and Methods
The animal study protocol was approved by the Institutional Review Board of the Southwest University of Science and Technology (protocol code SM00155). The complex probiotic product we have used comprises four kinds of mixed probiotics. The effective content of each probiotic was 5.1 × 107 CFU/g Bacillus licheniformis, 6.3 × 107 CFU/g Bacillus subtilis, 4.3 × 107 CFU/g Lactobacillus acidophilus and 2.5 × 107 CFU/g Saccharomyces cerevisiae.
2.1. Experimental Design, Animals and Housing
One hundred and twenty-eight (Duroc, Landrace and Yorkshire) growing pigs (average initial body weight (BW) of 28.38 ± 0.25 kg) were used in a 28-day growth trial. At the start of the experiment, pigs were assigned to four dietary treatments based on initial BW in a randomized complete-block design. There were eight replicate pens per dietary treatment, with four pigs per pen (2 barrows, 2 gilts). Dietary treatments included: (1) CON (control diet) with no probiotic, 0%; (2) CON with 0.05% complex probiotic; (3) CON with 0.1% complex probiotic; (4) CON with 0.2% complex probiotic. The control diet (Table 1) was a compound feed in mash, formulated to meet nutrient requirements for 25–50 kg growing pigs [15]. Throughout the experiment, the pigs were housed in plastic floor pens and all the pigs were provided with ad libitum access to feed and water through a self-feeder and a nipple drinker, respectively. The target room temperature and humidity throughout the study were 20 °C and 60%, respectively.
2.2. Fecal Score and Sample Collection
Feces were scored on a scale from one to five (fecal score: 1 hard, dry pellet; 2 firm, formed stool; 3 soft, moist stool that retains shape; 4 soft, unformed stool that assumes the shape of the container; 5 watery liquid that can be poured) by observing the morphology of the feces in each pen at 08:00 and 20:00 every day. BW for each pig was measured on days 0, 14 and 28, to determine average daily gain (ADG). Feed consumption was recorded every day, by measuring the amount of feed fed and remaining on a pen, to calculate average daily feed intake (ADFI), and feed to gain ratio (F: G). Chromium oxide was added to the diet as an indigestible marker at 0.5% for 4 days (during days 11 to 14 and days 25 to 28) prior to fecal collection on days 14 and 28 for calculating dry matter (DM), crude protein (CP) and gross energy (GE) digestibility values. On day 14, rectal massage was used on each pig to collect 300 g of fresh feces for the determination of fecal gas emissions, with another 60 g of fresh feces used to determine nutrient digestibility. Blood samples were taken from eight pigs per dietary treatment. One pig was randomly selected from each pen (guaranteed male to female ratio of 1:1 for each treatment) and bled via jugular venipuncture at the end of the experiment. On day 28, a large amount of feces was collected through rectal massaging. Collection of 300 g and 60 g of fresh feces in the front section (first discharge the feces within 15 cm) was carried out to measure fecal gas emissions and nutrient digestibility, respectively. After collection, 20 g of fresh feces in the latter section (more than 15 cm in length) were stored in a cryopreservation tube at −80 °C, to measure the microbial content of the feces, and 40 g of those were placed in a sample tube at −20 °C to measure the SCFAs in the feces. After fecal collection from each pig was completed, feces from all the pigs in the same pen were mixed prior to analysis.
2.3. Nutrient Digestibility and Blood Profile Analyses
Diet and fecal samples were analyzed after drying in a forced-air oven and grinding through a 1 mm sieve. Calcium (Ca) and phosphorus (P) were determined in the diet based on the method of Liu et al. [16]. Feces were dried in a forced-air oven at 105 °C for 2 h [17] to determine the DM content. The concentrations of CP in experimental diets and feces were determined by the combustion method [17]. Dietary and fecal GE were determined by a fully automated calorimeter (BYLRY-3000W). After nitrification, Cr2O3 concentrations in diets and fecal samples were determined by reading absorbance at 450 nm on a spectrophotometer. Blood indicators were measured by using an automatic biochemical analyzer (BK-600, biobased, Jinan City, Shandong Province, China) [17].
2.4. Fecal Microbiota Analysis
Fecal microbial assays were performed as described by Liu et al. [18]. Fecal total DNA was extracted by using Omega’s stool DNA isolation kit (Omega BioTec, Norcross, GA, USA). In this experiment, the concentrations of six species of bacteria, including Prevotella, Bacteroides, Bifidobacterium, Escherichia coli, Lactobacillus and Bacillus, were determined. Primer sequences and annealing temperatures were shown in Table 2. This test used 11 μL in a fluorescence-quantitative PCR reaction system, including 2 μL of DNA, 2.7 μL of RNase-free water, 0.4 μL (10 μM) of upstream and downstream primers and 5.5 μL 2× KAPA SYBR FAST qPCR Kit Master Mix. The reaction conditions were: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of denaturation/annealing (95 °C for 15 s, 60 °C for 1 min) and a melting curve process (from 70 °C to 90 °C, increasing by 0.5 °C every 5 s). The fluorescence-quantitative reaction was performed on an ABI 7600 instrument.
2.5. Determination of SCFAs in Feces
Fecal samples were sealed, thawed at 5 °C for 4 h and then mixed. After weighing 15 g of feces, 15 mL of distilled water was added for mixing, then the mixture was centrifuged at 4000× g and 18 °C for 5 min. Five mL of supernatant was then added to 5 mL of HCl, the mixture then being stored at 7 °C. This mixture was centrifuged at 14,000× g and 17 °C for 10 min then injected into a gas chromatograph for detection. The column (1.8 m) with the stationary phase SP 1200 (Supelco) contained 10% SP 1200, 1% H3PO4, and acid-washed 80/100 Chromosorb W. Flame ionization detector was used for detection, with nitrogen used as a carrier gas.
