Characterization, Expression Profiling, and Functional Analyses of a 4CL-Like Gene of Populus trichocarpa

Abstract

Adenosine 5′-monophosphate (AMP) (adenylate)-forming acetyl-CoA synthetase (ACS) catalyzes the formation of acetyl-coenzyme A (CoA), and the ACS family is closely related to the 4-coumarate CoA ligase (4CL) family. In this study, a 4CL-like gene was cloned from Populus trichocarpa and named Pt4CL-like. Characterization of Pt4CL-like, using bioinformatics, showed that it contained box I and box II domains at the end of the C-terminal sequence, and there is a characteristic sequence of ACS, namely, peroxisome-targeting sequence (PTS). Real-time PCR results showed that the 4CL-like gene was expressed in all tissues tested, and was highly expressed in the stems. A denaturation and renaturation process was conducted, and the recombinant Pt4CL-like protein was purified through HisTrap^TM high performance affinity chromatography. It showed Pt4CL-like protein did not catalyze substrates of 4CL, but could significantly catalyzed sodium acetate. These results indicate that Pt4CL-like protein belongs to the ACS family, providing a theoretical basis for further analysis and comparison of the functions of adenylate-forming enzymes and 4CL family.

1. Introduction

The genome of Populus trichocarpa contains a large number of genes encoding carboxylic acid-activating enzymes, including long-chain fatty acyl-coenzyme A (CoA) synthetases, 4-coumarate: CoA ligases (4CL), and 4CL-like proteins of unknown biochemical function. The adenylate-forming enzyme superfamily is divided into several subfamilies according to substrate, including the acetyl coenzyme ligase, short-chain coenzyme ligase, long-chain coenzyme ligase, coumaric acid coenzyme ligase, luciferase, and adenylate domain nonribosomal peptide synthetase subfamilies [1]. In addition, adenylate-forming enzymes contain the highly conserved Adenosine 5′-monophosphate (AMP)-binding and Adenosine triphosphate (ATP)-dependent domains, which indicates the specific functions of enzymes. Adenylate-forming enzymes utilize a two-step mechanism. In the first step, ACS combines acetate with ATP to form the intermediate acetyl adenylate (AcAMP), referred to as adenylate, with concomitant release of pyrophosphate. The second step is characterized by the formation of acyl-CoA and AMP, causing CoA and AMP to be released [2,3,4].

4CL plays an important role in the biosynthesis of lignin. It can convert various numbers of cinnamic acid derivatives, including coumarate, caffeate, and ferulate, into coenzyme A (CoA)-linked intermediates, and these activated phenolic acids serve as precursors for the biosynthesis of lignin [5,6]. Previous studies have shown that 4CL enzymes expressed in higher plants have multiple isoforms, and they often have distinct catalytic properties and expression profiles that regulate CoA ligation fluxes in specific plant tissues. For example, the 4CL genes of Arabidopsis thaliana, At4CL1 and At4CL2, are mainly expressed in lignifying cells and are involved in the formation of lignin, whereas At4CL3 is expressed in a broad range of cell types and is involved in the flavonoid biosynthesis pathway. Meanwhile, At4CL4 is hardly detectable and promotes the formation of lignin [7,8]. In accordance with Arabidopsis thaliana, Populus trichocarpa also has multiple isoforms. Ptr4CL3 and Ptr4CL5 have high transcriptional levels in differentiating xylem. Ptr4CL3 can regulate the β-coumaric acid and caffeic acid CoA ligation pathways, while Ptr4CL5 regulates only the caffeic acid pathway, and caffeic acid modulates the CoA ligation flux for monolignol biosynthesis [9,10,11].

