Next Article in Journal
The Allelopathic Effects of Trewia nudiflora Leaf Extracts and Its Identified Substances
Next Article in Special Issue
Potential Role of Biochar and Silicon in Improving Physio-Biochemical and Yield Characteristics of Borage Plants under Different Irrigation Regimes
Previous Article in Journal
Transcriptional Regulation of Female and Male Flower Bud Initiation and Development in Pecan (Carya illinoensis)
Previous Article in Special Issue
Response of Juvenile Saccharina japonica to the Combined Stressors of Elevated pCO2 and Excess Copper
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 6
10.3390/plants12061379
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress

by
Xianjun Chen
1,2,†,
Hongwei Han
1,2,3,†,
Yundan Cong
1,2,
Xuezhen Li
1,2,
Wenbo Zhang
1,2,
Wenliang Wan
1,2,
Jinxia Cui
1,2,
Wei Xu
1,2,
Ming Diao
1,2,* and
Huiying Liu
1,2,*
1
Department of Horticulture, Agricultural College, Shihezi University, Shihezi 832003, China
2
Key Laboratory of Special Fruits and Vegetables Cultivation Physiology and Germplasm Resources Utilization of Xinjiang Production and Contruction Crops, Shihezi 832003, China
3
Key Laboratory of Horticulture Crop Genomics and Genetic Improvement in Xinjiang, Institute of Horticultural Crops, Xinjiang Academy of Agricultural Sciences, Urumqi 830000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2023, 12(6), 1379; https://doi.org/10.3390/plants12061379
Submission received: 15 February 2023 / Revised: 16 March 2023 / Accepted: 16 March 2023 / Published: 20 March 2023
(This article belongs to the Special Issue Physiological and Biochemical Adjustments in Response to Abiotic Stressors Associated with Climate Change)
Browse Figures
Versions Notes

Abstract

:
This study investigated the protective effects of exogenous ascorbic acid (AsA, 0.5 mmol·L−1) treatment on salt-induced photosystem inhibition in tomato seedlings under salt stress (NaCl, 100 mmol·L−1) conditions with and without the AsA inhibitor lycorine. Salt stress reduced the activities of photosystem II (PSII) and PSI. AsA treatment mitigated inhibition of the maximal photochemical efficiency of PSII (Fv/Fm), maximal P700 changes (Pm), the effective quantum yields of PSII and I [Y(II) and Y(I)], and non-photochemical quenching coefficient (NPQ) values under salt stress conditions both with and without lycorine. Moreover, AsA restored the balance of excitation energy between two photosystems (β/α-1) after disruption by salt stress, with or without lycorine. Treatment of the leaves of salt-stressed plants with AsA with or without lycorine increased the proportion of electron flux for photosynthetic carbon reduction [Je(PCR)] while decreasing the O2-dependent alternative electron flux [Ja(O2-dependent)]. AsA with or without lycorine further resulted in increases in the quantum yield of cyclic electron flow (CEF) around PSI [Y(CEF)] while increasing the expression of antioxidant and AsA–GSH cycle-related genes and elevating the ratio of reduced glutathione/oxidized glutathione (GSH/GSSG). Similarly, AsA treatment significantly decreased the levels of reactive oxygen species [superoxide anion (O2−) and hydrogen peroxide (H2O2)] in these plants. Together, these data indicate that AsA can alleviate salt-stress-induced inhibition of PSII and PSI in tomato seedlings by restoring the excitation energy balance between the photosystems, regulating the dissipation of excess light energy by CEF and NPQ, increasing photosynthetic electron flux, and enhancing the scavenging of reactive oxygen species, thereby enabling plants to better tolerate salt stress.