2.6. Fecal Gas Emissions Analyses
The fresh feces (300 g) from each pen were placed in separate 2.6 L plastic boxes with a small hole located in the middle of one side, which was sealed with adhesive plaster. The samples were fermented for 24 h at room temperature (25 °C). Afterwards, 100 mL of the head-space air was sampled from approximately 2.0 cm above the fecal sample. After the gas was collected, the small hole was resealed for gas detection. Before measurement, the fecal samples were manually shaken for approximately 30 s to disrupt crust formation on the surface of the fecal samples and to homogenize the samples. Concentrations of NH3, H2S, mercaptan, acetic acid and CO2 were measured by using a portable 6-in-1 gas detector (SGA-606, ingoan, Shenzhen, Guangdong Province, China).
2.7. Statistical Analyses
Data was analyzed by ANOVA, using the GLM procedure of SAS (SAS Inst. Inc., Cary, NC, USA) for a randomized complete-block design evaluating the level of complex probiotic added to the diet. The dose–response effects of dietary complex probiotic were computed using orthogonal polynomial contrasts for evaluating linear and quadratic effects. Post-hoc test was used to compare the control group (0 % complex probiotic) versus complex probiotic added to the diet. For all response criteria, the pen served as the experimental unit. Variability in the data was expressed as the pooled SE and p < 0.05 was considered statistically significant.
3. Results
3.1. Growth Performance and Nutrient Digestibility
There were linear increases in final body weight (FBW; Day 28) and ADG (Day 15–28 and Day 0–28) as the amounts of dietary complex probiotic increased (Table 3; p < 0.01), with trait values greater for pigs fed 0.1% complex probiotic than CON pigs (p < 0.05). Linear increases in average daily feed intakes (ADFI) (Day 15–28 and Day 0–28) were present as the amounts of dietary complex probiotic increased (Table 3; p < 0.04), but did not affect (p > 0.12) ADFI or F: G values versus CON pigs. There was no effect of dietary complex probiotic supplementation on nutrient digestibility in growing pigs (p > 0.05) when assessed on day 14 or day 28 (Table 4).
3.2. Blood Profile
The addition of complex probiotic to the diet reduced (p < 0.01) total cholesterol and glucose concentrations in the blood (Table 5). There was a linear decrease (p < 0.02) in total cholesterol and glucose concentrations as the amounts of dietary complex probiotic increased, with total cholesterol and glucose concentrations further decreasing (p < 0.05) when complex probiotic increased from 0.05% to 0.1% of the diet. Dietary complex probiotic supplementation did not affect (p > 0.38) the concentrations of HDL, LDL, triacylglycerides, total protein and urea nitrogen in the blood.
3.3. Fecal Microbiota, Fecal SCFAs, Fecal Score and Fecal Gas Emissions
There was no effect (p > 0.07) of dietary complex probiotic supplementation on the fecal score in growing pigs throughout the study. (Table 6). Concentrations of Bifidobacterium increased (p < 0.04) with the addition of dietary complex probiotic, along with a linear increase (p = 0.01) in Bifidobacterium numbers as the amount of dietary complex probiotic increased (Table 7). There was no effect (p > 0.27) of dietary complex probiotic supplementation on the concentrations of any other microbial species evaluated (Table 7). Acetate was the only short-chain fatty acid to increase (p < 0.02) when complex probiotic were added to the diet (Table 8). There were linear increases (p < 0.05) in acetate, butyrate and total SCFA concentrations as the amounts of complex probiotic increased in the diet (Table 8). The addition of complex probiotic to the diet decreased (p < 0.04) concentrations of NH3 on day 14, and concentrations of NH3 and H2S on day 28 (Table 9), with linear decreases (p < 0.03) for NH3 and H2S as the amount of dietary complex probiotic increased. Ammonia concentrations on day 28 further decreased when the dietary inclusion rate for complex probiotic increased from 0.05% to 0.1% (Table 9).
4. Discussion
The results of this study showed that although dietary supplementation of complex probiotic had no significant effect on nutrient digestibility and feces score of growing pigs, an appropriate dose of complex probiotic (0.1%) could improve the ADG during days 15 to 28, change the composition of intestinal microorganisms and SCFAs, and reduce the incidence of noxious gas emissions in growing pigs.
Growth performance is an intuitive comprehensive assessment of animal production, affected by the ambient environment and diet composition. The nutritional composition of the diet [25,26] including dietary Ca and P concentrations [16,27,28], along with feeding management [29,30,31], are important factors for pig growth performance. There have been many studies evaluating the effects of probiotics on the growth performance of pigs. Meng et al. [4] indicated that dietary supplementation of probiotics (Bacillus subtilis-endospore and Clostridium butyricum-endospore complex) could effectively improve the ADG and lower F: G. Another study showed that 0.3% and 0.5% EM®® probiotics (Saccharomyces cerevisiae, Lactobacillus casei, Lactobacillus plantarum) supplementation had lower ADG compared to the 0% probiotic group in the last four weeks before slaughter [10]. Using complex probiotic (Lactobacillus plantarum, Lactobacillus fermentum and Enterococcus faecium) improved the daily weight gain of weaned piglets [32]. The results from the present found adding 0.1% complex probiotic to the diet could significantly increase ADG with no effects on ADFI and F: G, versus pigs fed a control diet with no probiotics added. The addition for probiotics effectively increased FBW of growing pigs compared to the control group. After comparing the results of each of the above experiments, it can be seen that the effects of adding compound probiotics on growth performance were both improved and reduced. The reason for the different results (described above) from trial to trial could be the difference in the type and dose of probiotics added.