With further research and complete sequencing of the Arabidopsis genome, researchers have gradually uncovered eight genes in Arabidopsis that are highly similar to the 4CL conserved domain containing box I and box II, which can be classified as 4CL-like genes [12,13,14]. However, these genes have no corresponding 4CL substrates (β-coumaric acid, caffeic acid, ferulic acid, 5-hydroxyferulic acid, and erucic acid), and have no direct relationship with the synthesis of lignin or flavonoid compounds in terms of expression [14]. Although most 4CL-like genes have unknown functions, several have specific biochemical roles. For example, the At1g20510 protein exhibits cyclopentane-1-octanoic acid (OPC-8) CoA ligase activity, which is an essential step in jasmonate biosynthesis [15]. These results show that 4CL-like genes may belong to the acetyl-CoA synthetase (ACS) family [16]. Compared to the herb Arabidopsis thaliana, the poplar tree has a larger genome, in which more 4CL-like genes have been cloned and characterized. It has been predicted that the total poplar genome contains 17 4CL genes [10]. Five of these genes have been recognized as 4CL genes, while the others have not clearly been identified, but generally do not show the catalytic activity characteristic of 4CL [17]. Peroxisome-targeting sequence 1 (PTS1) is generally in the C-terminal region of the majority of 4CL-like enzymes and targets peroxisome [1,18]. PTS1 is characterized by a sequence consisting of three amino acid residues, and is considered a characteristic sequence of peroxisomes. Therefore, the suspected 4CL-like proteins with a PTS1 sequence are highly likely to have CoA ligase activity, rather than acting as a true 4CL. Recently, studies have shown that the fused PTS1 sequences of these proteins participate in the jasmonic acid synthesis pathway, playing the role of CoA ligase [15,18]. However, due to the high homology sequence in the supergene family of adenylate synthase, it is very difficult to identify this using gene sequence analyses, therefore, it is necessary to use different substrates for enzymatic reactions to identify the function of 4CL-like protein. Based on previous findings, the characterization, expression profiling, and function of 4CL-like genes should be investigated.

In this study, we performed molecular cloning, characterization, and functional analyses of the 4CL-like gene of P. trichocarpa. We investigated the functions of this enzyme and its expression patterns in different tissues and under various abiotic stresses. The results show that the 4CL-like gene belongs to the ACS family. In addition, the 4CL-like gene was expressed in roots, stems, leaves, and petioles, but the expression level are different. In addition, the results showed high transcriptional levels in the upper stem region and low expression in roots. Moreover, the Pt4CL-like gene can be induced with 200 mM NaCl, 200 μM abscisic acid, 2 mM H₂O₂, 4 °C cold stress, or 10% PEG₆₀₀₀.

2. Materials and Methods

2.1. Materials

Three-month-old seedlings of P. trichocarpa grown on sterile half-strength Murashige and Skoog (MS) medium (pH 5.8). Total RNA was extracted from P. trichocarpa plants. Escherichia coli strains, including Top10 cells and BL21 (DE3) cells, were utilized. Top10 cells were employed in cloning and propagation, and BL21 (DE3) cells were used for protein expression. PCR cleanup kits were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). Primer synthesis and DNA sequencing were performed by Invitrogen Biotechnology Company (Shanghai, China).

2.2. RNA Isolation and cDNA Synthesis

RNAs were extracted from different tissue parts using the Biomiga Miniprep kit, according to the manufacturer’s instruction, and cDNA was synthesized with 5× PrimeScript Master Mix (Takara, Dalian, China), according to the manufacturer’s instruction.

2.3. Cloning of the Open Reading Frame (ORF) and Rapid Amplification of cDNA Ends (RACE)

The full-length sequence, including the 3′- and 5′-untranslated regions of the 4CL-like gene, was achieved using rapid amplification of cDNA ends (RACE). To identify the 5′-untranslated regions, reverse primers 5′ GSP1 and 5′ GSP2 designed according to the homology, and the forward primers universal primer mix (UPM) and nest universal primer mix (NUP) were used to carry out the PCR. To achieve the 3′-untranslated regions, the forward primers 3′ GSP1 and 3′ GSP2 designed based on the homology sequences, and the 3′-outer and 3′-inner reverse primers were adapted to execute the PCR. The above PCR products were ligated into the PEASY-T3 vector (pEASY-T3 cloning kit, Beijing, China) and sequenced. The opening reading frame of the cDNA encoding the 4CL-like gene was amplified via PCR. The primers used are shown in

Table 1. Gene-specific primers.