1. Introduction

Soil salinization and secondary salinization threaten sustainable agriculture and ecological integrity throughout the world [1,2]. Salinization is also aggravated by climate change, over-fertilization, and over-irrigation. Tomatoes (Solanum lycopersicum L) are widely grown in open-field and facility production settings. While tomato plants do show some degree of salt tolerance, they are nevertheless susceptible to salt stress, which inhibits both photosynthesis and production [3,4]. Thus, new approaches are needed to alleviate the effects of salt stress on tomatoes to ensure the efficient production of tomato crops.
Photosynthesis is driven by light energy, but stress conditions can reduce the conversion of absorbed light energy and associated CO2 assimilation, resulting in the generation of excess light energy. If not dissipated, this excess energy can trigger the accumulation of reactive oxygen species (ROS), leading to photo-oxidative damage to the photosystem and contributing to increasingly severe photoinhibition. Plants have evolved a series of photoprotective mechanisms that can help mitigate such damage. For example, plants can reduce absorption of light energy by altering the leaf angle or leaf area, decreasing the antenna pigment content, and altering the numbers of reaction centers [5]. Non-photochemical quenching (NPQ) can also facilitate thermal dissipation, while cyclic electron flow (CEF) around photosystem I (PSI)can maintain an appropriate proton gradient (ΔpH) across the thylakoid membrane necessary to facilitate the dissipation of excessive excitation energy [6]. Plants can also reduce photoinhibition through photorespiration, enhanced Mehler’s reaction, state transition of the photosystem, and ROS scavenging mechanisms to regulate the distribution of excitation energy in the photosystem [7,8]. As an alternative electron pathway, CEF around PSI can regulate electron transfer rates, maintain the balance between ATP and NAPDH, and protect against excessive PSI receptor reduction, thereby decreasing rates of hydroxyl radical (·OH) formation to prevent photodamage to PSI [9,10]. This mechanism can also aid in the repair of photodamage to photosystem II (PSII) [11].
Plants can engage a range of exogenous substances to augment salt tolerance in response to increased salinity. The application of exogenous substances thus represents a promising means of improving plant salt tolerance. Ascorbic acid (AsA), also known as vitamin C, is a small-molecule antioxidant that is present at high levels in the chloroplast stroma and in other parts of plant tissues, wherein it functions as a key electron donor in redox reactions and can regulate photosynthesis by preserving photosystem integrity [12,13]. The synthesis of AsA is mediated by the enzyme L-Galactono-1, 4-lactone dehydrogenase (L-GalLDH), and the overexpression of this gene in rice leads to significant increases in endogenous AsA production and levels of the ribulose-1, 5-bisphosphate (RuBP) and carboxylase/oxygenase (Rubisco) proteins [14], while silencing of L-GalLDH reduced endogenous AsA production by 30–50%. The resultant AsA deficiency rendered rice plants more susceptible to H2O2 production and lipid peroxidation in addition to reducing total antioxidant capacity and the overall photosynthetic capacity of plants [15]. In addition, exogenous AsA was found to play a vital role in abiotic stress responses, increasing the antioxidant properties of sweet pepper and thus improving the drought resistance of the plant [16]. Moreover, exogenous AsA can increase endogenous AsA, proline, and photosynthetic pigment levels, thus improving heat tolerance in tomato seedlings [17]. AsA can also reduce cold-associated oxidative damage by reducing lipid peroxidation, electrolyte leakage, and hydrogen peroxide (H2O2) production [18]. The benefits of AsA have also been detected under stress conditions induced by heavy metals [19], high nitrate levels [20], and high salt levels [21], showing that AsA can directly influence the antioxidant capacity and photosynthetic activity of plants.
Our previous study using fast OJIP fluorescence kinetics and JIP-test analyses showed that exogenous AsA treatment increased endogenous AsA levels and alleviated PSII photoinhibition, thus promoting tomato seedling growth under salt stress conditions [22]. However, these findings reflected PSII photochemical changes before the start of the dark reaction, and little is known of the utilization of light energy by the photosystems after carbon assimilation is initiated. PSII is generally regarded as being more sensitive than PSI, and it is thus considered the primary site of photoinhibition. Despite this, some reports have found that low-temperature and low-light conditions damage PSI more severely than PSII. Indeed, Terashima et al. [23] reported that in cucumber leaves exposed to low temperatures, PSI, rather than PSII, was the primary site of photoinhibition. Little research has been conducted on how PSI functions in tomato seedlings under salt stress [24], and the role of AsA as a regulator of photoinhibition in this setting is not well understood. Thus, the present study investigated the effects of exogenous AsA application and an inhibitor of AsA synthesis, lycorine, on tomato seedlings, examining the activity, light energy partitioning, and electron transport in PSI and PSII under conditions of salt stress. PSII electron flow partitioning, CEF around PSI (CEF-PSI), and ROS scavenging activity were also investigated.