Although we observed an increase in ADG in the present study, feeding probiotics did not affect nutrient digestibility [33,34,35,36]. To uncover clues about the effects of probiotics on growth performance, we analyzed the hindgut microbes, as well as SCFAs. Our results showed that feeding probiotics in the diet increased numbers of Bifidobacteria, while did not affect the numbers of several microbial species. Preliminary study showed Bifidobacteria could reduce diarrhea rates [37]. Fecal scores for this study showed no significant difference among the treatment groups, because no diarrhea results were observed. Changes in the composition of gut microbes often affect the composition of their products [38]. We found that adding 0.1% probiotics to the diet could significantly increase amounts of acetate and butyrate produced in the feces. Butyrate acid and acetate could be absorbed by the hindgut and provide a large amount of energy for the body [39]. This is probably the main reason for the improvement in ADG by adding complex probiotic. In the present study, adding probiotics to the diet significantly reduced concentrations of total cholesterol and glucose. Previous studies have found that higher levels of SCFAs could significantly reduce plasma glucose and cholesterol levels [40,41]. SCFAs could regulate plasma glucose and cholesterol levels through the hepatic AMPK pathway, and also affect plasma glucose levels by increasing gut satiety hormones. In this study, we also found that the content of total SCFAs in the probiotic group tended to increase, but not significantly. The above results indicated that the addition of probiotics could change the composition of intestinal microorganisms and SCFAs, thereby affecting the levels of plasma glucose and cholesterol, altered pathways of nutrient metabolism, and the final manifestation was the improvement of ADG and FBW. More evidences of the effects on nutrient metabolism need further collection.
With advancements in intensive farming, pollution from the gaseous emissions from pig manure is a serious problem. This study found that adding probiotics could effectively reduce NH3 and H2S emissions from manure. High concentrations of NH3 and H2S damaged the respiratory mucosa of pigs and reduced growth performance [42]. Adding probiotics could effectively improve the air environment on pig farms and had a positive effect on the control of farm pollution.
5. Conclusions
Dietary supplementation of 0.5% complex probiotic had limited effects on growth performance in growing pigs. Dietary supplementation of 0.1% and 0.2% complex probiotic altered gut microbial composition and SCFAs content, improved ADG and reduced noxious gas emissions.
Author Contributions
Conceptualization, J.W. and J.L.; methodology, J.W., S.L. and J.L.; validation, H.Y., H.Z. and J.W.; formal analysis, W.T. and H.D.; writing—original draft preparation, J.W.; writing—review and editing, J.W. and J.L.; project administration, J.W. and J.L. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the Guizhou Science and Technology Program (2021149).
Institutional Review Board Statement
The animal study protocol was approved by the Institutional Review Board (or Ethics Committee) of the Southwest University of Science and Technology (protocol code SM00155 and 1 November 2020).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data will be made available upon reasonable request.
Acknowledgments
We thank Jingjing Li for her contribution to this article.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Arif, M.; Iram, A.; Bhutta, M.A.K.; Naiel, M.A.E.; Abd El-Hack, M.E.; Othman, S.I.; Allam, A.A.; Amer, M.S.; Taha, A.E. The Biodegradation Role of Saccharomyces cerevisiae against Harmful Effects of Mycotoxin Contaminated Diets on Broiler Performance, Immunity Status, and Carcass Characteristics. Animals 2020, 10, 238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alagawany, M.; Abd El-Hack, M.E.; Farag, M.R.; Sachan, S.; Karthik, K.; Dhama, K. The Use of Probiotics as Eco-Friendly Alternatives for Antibiotics in Poultry Nutrition. Environ. Sci. Pollut. Res. 2018, 25, 10611–10618. [Google Scholar] [CrossRef] [PubMed]
- Hori, T.; Matsuda, K.; Oishi, K. Probiotics: A Dietary Factor to Modulate the Gut Microbiome, Host Immune System, and Gut–Brain Interaction. Microorganisms 2020, 8, 1401. [Google Scholar] [CrossRef] [PubMed]
- Meng, Q.W.; Yan, L.; Ao, X.; Zhou, T.X.; Wang, J.P.; Lee, J.H.; Kim, I.H. Influence of Probiotics in Different Energy and Nutrient Density Diets on Growth Performance, Nutrient Digestibility, Meat Quality, and Blood Characteristics in Growing-Finishing Pigs. J. Anim. Sci. 2010, 88, 3320–3326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xuan, Z.N.; Kim, J.D.; Heo, K.N.; Jung, H.J.; Lee, J.H.; Han, Y.K.; Kim, Y.Y.; Han, I.K. Study on the Development of a Probiotics Complex for Weaned Pigs. Asian-Australas. J. Anim. Sci. 2001, 14, 1425–1428. [Google Scholar] [CrossRef]
- Giang, H.H.; Viet, T.Q.; Ogle, B.; Lindberg, J.E. Effects of Supplementation of Probiotics on the Performance, Nutrient Digestibility and Faecal Microflora in Growing-Finishing Pigs. Asian-Australas. J. Anim. Sci. 2011, 24, 655–661. [Google Scholar] [CrossRef]
- Webb, J.; Broomfield, M.; Jones, S.; Donovan, B. Ammonia and Odour Emissions from UK Pig Farms and Nitrogen Leaching from Outdoor Pig Production. A Review. Sci. Total Environ. 2014, 470–471, 865–875. [Google Scholar] [CrossRef]
- Frontiers | Strain-Specificity and Disease-Specificity of Probiotic Efficacy: A Systematic Review and Meta-Analysis. Available online: https://www.frontiersin.org/articles/10.3389/fmed.2018.00124/full (accessed on 5 December 2022).