Primer	Direction	Nucleotide Sequence (5′–3′)
Pt4CL-like F	Forward	ATGGCAGACAACAACAACCTC
Pt4CL-like R	Reverse	TCAGAGCTTGGAGGTTGCG
3′GSP-1-Pt4CL-like	Forward	TATCCAGGGGTTACGATTTT
3′Outer	Reverse	TACCGTCGTTCCACTAGTGATTT
3′GSP-2-Pt4CL-like	Forward	GCAGGTCGGGCAGTTCC
3′Inter	Reverse	CGCGGATCCTCCACTAGTGATTTCACTATAGG
UPM	Forward	CTAATACGACTCACTATAGGGCAAGCAAGCAGTGGTATCAAACGCAGAGT (long)
		CTAATACGACTCACTATAGGGC (short)
5′GSP-1-Pt4CL-like	Reverse	AGGAAACGGTATTACAGCAG
NUP	Forward	AAGCAGTGGTATCAACGCAGAGT
5′GSP-2-Pt4CL-like	Reverse	ATCCTTTCGGAGAATCTT
q-Pt4CL-like	Forward	CTGCACTGTGTTTCCGTTTC
q-Pt4CL-like	Reverse	GACGCTATTGACATGAGCAG
q-actin	Forward	TAACGCTTTGCTGGTGAACC
q-actin	Reverse	GCAATGCCTCTAGTTCTGCC
PET-Pt4CL-like	Forward	ATAAGAATGCGGCCCTCATGGCAGACAACAACAACCTC
PET-Pt4CL-like	Reverse	GGAATTCCATATGTCAGAGCTTGGAGGTTGCG

. Then, PCR was performed in a volume of 50 μL containing 2.0 µL template cDNA, 1.5 µL each of the forward and reverse primers, 5.0 µL 10× PCR buffer (Mg2+ plus), 4 µL dNTPs, and 0.5 µL rTaq DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China). The reaction was performed as follows: 95 °C for 7 min, 35 cycles of 95 °C for 50 s, 58 °C for 50 s, and 72 °C for 2 min and, finally, 72 °C for 10 min. Next, the PCR product was purified and cloned into the PEASY-T3 vector, and then transformed into E. coli Trans TI. According to the results of a color reaction system using X-Gal and isopropyl β-D-1-thiogalactopyranoside (IPTG), the positive clones were isolated and sequenced (Invitrogen). The ExPASy online tool (http://www.expasy.org/) was used to analyze the nucleotide sequence, and deduce the amino acid sequence, and open reading frame (ORF) of the 4CL-like gene. The molecular weights (MWs) and predicted isoelectric points (pIs) were also calculated using ExPASy online. The Scanprosite search function of the PROSITE database in ExPASy online was used to predict the structural and functional domains of 4CL-like protein. Also, the PORTER server (http://distil.ucd.ie/porter/) at Dublin University and the SWISS-MODEL server (http://www.expasy.org/swissmod/SWISS-MODEL.html) were used to analyze the advanced structure of proteins. MEGA software (ver. 5.0, MEGA, Arizona State University, USA) was used to analyze the multiple alignment and construct a phylogenetic tree of 4CL-like genes.

2.4. Vector Construction and Heterologous Expression

The ORF of Pt4CL-like and the restriction site was amplified via PCR (Table 1). Then, the PCR product was cloned into pET28a via two restriction sites (NotI and NdeI). The vector pET28a-Pt4CL-like was transformed into Escherichia coli BL21 (DE3) cells. E. coli BL21 (DE3)/pET28a-Pt4CL-like was grown overnight in 3 mL Luria-Bertani broth (LB) medium containing 50 μg/mL kanamycin, and transferred into 1 L LB medium containing kanamycin. This 1 L LB was incubated at 37 °C with 220 rpm. When the optical density (OD) at 600 nm was 0.6, 1 mM IPTG was added to l L LB to induce expression and with incubation at 37 °C, 220 rpm for 4 h. After expression was induced, the sediment was pelleted, and the bacteria were collected. The uninduced and induced solutions were analyzed via 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, Solarbio Co., Beijing, China). Subsequently, the collected bacteria were suspended and mixed with 100 mL bacterial lysis buffer (20 mM Tris-base (Solarbio Co., Beijing, China), 500 mM NaCl (Solarbio Co., Beijing, China), and 20 mM imidazole (Solarbio Co., Beijing, China). Next, the cell suspension was sonicated on ice using 2 bursts and 6 s cooling periods for 10 min using an ultrasonic cell disruptor. The lysate was centrifuged at 4 °C, 14,000× g for 15 min. The precipitate and supernatant were analyzed via 12% SDS-PAGE.