2. Results

2.1. PSI and PSII Activity Levels

As shown in Figure 1A, NaCl treatment led to significant reductions in Fv/Fm ratios throughout the study period. In Figure 1B, Fv/Fm also were shown in false-color code-based images. Under NaCl treatment, leaf colors shifted from blue to green, representing a reduction in the Fv/Fm ratios. The false-color images of Fv/Fm showed a trend that was consistent with the Fv/Fm ratios, indicating inhibition of PSII. The Y(II) and qP values also declined throughout the study period relative to the controls, while the 1–qP, Y(NPQ), and Y(NO) values showed the opposite trend. The false-color images of Y(II), Y(NPQ), and Y(NO) (Figure 2C,F,I) were consistent with their value (Figure 2B,E,H). On day three, the NPQ of the NaCl-treated plants was increased relative to control plants but decreased on days six and nine post-treatment. Seedlings in the NaCl + AsA treatment group showed significant increases in leaf Fv/Fm, Y(II), and qP values of 3.7–19.2%, 10.4–21.6%, and 6.5–12.1%, respectively, compared with the NaCl-treatment group, together with significant decreases in NPQ (on day three), 1–qP, Y(NPQ), and Y(NO). Significant decreases in Fv/Fm, qP, NPQ, and Y(II) in NaCl + lycorine-treated plants relative to those treated with only NaCl were observed on days six and nine, while NaCl + lycorine + AsA treatment reversed the effects of NaCl + lycorine on these indices. NaCl treatment was also associated with significant increases in Y(NA) and significant reductions in Pm, Y(I), and Y(ND) relative to control seedlings, indicating PSI inhibition (Figure 1 and Figure 2). NaCl + lycorine treatment significantly decreased Y(I) and Y(ND) by 7.6–15.8% and 31.1–44.6%, respectively, relative to NaCl treatment, whereas Y(NA) remained elevated relative to NaCl treatment at all time points. However, AsA treatment was sufficient to reverse the decreases in Y(I) and Y(ND) values, while AsA further reduced Y(NA) values in these seedlings relative to the NaCl and NaCl + lycorine treatment groups.

2.2. The Allocation of Absorbed Light Engery between PSI and PSII

Relative to the control, NaCl stress was associated with significant reductions in α and p and significant increases in β, β/α−1, Ex, and D in tomato seedling leaves (Figure 3). The application of AsA resulted in significant improvements in α and p as well as significant reductions in β, β/α−1, Ex, and D in these NaCl-exposed plants on days three, six, and nine. Conversely, NaCl + lycorine treatment reduced the α and p values in tomato leaves, while the β, β/α-1, and Ex values in leaves under NaCl + lycorine + AsA treatment conditions were decreased relative to the NaCl + lycorine treatment conditions at all analytical time points.