- Sánchez, B.; Delgado, S.; Blanco-Míguez, A.; Lourenço, A.; Gueimonde, M.; Margolles, A. Probiotics, Gut Microbiota, and Their Influence on Host Health and Disease. Mol. Nutr. Food Res. 2017, 61, 1600240. [Google Scholar] [CrossRef] [Green Version]
- Rybarczyk, A.; Bogusławska-Wąs, E.; Łupkowska, A. Effect of EM® Probiotic on Gut Microbiota, Growth Performance, Carcass and Meat Quality of Pigs. Livest. Sci. 2020, 241, 104206. [Google Scholar] [CrossRef]
- Xin, J.; Zeng, D.; Wang, H.; Sun, N.; Zhao, Y.; Dan, Y.; Pan, K.; Jing, B.; Ni, X. Probiotic Lactobacillus johnsonii BS15 Promotes Growth Performance, Intestinal Immunity, and Gut Microbiota in Piglets. Probiotics Antimicro. Prot. 2020, 12, 184–193. [Google Scholar] [CrossRef]
- Sampath, V.; Heon Baek, D.; Shanmugam, S.; Kim, I.H. Dietary Inclusion of Blood Plasma with Yeast (Saccharomyces cerevisiae) Supplementation Enhanced the Growth Performance, Nutrient Digestibility, Lactobacillus Count, and Reduced Gas Emissions in Weaning Pigs. Animals 2021, 11, 759. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Kim, Y.H.; Kim, I.H. Effects of Two Bacillus Strains Probiotic Supplement on Reproduction Performance, Nutrient Digestibility, Blood Profile, Fecal Score, Excreta Odor Contents and Fecal Microflora in Lactation Sows, and Growth Performance in Sucking Piglets. Livest. Sci. 2021, 244, 104293. [Google Scholar] [CrossRef]
- Liu, J.B.; Cao, S.C.; Liu, J.; Xie, Y.N.; Zhang, H.F. Effect of Probiotics and Xylo-Oligosaccharide Supplementation on Nutrient Digestibility, Intestinal Health and Noxious Gas Emission in Weanling Pigs. Asian-Australas. J. Anim. Sci. 2018, 31, 1660–1669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- National Research Council. Nutrient Requirements of Swine; The National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Liu, J.B.; Xue, P.C.; Cao, S.C.; Liu, J.; Chen, L.; Zhang, H.F. Effects of Dietary Phosphorus Concentration and Body Weight on Postileal Phosphorus Digestion in Pigs. Anim. Feed. Sci. Technol. 2018, 242, 86–94. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of AOAC International, 18th ed.; Association of Official Analytical Chemists: Gaithersburg, MA, USA, 2007. [Google Scholar]
- Liu, J.; Pu, Y.-Y.; Xie, Q.; Wang, J.-K.; Liu, J.-X. Pectin Induces an In Vitro Rumen Microbial Population Shift Attributed to the Pectinolytic Treponema Group. Curr. Microbiol. 2015, 70, 67–74. [Google Scholar] [CrossRef]
- Layton, A.; McKay, L.; Williams, D.; Garrett, V.; Gentry, R.; Sayler, G. Development of Bacteroides 16S RRNA Gene TaqMan-Based Real-Time PCR Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water. Appl. Environ. Microbiol. 2006, 72, 4214–4224. [Google Scholar] [CrossRef] [Green Version]
- Bergström, A.; Licht, T.R.; Wilcks, A.; Andersen, J.B.; Schmidt, L.R.; Grønlund, H.A.; Vigsnæs, L.K.; Michaelsen, K.F.; Bahl, M.I. Introducing GUt Low-Density Array (GULDA)—A Validated Approach for QPCR-Based Intestinal Microbial Community Analysis. FEMS Microbiol. Lett. 2012, 337, 38–47. [Google Scholar] [CrossRef] [Green Version]
- Walker, A.W.; Ince, J.; Duncan, S.H.; Webster, L.M.; Holtrop, G.; Ze, X.; Brown, D.; Stares, M.D.; Scott, P.; Bergerat, A.; et al. Dominant and Diet-Responsive Groups of Bacteria within the Human Colonic Microbiota. ISME J. 2011, 5, 220–230. [Google Scholar] [CrossRef]
- Huijsdens, X.W.; Linskens, R.K.; Mak, M.; Meuwissen, S.G.M.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M. Quantification of Bacteria Adherent to Gastrointestinal Mucosa by Real-Time PCR. J. Clin. Microbiol. 2002, 40, 4423–4427. [Google Scholar] [CrossRef] [Green Version]
- Khafipour, E.; Li, S.; Plaizier, J.C.; Krause, D.O. Rumen Microbiome Composition Determined Using Two Nutritional Models of Subacute Ruminal Acidosis. Appl. Environ. Microbiol. 2009, 75, 7115–7124. [Google Scholar] [CrossRef]