2.5. Denaturation and Renaturation of Recombinant Protein

Most of the target protein remained in the form of inclusion bodies in the precipitate after sonication, and no target protein was detected in the supernatant through 12% SDS-PAGE. Therefore, the denaturation and renaturation technique was used to achieve target proteins with biological activity. The process of denaturation was carried out as follows: First, inclusion body washing solution 1 (2 M urea, 20 mM Tris, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 M NaCl, and 1% Triton X-100, pH 8.5) was used to wash the collected precipitate three times. Subsequently, the collected solution was centrifuged, and precipitate was washed two times with inclusion body washing solution 2 (4 M urea, 20 mM Tris, 1 mM EDTA, 1 M NaCl, and 1% Triton X-100, pH 8.5) and the collected solution was centrifuged at 13,000 rpm for 20 min at 4 °C. Then the precipitate was washed once with inclusion body washing solution 3 (6 M urea, 20 mM Tris, 1 mM EDTA, 1 M NaCl, and 1% Triton X-100, pH 8.5). Finally, the precipitate was collected and dissolved in inclusion body dissolving solution 4 (8 M urea, 20 mM Tris, 1 mM EDTA, 1 M NaCl, and 1% Triton X-100, pH 8.5). The collected denaturation solution was stored for 48 h at 4 °C, and then centrifuged at 13,000 rpm for 20 min at 4 °C. The inclusion bodies in the dissolving solution were added dropwise to 20 mM Tris (pH 8.5). The process of renaturation is more complex and takes longer, as precipitation of protein from the solution does not occur during the process of renaturation. Renaturation buffer (4–0.5 M urea, 0.5 M NaCl, 10 mM Tris, 0.5 mM EDTA, 1 mM L-arginine, 1 mM reduced L-glutathione, 0.2 mM oxidized L-glutathione, and 5 mM DL-Dithiothreitol (DTT), pH 8.5) was added sequentially around the denatured protein contained in the dialysis bag, and dialyzed overnight in a 4 °C chromatography cabinet. During dialysis, the concentration was reduced and binding buffer (20 mM Tris-base, 500 mM NaCl, and 20 mM imidazole) was used as the final dialysis buffer.

2.6. Purification of the Recombinant Pt4CL-Like and Western Blotting

The regenerated solution was applied to a Ni²⁺-NTA-chelating column equilibrated with Ni-NTA binding buffer (20 mM Tris-base, 500 mM NaCl, and 20 mM imidazole). After washing with Ni-NTA washing buffer until the baseline absorbance was reached, the column was washed with 250 mM imidazole in buffer (20 mM Tris-HCl and 500 mM NaCl, pH 8.5) at a flow rate of 1 mL/min. Fractions were collected and analyzed with 12% SDS-PAGE. Following overnight dialysis at 4 °C with phosphate-buffered saline (PBS), the protein was lyophilized. The purified proteins separated by SDS-PAGE were transferred to a polyvinylidene difluoride (PVDF) membrane (Solarbio Co., Beijing, China). The membrane was incubated with horseradish peroxidase (HRP)-conjugated rabbit anti-His Tag antibody IgG (Zhongshan Biotechnique, Beijing, China) at 4 °C overnight.

2.7. Enzymatic Activity of Pt4CL-Like

4CL activity was determined through the spectrophotometric assay described by Knobloch et al. The system for the reaction of the enzyme activity assay included 2 μg of purified protein, 5 mM ATP, 0.33 mM CoA, 500 mM Tris-HCl (pH 7.8), and 25 mM MgCl₂. After the reaction mixtures were mixed, they were incubated at room temperature for 10 min, and the absorbances of 4-coumaroyl-CoA, caffeoyl-CoA, and feruloyl-CoA were monitored by spectrophotometry at wavelengths of 333, 363, and 345 nm, respectively [14,19]. The reaction mixture contained 12.5 µL 0.2 M MgCl₂, 50 µL 0.1 M ATP, 30 µL 20 mM CoA, 30 µL 0.2 M sodium acetate, 50 µL hydroxylamine solution, and a specific amount of protein. The reaction was initiated using ATP and carried out at 37 °C for 10 min. A volume of 1 mL ferric chloride reagent (0.5 mol·L⁻¹ ferric chloride, 0.6 mol·L⁻¹ hydrochloric acid) was added to stop the reaction. Next, the tubes were centrifuged at 12,000× g for 2 min, and the mixed solution was measured at 540 nm with a spectrophotometer. To determine the optima of both pH and temperature, sodium acetate was used as the substrate. Phosphate buffer (10 mM), having a pH of 4.0 to 8.0, was used to provide different pH conditions for the enzyme reaction. When analyzing the temperature distribution, the optimum pH of each ACS was used. All mixtures were held at each temperature for 10 min before the start of the reaction. The protein activity was determined by the above method at 4, 10, 20, 30, 35, 37, 40, 50, and 55 °C temperatures.