2.3. PSII Electron Flux Distributions

NaCl treatment was associated with significant reductions in Je (PSII), Je (PCR), and Je (PCO) in tomato leaves together with significant increases in Ja, Ja (O2-dependent), and Ja(O2-independent) relative to control plants (Figure 4). NaCl + AsA treatment reversed the impact of NaCl treatment on Je (PSII), Je (PCR), and Ja (O2-dependent), with these values rising by 10.4–21.6%, 25.3–41.8%, and 18.8–122.8%, respectively, relative to NaCl treatment, whereas Ja (O2-dependent) decreased significantly by 4.5–30.0% throughout the study period. NaCl + lycorine treatment resulted in further decreases in Je (PSII), Je (PCR), and Je (PCO) as well as increases in Ja and Ja (O2-dependent). However, combined AsA treatment was sufficient to weaken the adverse impacts of NaCl + lycorine treatment on these parameters.
Treatment with NaCl resulted in significant reductions in the Je (PCR)/Je (PSII) and Je (PCO)/Je (PSII) ratios, while significantly increasing the Ja/Je (PSII), Ja(O2-independent)/Je (PSII), and Ja (O2-dependent)/Je (PSII) ratios at all sampling time points relative to control seedlings (Figure 5). NaCl + AsA treatment was sufficient to reverse the impact of NaCl on the Je (PCR)/Je (PSII), Je (PCO)/Je (PSII), Ja/Je (PSII), and Ja (O2-dependent)/Je (PSII) ratios while promoting an increase in the Ja (O2-independent)/Je (PSII) ratio. Lycorine treatment reduced the Je (PCR)/Je (PSII) and Ja (O2-independent)/Je (PSII) ratios at all time points, decreased the Je (PCO)/Je (PSII) ratio on days six and nine, and resulted in a significant increase in Ja/Je (PSII) and Ja (O2-dependent)/Je (PSII) ratios at all time points in these NaCl-exposed seedlings. Significantly higher Je (PCR)/Je (PSII), Je (PCO)/Je (PSII), and Ja (O2-independent)/Je (PSII) ratios were observed under NaCl + lycorine + AsA treatment conditions at all time points relative to NaCl + lycorine treatment conditions, whereas Ja/Je (PSII) and Ja (O2-dependent)/Je (PSII) were decreased.

2.4. CEF-PSI Analyses

As shown in Figure 4 and Figure 6, electron transport rates for both PSI and PSII [Je (PSII) and Je (PSI)] were significantly decreased in response to NaCl and NaCl + lycorine treatment relative to control and NaCl treatment, respectively, whereas AsA promoted Je (PSII) and significantly increased Je (PSI) in the leaves of these tomato seedlings irrespective of the addition of lycorine. Salt stress was also associated with the inhibition of LEF and the stimulation of the quantum yield of CEF around PSI [Y (CEF)], the ratio of the quantum yield of CEF to Y(II) [Y (CEF)/Y (II)], and electron flux through CEF-PSI [(Je (CEF-PSI)] on day three post-treatment, but these indices declined significantly on days six and nine after treatment. Relative to seedlings in the NaCl or NaCl + lycorine groups, those subjected to AsA treatment exhibited significant increases in Y (CEF) by 15.1–57.7% and 37.5–150.3%, Y (CEF)/Y (II) by 27.6–39.9% and 21.1–114.9%, and Je (CEF-PSI) by 15.1–57.7% and 37.5–150.3%, respectively, throughout the study period.

2.5. ROS Metabolism and Oxidative Damage Analyses

Salt stress induced an increase in the O2− generation rate, MDA and H2O2 content, and relative conductivity in the tomato leaves. Relative to NaCl-treated plants, plants treated with NaCl + AsA treatment showed O2− generation rates that were 48.3%, 51.5%, and 40.9% lower at the three sampling time points, with significant concomitant 40.0–55.5%, 22.8–51.8%, and 12.8–55.5% reductions in the relative conductivity and levels of H2O2 and MDA in leaves of NaCl + AsA-treated seedlings (Figure 7). In addition, relative to NaCl treatment, NaCl + lycorine treatment was associated with higher levels of MDA and ROS accumulation throughout the treatment period, while combined NaCl + lycorine + AsA treatment was sufficient to reverse these adverse effects of NaCl + lycorine treatment in analyzed seedlings.

2.6. GSH Content and the GSH/GSSG Ratio

Relative to control seedlings, salt-stressed plants showed significantly reduced GSH levels and GSH/GSSG ratio throughout the study period (Figure 8). Relative to NaCl only, NaCl + lycorine treatment was associated with significant 18.8–46.3% reductions in GSH contents without significantly impacting the GSH/GSSG ratio at any time point. Exogenous AsA administration significantly attenuated the effects of NaCl and NaCl + lycorine treatment on GSH content and the GSH/GSSG ratio at these three sampling time points.