- Fernández-No, I.C.; Guarddon, M.; Böhme, K.; Cepeda, A.; Calo-Mata, P.; Barros-Velázquez, J. Detection and Quantification of Spoilage and Pathogenic Bacillus cereus, Bacillus subtilis and Bacillus licheniformis by Real-Time PCR. Food Microbiol. 2011, 28, 605–610. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.B.; Cao, S.C.; Liu, J.; Pu, J.; Chen, L.; Zhang, H.F. Effects of Dietary Energy and Lipase Levels on Nutrient Digestibility, Digestive Physiology and Noxious Gas Emission in Weaning Pigs. Asian-Australas. J. Anim. Sci. 2018, 31, 1963–1973. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zou, T.; Wei, W.; Cao, S.; Zhang, H.; Liu, J. Effects of Dietary Fat Sources during Late Gestation on Colostrum Quality and Mammary Gland Inflammation in Lipopolysaccharide-Challenged Sows. Animals 2020, 10, 319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhai, H.; Adeola, O.; Liu, J. Phosphorus Nutrition of Growing Pigs. Anim. Nutr. 2022, 9, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.B.; Cai, X.; Xiong, H.; Zhang, H.F. Effects of Feeding Frequency on Meat Quality Traits and Longissimus Muscle Proteome in Finishing Pigs. J. Anim. Physiol. Anim. Nutr. 2017, 101, 1175–1184. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.B.; Yan, H.L.; Cao, S.C.; Liu, J.; Zhang, H.F. Effect of Feed Intake Level on the Determination of Apparent and Standardized Total Tract Digestibility of Phosphorus for Growing Pigs. Anim. Feed. Sci. Technol. 2018, 246, 137–143. [Google Scholar] [CrossRef]
- Cao, S.; Tang, W.; Diao, H.; Li, S.; Yan, H.; Liu, J. Reduced Meal Frequency Decreases Fat Deposition and Improves Feed Efficiency of Growing–Finishing Pigs. Animals 2022, 12, 2557. [Google Scholar] [CrossRef]
- Yan, H.; Wei, W.; Hu, L.; Zhang, Y.; Zhang, H.; Liu, J. Reduced Feeding Frequency Improves Feed Efficiency Associated with Altered Fecal Microbiota and Bile Acid Composition in Pigs. Front. Microbiol. 2021, 12, 761210. [Google Scholar] [CrossRef]
- Veizaj-Delia, E.; Piu, T.; Lekaj, P.; Tafaj, M. Using Combined Probiotic to Improve Growth Performance of Weaned Piglets on Extensive Farm Conditions. Livest. Sci. 2010, 134, 249–251. [Google Scholar] [CrossRef]
- Chen, Y.J.; Min, B.J.; Cho, J.H.; Kwon, O.S.; Son, K.S.; Kim, H.J.; Kim, I.H. Effects of Dietary Bacillus-Based Probiotic on Growth Performance, Nutrients Digestibility, Blood Characteristics and Fecal Noxious Gas Content in Finishing Pigs. Asian-Australas. J. Anim. Sci. 2006, 19, 587–592. [Google Scholar] [CrossRef]
- Dowarah, R.; Verma, A.K.; Agarwal, N.; Singh, P.; Singh, B.R. Selection and characterization of probiotic lactic acid bacteria and its impact on growth, nutrient digestibility, health and antioxidant status in weaned piglets. PLoS ONE 2018, 13, e0192978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balasubramanian, B.; Lee, S.I.; Kim, I.-H. Inclusion of Dietary Multi-Species Probiotic on Growth Performance, Nutrient Digestibility, Meat Quality Traits, Faecal Microbiota and Diarrhoea Score in Growing–Finishing Pigs. Ital. J. Anim. Sci. 2018, 17, 100–106. [Google Scholar] [CrossRef]
- Joysowal, M.; Saikia, B.N.; Dowarah, R.; Tamuly, S.; Kalita, D.; Choudhury, K.B.D. Effect of Probiotic Pediococcus acidilactici FT28 on Growth Performance, Nutrient Digestibility, Health Status, Meat Quality, and Intestinal Morphology in Growing Pigs. Vet. World 2018, 11, 1669–1676. [Google Scholar] [CrossRef] [PubMed]
- Tojo, R.; Suárez, A.; Clemente, M.G.; de los Reyes-Gavilán, C.G.; Margolles, A.; Gueimonde, M.; Ruas-Madiedo, P. Intestinal Microbiota in Health and Disease: Role of Bifidobacteria in Gut Homeostasis. World J. Gastroenterol. 2014, 20, 15163–15176. [Google Scholar] [CrossRef] [PubMed]
- Bhattarai, Y. Microbiota-Gut-Brain Axis: Interaction of Gut Microbes and Their Metabolites with Host Epithelial Barriers. Neurogastroenterol. Motil. 2018, 30, e13366. [Google Scholar] [CrossRef] [PubMed]
- Binder, H.J. Role of Colonic Short-Chain Fatty Acid Transport in Diarrhea. Annu. Rev. Physiol. 2010, 72, 297–313. [Google Scholar] [CrossRef]
- Fushimi, T.; Suruga, K.; Oshima, Y.; Fukiharu, M.; Tsukamoto, Y.; Goda, T. Dietary Acetic Acid Reduces Serum Cholesterol and Triacylglycerols in Rats Fed a Cholesterol-Rich Diet. Br. J. Nutr. 2006, 95, 916–924. [Google Scholar] [CrossRef] [Green Version]
- Sakakibara, S.; Yamauchi, T.; Oshima, Y.; Tsukamoto, Y.; Kadowaki, T. Acetic Acid Activates Hepatic AMPK and Reduces Hyperglycemia in Diabetic KK-A(y) Mice. Biochem. Biophys. Res. Commun. 2006, 344, 597–604. [Google Scholar] [CrossRef]
- Curtis, S.E.; Anderson, C.R.; Simon, J.; Jensen, A.H.; Day, D.L.; Kelley, K.W. Effects of Aerial Ammonia, Hydrogen Sulfide and Swine-House Dust on Rate of Gain and Respiratory-Tract Structure in Swine. J. Anim. Sci. 1975, 41, 735–739. [Google Scholar] [CrossRef]
Table 1.