2.8. Transcription of Pt4CL-Like in Various Tissues

Total RNA was isolated from mature and young leaves, upper and lower stems, petioles, and roots of P. trichocarpa, according to the reagent manufacturer’s instructions. qRT-PCR was performed with a Real-Time PCR System (Applied Biosystems, Carlsbad, California, USA) using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) and the SYBR Green PCR Kit (Takara, Dalian, China). qRT-PCR primers were designed for Pt4CL-like (Table 1), and the housekeeping gene actin was used as an internal control. qRT-PCR was carried out as follows: initial incubation at 95 °C for 5 min, followed by 40 cycles of 45 s at 95 °C, 45 s at the annealing temperature of 60 °C, and 45 s at 72 °C and, then, a final incubation for 10 min at 72 °C. Triplicate measurements were used to determine the values for each parameter, and each data point represented the mean of the measurements. The treatments for analyses of transcription of Pt4CL-like in various tissues were repeated three times.

2.9. Expression of Pt4CL-Like in Response to Abiotic Stress Treatments

Populus trichocarpa seedlings treated with 200 mM NaCl, 200 μm abscisic acid (ABA), or 2 mM hydrogen peroxide (H₂O₂) were sampled at 0, 2, 4, 6, 8, 12, 24, and 48 h, and those subjected to 4 °C cold stress or 10% PEG₆₀₀₀ were collected after 1, 2, 3, 4, 5, 6, and 7 days. Following treatment, RNA was extracted from poplar leaves according to the above method. Subsequently, qRT-PCR was performed as described above. Triplicate measurements were used to determine the values for each parameter, and each data point represented the mean of these measurements. The experiments of expression of Pt4CL-like in response to abiotic stress treatments were repeated three times.

3. Results

3.1. Molecular Cloning and Sequence Analyses of Pt4CL-Like

Full-length cDNA of Pt4CL-like was isolated from P. trichocarpa, referring to Pt4CL-like (XP_002307770.2). The Pt4CL-like ORF is 1665 base pairs (bp) in length, and encodes a peptide of 554 amino acids. Based on the sequence of Pt4CL-like, we designed specific primers and achieved full-length amplification of Pt4CL-like using RACE. The full gene length, ORF size, amino acid sequence length, MW, and pI of Pt4CL-like deduced protein are shown in

Table 2. Length, open reading frame (ORF), amino acid sequence length, molecular weight, and predicted isoelectric points (pI) of Pt4CL-like deduced protein are shown.

Gene Name	Full Length(bp)	ORF (bp)	Amino Acid Sequence (aa)	Molecular Weight	pI
Pt4CL-like	2127	1665	554	60.33	7.6

. The deduced amino acid sequence of Pt4CL-like showed a high degree of homology with ACS sequences from other plant species, e.g., Ricinus communis (XP_017975597.1, 80.87% identity), Durio zibethinus (XP_007225144.1, 79.78% identity), Gossypium arboreum (AMJ39459, 78.88% identity), and Corchorus olitorius (CAD22530.1, 73.29% identity) (Figure 1). Generally speaking, the box I and box II domains of 4CL were completely conserved, according to the sequence alignment and analyses of Martínez-Blanco et al. [20], whereas the box I domain of the 4CL-like gene was relatively conserved, and the box II domain was generally not conserved. At4CL1 (NP_001077697.1), At4CL2 (AF_106086.1), At4CL3 (AF_106087.1), Pt4CL1 (XP_002297699.20, Pt4CL4 (XP_002324477.2), and Pt4CL5 (XP_002304825.2) were chosen to identify conserved sequences. The box I domain (SSGTTGLPKGV) and the box II domain (GEICIRG) were conserved according to the sequence alignment (Figure 2A,B), but the box I domain and the box II domain were not conserved compared to sequences from Populus trichocarpa (XP_002307770.2), Hevea brasiliensis (XP_021666022.1), Jatropha curcas (XP_012073683.1), Manihot esculenta (XP_021601125.1), and others (Figure 2C,D). For example, the main differences in Pt4CL-like were changes in proline to serine, and leucine to glutamate, in box I. Leucine is a nonpolar amino acid, while glutamate is a polar and negatively charged amino acid; similarly, proline is a nonpolar amino acid, while serine is a polar amino acid. Changes were also observed in the box II domain, with isoleucine changing to leucine and cysteine changing to tryptophan. Tryptophan is a nonpolar amino acid, while cysteine is a polar and uncharged amino acid (Figure 2 and Figure S1).

Changes in the polarity of amino acids may lead to changes in protein properties, and, therefore, we speculate that Pt4CL-like may have the different catalytic activity to 4CL [21,22].

3.2. 3D Structure and Phylogenetic Analyses

Modeling of 3D structures was conducted using the SWISS-MODEL server, and the 3D structures of Pt4CL1, Pt4CL4, Pt4CL5, At4CL1, At4CL2, and At4CL3 were predicted. Furthermore, 4CL-like proteins from Populus trichocarpa, Hevea brasiliensis, Jatropha curcas, and Manihot esculenta were also predicted. Structure comparison was used to identify similarities among protein sequences, and the results indicated that the box I domain of Pt4CL1, Pt4CL4, Pt4CL5, At4CL1, At4CL2, and At4CL3 was a conserved sequence, as was the box II domain of Pt4CL1, Pt4CL4, Pt4CL5, At4CL1, At4CL2, and At4CL3 (Figure S2A,B). However, the box I and box II domains of 4CL-like proteins were not conserved, and only the conserved PTS sequence was observed to have C-terminal modification (Figure S2C). For investigating the evolutionary relationships between the 4CL-like protein and other adenylate-forming enzymes, we performed phylogenetic analysis using the MEGA 5.0 program. The phylogenetic analysis results illustrated that 4CL-like had high homology with other amino acid sequences from ACS, and 4CL-like protein was most closely related to evolution of other ACS protein sequences, such as those from Manihot esculenta (XP_021601125.1) and Jatropha curcas (XP_012073683.1) (Figure 3).

3.3. Prokaryotic Expression, Purification, and Western Blot

The vector pET28a was used as an expression vector, and the ORF of the 4CL-like gene of P. trichocarpa was inserted into this prokaryotic vector between the NotI and NdeI restriction sites (Figure 4A). Then, the recombinant plasmid pET28a-Pt4CL-like was transformed to E. coli strain BL21 and the recombinant expression bacteria were obtained. After induction with 1 mM IPTG for 4 h, the Pt4CL-like protein was expressed (Figure 4B), and analyses of the supernatant and precipitate indicated that the recombinant protein was present in the form of inclusion bodies (Figure 4C). To identify the influence of IPTG concentration, temperature, and shaking speed on protein expression, treatments of 0.3, 0.5, and 1 mM IPTG, at 16 and 37 °C, and at 110 and 220 rpm, were carried out. Through the analysis of different concentrations of IPTG, different induction temperatures and different induction speed, we found that the Pt4CL-like protein always exists in the precipitate, and no target protein was detected in the supernatant when the recombinant bacteria were induced to express protein using low concentrations of IPTG, low induction temperatures and low induction speeds, so we had to carry out denaturation and renaturation of the protein (Figure 4D).

The targeted protein was expressed in the precipitate according to 12% SDS-PAGE analyses and, thus, was considered an inclusion body. Therefore, manipulation of denaturation and renaturation conditions was carried out to focus on inclusion bodies. The inclusion body could not be released when 2 M urea and 4 M urea was used to manipulate the precipitate (Figure 5A). A small amount of the inclusion body was released when 6 M urea was used to treat the precipitate (Figure 5A). When 8 M urea was used, the inclusion body could be released according to 12% SDS-PAGE (Figure 5A). The entire denaturation process is shown in Figure 6 (Left). The inclusion body that was released had no biological activity and, therefore, the process of renaturation was carried out in vitro to restore protein activity. The entire renaturation process is shown in Figure 6 (Right).