Ingredient and chemical composition of diets.
| Ingredients, g/kg | |
|---|---|
| Corn | 700.0 |
| Soybean meal (43% CP) | 225.0 |
| Wheat bran | 30.0 |
| Soybean oil | 15.0 |
| Monocalcium phosphate | 12.0 |
| Limestone (38% Ca) | 7.0 |
| Salt | 3.0 |
| Choline chloride (50%) | 1.0 |
| L-Lys, 78.8% | 2.8 |
| DL-Met, 98% | 0.5 |
| L-Thr, 97.5% | 1.2 |
| Vitamin premix 1 | 1.5 |
| Mineral premix 2 | 1.0 |
| Total | 1000 |
| Determined nutrients, % | |
| DE, kcal/kg | 3390 |
| Crude protein | 15.31 |
| Ca | 0.656 |
| Total P | 0.55 |
| STDD P | 0.38 |
| NDF | 9.43 |
| Ca: P | 1.19 |
1 Vitamin premix contained per gram of premix: vitamin A, 2640 IU; vitamin D3, 264 IU; vitamin E, 17.6 IU; vitamin K activity, 2.4 mg; menadione, 880 μg; vitamin B12, 15.4 μg; riboflavin, 3.52 mg; D-pantothenic acid, 8.8 mg; niacin, 13.2 mg. 2 Mineral premixes contained per gram of premix: Cu (as copper chloride), 9 mg; I (as ethylenediamine dihydroiodide (EDDI)), 0.36 mg; Fe (as ferrous carbonate), 194 mg; Mn (as manganese oxide), 17 mg; and Zn (as zinc oxide), 149 mg.
Table 2.
Primer sequence for fecal microbiota.
| Bacteria | Upstream Primer (5′ → 3′) | Downstream Primers (5′ → 3′) | AT, °C | R |
|---|---|---|---|---|
| Prevotella | CACCAAGGCGACGATCA | GGATAACGCCTGGACCT | 60 | [19] |
| Bacteroides | CGATGGATAGGGGTTCTGAGAGGA | GCTGGCACGGAGTTAGCCGA | 60 | [20] |
| Bifidobacterium | TCGCGTCYGGTGTGAAAG | GGTGTTCTTCCCGATATCTACA | 60 | [21] |
| Escherichia coli | CATGCCGCGTGTATGAAGAA | CGGGTAACGTCAATGAGCAAA | 60 | [22] |
| Lactobacillus | AGCAGTAGGGAATCTTCCA | ATTCCACCGCTACACATG | 60 | [23] |
| Bacillus | CCTACGGGAGGCAGCAGTAG | GCGTTGCTCCGTCAGACTTT | 59 | [24] |
Note. AT, annealing temperature; R, reference.
Table 3.
Effects of dietary complex probiotic supplementation on growth performance in growing pigs.
Table 3.
Effects of dietary complex probiotic supplementation on growth performance in growing pigs.
| Item | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Body weight, kg | |||||||
| Initial | 28.26 ± 0.26 | 28.43 ± 0.28 | 28.38 ± 0.23 | 48.46 ± 0.15 | 0.575 | 0.753 | 0.731 |
| Day 14 | 38.00 ± 0.16 | 38.18 ± 0.36 | 38.24 ± 0.30 | 38.09 ± 0.29 | 0.628 | 0.585 | 0.881 |
| Day 28 | 48.38 ± 0.31 b | 48.71 ± 0.32 ab | 49.85 ± 0.31 a | 48.99 ± 0.37 ab | 0.036 | 0.005 | 0.359 |
| ADG, kg/day | |||||||
| Day 0–14 | 695 ± 21.7 | 696 ± 34.9 | 704 ± 21.4 | 687 ± 18.6 | 0.984 | 0.815 | 0.914 |
| Day 15–28 | 741 ± 13.4 b | 752 ± 31.3 b | 829 ± 11.2 a | 778 ± 7.78 ab | 0.074 | 0.004 | 0.185 |
| Day 0–28 | 718 ± 11.7 b | 724 ± 8.69 ab | 766 ± 12.3 a | 733 ± 12.4 ab | 0.135 | 0.009 | 0.235 |
| ADFI, kg/day | |||||||
| Day 0–14 | 1515 ± 42.7 | 1502 ± 78.9 | 1490 ± 36.6 | 1861 ± 22.2 | 0.613 | 0.746 | 0.997 |
| Day 15–28 | 1793 ± 40.6 | 1815 ± 79.2 | 1977 ± 29.3 | 1861 ± 22.3 | 0.153 | 0.017 | 0.279 |
| Day 0–28 | 1654 ± 29.2 | 1659 ± 21.2 | 1733 ± 17.8 | 1660 ± 24.0 | 0.340 | 0.034 | 0.265 |
| F: G | |||||||
| Day 0–14 | 2.18 ± 0.02 | 2.16 ± 0.01 | 2.12 ± 0.03 | 2.12 ± 0.02 | 0.058 | 0.049 | 0.814 |
| Day 15–28 | 2.42 ± 0.02 | 2.41 ± 0.03 | 2.38 ± 0.02 | 2.39 ± 0.01 | 0.378 | 0.293 | 0.726 |
| Day 0–28 | 2.30 ± 0.01 | 2.29 ± 0.02 | 2.26 ± 0.02 | 2.27 ± 0.01 | 0.121 | 0.092 | 0.711 |
Note. ADFI, average daily feed intake; ADG, average daily gain; F:G, the ratio of feed to gain; a, b Means in the same row with different superscripts differ significantly (p < 0.05).