HisTrap HP affinity chromatography was used to purify the recombinant Pt4CL-like protein. His-tagged proteins were captured using Ni-IDA resin, washed repeatedly in a buffer containing 20 mM imidazole, and eluted in a buffer containing 250 mM imidazole (Figure 5C). The Pt4CL-like protein fraction was eluted with 250 mM imidazole, as shown in 12% SDS-PAGE analyses (Figure 5B), and a pure band of 60 kDa was observed, in agreement with the theoretical mass of Pt4CL-like protein (57 kDa) with the His tag protein. Western blotting was used to determine whether Pt4CL-like protein could be specifically recognized by rabbit antiserum against His-Pt4CL-like expressed in E. coli BL21 (DE3). The rabbit antiserum successfully identified His-Pt4CL-like, confirming that the peptides expressed by BL21 (DE3) were Pt4CL-like protein (Figure 5B).

3.4. Enzymatic Activity of Pt4CL-Like Protein and Effects of pH and Temperature on its Activity

To further identify the enzymatic characteristics of recombinant Pt4CL-like protein, substrate specificity was examined. Generally, when the substrate was ferulate acid, 4-coumaric acid ester, and caffeate, 4CLs exhibited higher activity. However, when the substrate was sodium acetate, ACS showed higher activity (7, 16). To determine the activity of recombinant Pt4CL-like proteins, different substrates, including sodium acetate, coumaric acid, caffeic acid, and ferulic acid, were selected for this study. The results showed that the recombinant Pt4CL-like protein can catalyze sodium acetate, but has no catalytic ability to coumaric acid, caffeic acid and ferulic acid (

Table 3. Different substrates’ K_m and V_max.

Enzyme	Substrate	Km (mmol/Ls)	Vmax (mmol/Ls)
Pt4CL-like protein	coumarate	-	-
	caffeate	-	-
	ferulate	-	-
	sodium acetate	1.91 ± 0.050	1.26 ± 0.075

). Also, we constructed the Michaelis-Menten equation and calculated a Michaelis constant (K_m) of 1.91 ± 0.05 and V_max of 1.26 ± 0.075 (Table 3).

Next, the effects of pH on enzyme activity were evaluated. The activity of recombinant Pt4CL-like protein was pH-dependent. Recombinant Pt4CL-like protein showed high levels of activity in the pH range of 6.0–7.0, with a pH optimum of 7.0. Little activity was detected at pH levels below 5.0 or above 8.0 (Figure 7A). Temperature profile analyses indicated that a temperature of 37 °C was optimum for enzymatic activity (Figure 7B); its activity decreased sharply at 40 °C–50 °C.

3.5. Analyses of Tissue-Specific Expression of the Pt4CL-Like Gene and Transcript Levels of Pt4CL-Like Gene Following Induction with 200 mM NaCl, 200 μM ABA, 2 mM H₂O₂, 4 °C Cold Stress, and 10% PEG₆₀₀₀

Quantitative real-time PCR was used to investigate the expression profile of the Pt4CL-like gene in various tissues (mature and young leaves, upper and lower stems, petioles, and roots); the gene-specific primers used are shown in Table 1. Transcription levels of Pt4CL-like gene were high in the upper and lower regions of stems, while the lowest expression level was observed in roots, with an almost 4-fold higher expression in young leaves than in roots (Figure 7C).

To identify the transcription pattern of the Pt4CL-like gene under stress, P. trichocarpa seedlings were subjected to the following abiotic stresses: 200 mM NaCl, 200 μM ABA, 2 mM H₂O₂, 4 °C cold stress, and 10% PEG₆₀₀₀. The expression of Pt4CL-like was altered to varying degrees in response to these treatments. The highest level of Pt4CL-like gene expression was observed after 12 h of treatment with 200 μM ABA, which was approximately 5.5 times that of the control and was followed by a gradual decline (Figure 8A). Following treatment with 10% PEG₆₀₀₀ for 7 days, Pt4CL-like gene transcription was upregulated approximately 1.8-fold compared to the control, which was also followed by a gradual decline (Figure 8C). Expression of Pt4CL-like was enhanced with 1–48 h of 200 mM NaCl treatment, and the maximum difference in expression occurred at 12 h (Figure 8B). Following treatment with the abiotic stressor 2 mM H₂O₂, the expression of the Pt4CL-like gene was upregulated, reaching a level approximately 1.7-fold higher than the control at 24 h (Figure 8E). Pt4CL-like gene expression was induced by cold stress of 4 °C (control temperature, 23 °C) and reached a maximum level of expression after 7 days of treatment (Figure 8D).

4. Discussion

4CL plays a significant role in the phenylpropanoid pathway, as it can catalyze the formation of hydroxycinnamoyl-CoA thioesters, precursors for the synthesis of lignins, monolignols, flavonoids, stilbenes, coumarins, and other phenylpropanoids. Previous studies of 4CL genes have focused on their key roles in biosynthetic pathways of lignins, monolignols, and flavonoids [22,23,24,25], but few 4CL-like genes have been identified, and little is known about their characteristics and functions [15,18].

Generally speaking, through the enzymatic reaction of ACS, acetate and ATP are converted to an acetyl adenylate intermediate, and the acetyl moiety is transferred to CoA to form acetyl-CoA [16,26,27]. It is very hard to confirm the relationship between the ACS and 4CL groups due to the high similarity of their protein structures. In this study, cDNA of the Pt4CL-like gene was isolated, and the Pt4CL-like protein was expressed and purified in E. coli. Pt4CL-like was highly conserved with ACSs from other species and had a close relationship with ACSs from Ricinus communis (XP_017975597), Durio zibethinus (XP_007225144.1), Gossypium arboreum (AMJ39459), and Corchorus olitorius (CAD22530.1). Moreover, unlike the box I and box II domains of the Pt4CL gene, the box I domain of Pt4CL-like was relatively conserved, and its box II domain was generally not conserved. The main differences were changes in proline to serine and leucine to glutamate in box I. Leucine is a nonpolar amino acid, but glutamate is polar and negatively charged; similarly, proline is a nonpolar amino acid, but serine is a polar amino acid. Changes also occur in the box II domain, where isoleucine changes to leucine, and cysteine to tryptophan. Tryptophan is a nonpolar amino acid, while cysteine is polar and uncharged (Figure 2). Changes in the polarity of amino acids may lead to changes in protein properties and, therefore, we speculated that Pt4CL-like may exhibit the different catalytic activity with 4CL [16,28]. In addition, phylogenetic analyses revealed that Pt4CL-like had a closer relationship with ACSs from Manihot esculenta (XP_021601125.1) and Jatropha curcas (XP_012073683.1) and, thus, that Pt4CL-like belongs to the ACS family. In the whole genome of Arabidopsis, nine adenylate synthetase genes have been found and classified as 4CL-like genes [1], and these genes exhibit very high similarity, in the substrate-binding region and the conserved region, with true 4CL genes [22]. Unlike 4CL proteins, the 4CL-like proteins are predicted to play a role in the synthesis of peroxisomes due to the presence of peroxisome sequences (PTS) at the C-terminal end of 4CL-like proteins. In this study, the Pt4CL-like protein investigated (XP_002307770.2) also has PTS at its C-terminal end and, thus, may target the peroxisome.

For characterization and functional analyses of the 4CL-like gene from Populus trichocarpa, its enzymatic activity was observed. The recombinant 4CL-like protein had no reaction with the substrates of 4CL, but reacted with sodium acetate, which indicates that Pt4CL-like belongs to the ACS family. Compared to phylogenetic analyses and structure prediction, enzymatic analyses could represent a more effective method for characterizing 4CL-like proteins. The methods we used for characterization and functional analyses of the 4CL-like gene have been used in Dunaliella tertiolecta and Mycobacterium tuberculosis [29,30]. Previous research has shown that lipid contents in D. tertiolecta increase under conditions of nitrogen deficiency, and cells cultivated in nitrogen-deficient medium accumulate the greatest amounts of lipid [24]. In our study, Pt4CL-like responded to various abiotic stressors, including high salinity, low temperature, and drought. Our results suggest that 4CL-like activity in Populus trichocarpa may be related to abiotic stress. In addition, we analyzed tissue-specific expression of the Pt4CL-like gene, and found that it has high transcriptional levels in the upper and lower regions of stems and the lowest expression level in roots. We predict that Pt4CL-like may play essential roles in plant development and environmental interactions.

In conclusion, the cDNA of 4CL-like from Populus trichocarpa was isolated, and the 4CL-like protein was purified. We found that 4CL-like showed enzymatic activity, and could be classified into the ACS family. In addition, a higher transcript level of Pt4CL-like gene was determined in stems, and Pt4CL-like gene can respond to a variety of stresses, which suggests that this protein is involved in plant development and environmental interactions.