Table 4.
Effects of dietary complex probiotic supplementation on nutrient digestibility in growing pigs.
Table 4.
Effects of dietary complex probiotic supplementation on nutrient digestibility in growing pigs.
| Item, % | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Day 14 | |||||||
| Dry matter | 84.99 ± 0.60 | 84.48 ± 0.72 | 84.78 ± 0.77 | 83.89 ± 0.85 | 0.502 | 0.851 | 0.679 |
| Crude protein | 83.69 ± 0.79 | 83.51 ± 0.94 | 82.89 ± 1.24 | 82.59 ± 0.93 | 0.566 | 0.598 | 0.864 |
| Gross energy | 83.65 ± 0.94 | 83.85 ± 0.74 | 82.99 ± 0.95 | 82.85 ± 0.83 | 0.691 | 0.618 | 0.644 |
| Day 28 | |||||||
| Dry matter | 82.99 ± 0.84 | 83.22 ± 0.93 | 82.63 ± 0.91 | 82.53 ± 1.02 | 0.860 | 0.798 | 0.736 |
| Crude protein | 81.59 ± 0.96 | 80.67 ± 0.81 | 81.50 ± 0.92 | 81.88 ± 1.04 | 0.831 | 0.952 | 0.457 |
| Gross energy | 83.41 ± 0.73 | 84.35 ± 0.69 | 83.09 ± 0.61 | 82.96 ± 0.71 | 0.949 | 0.756 | 0.230 |
Table 5.
Effects of dietary complex probiotic supplementation on the blood profile in growing pigs.
| Item | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Total cholesterol, mmol/L | 2.41 ± 0.03 a | 2.36 ± 0.02 a | 2.25 ± 0.03 b | 2.24 ± 0.03 b | 0.001 | 0.0003 | 0.385 |
| HDL, mmol/L | 0.99 ± 0.03 | 0.96 ± 0.04 | 1.01 ± 0.03 | 1.03 ± 0.04 | 0.839 | 0.707 | 0.387 |
| LDL, mmol/L | 1.05 ± 0.06 | 1.09 ± 0.05 | 1.08 ± 0.03 | 1.08 ± 0.05 | 0.607 | 0.718 | 0.729 |
| Triacylglycerides, mmol/L | 0.47 ± 0.03 | 0.45 ±0.04 | 0.44 ±0.04 | 0.46 ±0.04 | 0.632 | 0.614 | 0.856 |
| Glucose, mmol/L | 7.07 ± 0.30 a | 6.13 ± 0.30 b | 5.76 ± 0.33 c | 5.86 ± 0.35 c | 0.006 | 0.011 | 0.505 |
| Total protein, g/L | 70.05 ± 1.06 | 70.83 ± 1.28 | 69.84 ± 1.07 | 71.03 ± 1.08 | 0.709 | 0.902 | 0.555 |
| Urea nitrogen, mmol/L | 4.01 ± 0.19 | 3.91 ± 0.28 | 3.96 ± 0.27 | 4.00 ± 0.39 | 0.876 | 0.913 | 0.835 |
Note. HDL, high-density lipoprotein; LDL, low-density lipoprotein; a, b, c Means in the same row with different superscripts differ significantly (p < 0.05).
Table 6.
Effects of dietary complex probiotic supplementation on fecal score in growing pigs.
| Item | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Day 7 | 3.37 ± 0.06 | 3.23 ± 0.12 | 3.43 ± 0.06 | 3.49 ± 0.02 | 0.931 | 0.638 | 0.089 |
| Day 14 | 3.42 ± 0.05 | 3.35 ± 0.06 | 3.43 ± 0.06 | 3.40 ± 0.06 | 0.760 | 0.865 | 0.332 |
| Day 21 | 3.34 ± 0.06 | 3.52 ± 0.04 | 3.42 ± 0.06 | 3.44 ± 0.0.7 | 0.099 | 0.354 | 0.073 |
| Day 28 | 3.39 ± 0.04 | 3.45 ± 0.06 | 3.28 ± 0.03 | 3.09 ± 0.12 | 0.247 | 0.323 | 0.258 |
Note. Fecal score = 1 hard, dry pellet; 2 firm, formed stool; 3 soft, moist stool that retains shape; 4 soft, unformed stool that assumes the shape of the container; 5 watery liquid that can be poured.
Table 7.
Effects of dietary complex probiotic supplementation on fecal microbiota in growing pigs.
| Item, Lg (Copies/g) | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Prevotella | 10.59 ± 0.24 | 10.34 ± 0.18 | 10.37 ± 0.21 | 10.40 ± 0.27 | 0.418 | 0.523 | 0.651 |
| Bacteroides | 11.79 ± 0.21 | 11.76 ± 0.20 | 11.63 ± 0.31 | 11.78 ± 0.21 | 0.824 | 0.663 | 0.863 |
| Bifidobacterium | 11.80 ± 0.36 | 12.01 ± 0.29 | 13.19 ± 0.33 | 13.10 ± 0.37 | 0.036 | 0.010 | 0.273 |
| Escherichia coli | 10.64 ± 0.24 | 10.78 ± 0.31 | 10.95 ± 0.28 | 10.84 ± 0.44 | 0.581 | 0.536 | 0.979 |
| Lactobacillus | 7.60 ± 0.17 | 7.65 ± 0.18 | 7.55 ± 0.19 | 7.51 ± 0.14 | 0.896 | 0.864 | 0.733 |
| Bacillus | 8.48 ± 0.26 | 8.35 ± 0.19 | 8.32 ± 0.18 | 8.52 ± 0.17 | 0.719 | 0.583 | 0.860 |
Table 8.
Effects of dietary complex probiotic supplementation on fecal SCFAs in growing pigs.
| Item, mmol/L | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Lactate | 2.48 ± 0.14 | 2.60 ± 0.16 | 2.66 ± 0.20 | 2.70 ± 0.25 | 0.466 | 0.558 | 0.893 |
| Acetate | 60.29 ± 3.66 b | 65.76 ± 2.44 ab | 72.98 ± 2.79 a | 71.36 ± 2.66 ab | 0.013 | 0.008 | 0.821 |
| Propionate | 18.98 ± 0.77 | 18.51 ± 1.80 | 18.21 ± 1.24 | 17.94 ± 1.27 | 0.573 | 0.652 | 0.956 |
| Isobutyrate | 2.74 ± 1.77 | 2.86 ± 0.23 | 2.91 ± 0.19 | 2.90 ± 0.23 | 0.537 | 0.580 | 0.891 |
| Butyrate | 8.14 ± 0.70 | 8.23 ± 0.81 | 10.90 ± 0.90 | 10.91 ± 0.94 | 0.100 | 0.038 | 0.251 |
| Isovalerate | 5.29 ± 0.45 | 5.48 ± 0.48 | 5.58 ± 0.52 | 5.71 ± 0.42 | 0.595 | 0.687 | 0.944 |
| Valerate | 3.64 ± 0.27 | 3.68 ± 0.24 | 3.93 ± 0.34 | 3.95 ± 0.27 | 0.536 | 0.506 | 0.776 |
| Total SCFAs | 99.07 ± 4.61 | 104.5 ± 4.17 | 114.5 ± 5.60 | 112.8 ± 4.82 | 0.063 | 0.044 | 0.722 |
Note. SCFAs, short chain fatty acids; a, b Means in the same row with different superscripts differ significantly (p < 0.05).
Table 9.
Effects of dietary complex probiotic supplementation on fecal gas emissions in growing pigs.
Table 9.
Effects of dietary complex probiotic supplementation on fecal gas emissions in growing pigs.
| Item, ppm | Probiotics (% of Diet) | p-Value | |||||
|---|---|---|---|---|---|---|---|
| 0 (CON) | 0.05 | 0.1 | 0.2 | CON vs. Probiotics | Linear | Quadratic | |
| Day 14 | |||||||
| Methyl mercaptans | 4.72 ± 0.11 | 4.74 ± 0.17 | 4.84 ± 0.18 | 4.82 ± 0.19 | 0.697 | 0.634 | 0.837 |
| NH3 | 4.00 ± 0.13 a | 3.62 ± 0.14 ab | 3.38 ± 0.17 b | 3.43 ± 0.15 ab | 0.007 | 0.010 | 0.703 |
| H2S | 2.75 ± 0.11 a | 2.71 ± 0.10 a | 2.42 ± 0.14 ab | 2.20 ± 0.14 b | 0.074 | 0.086 | 0.432 |
| Acetic acid | 6.88 ± 0.19 | 6.79 ± 0.23 | 6.68 ± 0.20 | 6.74 ± 0.26 | 0.589 | 0.562 | 0.988 |
| CO2 | 10,813 ± 226 | 10,953 ± 211 | 10,848 ± 355 | 10,969 ± 326 | 0.751 | 0.935 | 0.751 |
| Day 28 | |||||||
| Methyl mercaptans | 4.97 ± 0.23 | 5.13 ± 0.19 | 5.00 ± 0.25 | 5.05 ± 0.26 | 0.750 | 0.933 | 0.640 |
| NH3 | 4.16 ± 0.14 a | 4.05 ± 0.11 a | 3.47 ± 0.14 b | 3.36 ± 0.14 b | 0.010 | 0.002 | 0.184 |
| H2S | 3.06 ± 0.14 a | 2.99 ± 0.13 ab | 2.51 ± 0.11 b | 2.50 ± 0.12 b | 0.031 | 0.025 | 0.269 |
| Acetic acid | 7.37 ± 0.26 | 7.48 ± 0.25 | 7.39 ± 0.22 | 7.33 ± 0.29 | 0.932 | 0.972 | 0.768 |
| CO2 | 12,591 ± 243 | 12,700 ± 258 | 12,716 ± 330 | 12,575 ± 291 | 0.832 | 0.772 | 0.902 |
Note. a, b Means in the same row with different superscripts differ significantly (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Wang, J.; Li, S.; Tang, W.; Diao, H.; Zhang, H.; Yan, H.; Liu, J. Dietary Complex Probiotic Supplementation Changed the Composition of Intestinal Short-Chain Fatty Acids and Improved the Average Daily Gain of Growing Pigs. Vet. Sci. 2023, 10, 79. https://doi.org/10.3390/vetsci10020079
AMA Style
Wang J, Li S, Tang W, Diao H, Zhang H, Yan H, Liu J. Dietary Complex Probiotic Supplementation Changed the Composition of Intestinal Short-Chain Fatty Acids and Improved the Average Daily Gain of Growing Pigs. Veterinary Sciences. 2023; 10(2):79. https://doi.org/10.3390/vetsci10020079
Chicago/Turabian StyleWang, Juan, Shuwei Li, Wenjie Tang, Hui Diao, Hongfu Zhang, Honglin Yan, and Jingbo Liu. 2023. "Dietary Complex Probiotic Supplementation Changed the Composition of Intestinal Short-Chain Fatty Acids and Improved the Average Daily Gain of Growing Pigs" Veterinary Sciences 10, no. 2: 79. https://doi.org/10.3390/vetsci10020079
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