2.7. Antioxidant Enzyme Gene Expression and Activity Levels

Relative to control seedlings, NaCl treatment was associated with significant reductions in SOD, POD, CAT, APX, GR, DHAR, and MDHAR activity on days three, six, and nine (Figure 9 and Figure 10). Consistently, significant decreases in the expression of the genes encoding all these enzymes were observed at all three sampling time points in salt-stress-exposed seedlings relative to control seedlings (Figure 11). The expression and activity of these enzymes were significantly enhanced and decreased, respectively, upon NaCl + AsA and NaCl + lycorine treatment at all time points relative to NaCl treatment alone. However, combined NaCl + AsA + lycorine treatment reversed the deleterious effects of NaCl + lycorine treatment on such enzymatic activity and gene expression levels in these seedlings.

3. Materials and Methods

3.1. Plant Materials and Treatment Conditions

Tomato seeds (Ligeer 87-5) were incubated at 28 °C on moist filter paper for 2 days in an incubator, after which they were sown in a plastic dish containing peat and vermiculite (1:1). At the two-true-leaf stage, seedlings of uniform size were transplanted into 12-L black plastic containers (n = 6/container). The containers were filled with 10 L of Hoagland nutrient solution with oxygen. After 7 days, the plants were treated by adding NaCl to the nutrient solution and/or spraying AsA and/or the AsA synthase inhibitor (lycorine) on the leaves of the plants in the following combinations: (1) untreated control plants; (2) 100 mmol·L−1 NaCl (NaCl group); (3) 100 mmol·L−1 NaCl + 0.5 mmol·L−1 AsA (NaCl + AsA group); (4) 100 mmol·L−1 NaCl + 0.25 mmol·L−1 lycorine (NaCl + lycorine group); and (5) 100 mmol·L−1 NaCl + 0.25 mmol·L−1 lycorine + 0.5 mmol·L−1 AsA (NaCl + lycorine +AsA group). The AsA and lycorine volumes, concentrations, and application methods used herein were based on the results of our prior study [22]. Experiments were performed using randomized group assignments, with three replicates of five plants per treatment. Nutrient solutions were changed every third day and were oxygenated throughout the day. Samples were collected for analysis on days three, six, and nine of treatment.

3.2. Chlorophyll Fluorescence Parameters and P700 Redox State

The Maxi Imaging-Pam (Imaging-Pam, WALZ, Germany) modulated fluorescence imaging system was used to measure chlorophyll fluorescence parameters together with the Imaging Win program. PSII chlorophyll fluorescence and P700 redox states were simultaneously measured with a saturated pulse Dual-PAM-100 fluorometer and the Dual-PAM software. Following dark adaptation for 30 min, leaves were illuminated with a high-saturation light pulse (0.05 Hz) for 260 s. The instrument then automatically reported the following parameters: Fv/Fm, 1–qP, qP, NPQ, Y(NPQ), Y(II), Pm, Y(I), Y(NO), Y(NA), and Y(ND) (Table 1). False-color images of Fv/Fm, Y(II), Y(NPQ), and Y(NO) images [from 0.000 (black) to 1.000 (purple)] were recorded and compared with Imaging Win [25].

3.3. Absorbed Light Energy Allocation Analyses

Absorbed light energy allocation and the distribution coefficients for excitation energy of PSI and PSII, including D, p, Ex, β, α, and (β/α − 1), were analyzed using formulae reported previously by Demmig-Adams et al. [26] (Table 1).

3.4. LEF and CEF Electron Flux Transport Rate Calculations

Electron transport rates through PSII [Je(PSII)] and PSI [Je(PSI)] were computed using formulae reported previously by Miyake et al. [27]. Rubisco oxygenation rates (VO) and Rubisco carboxylation rates (Vc) can be analyzed using formulae reported previously by Sharkey et al. [28]. The distribution of electron fluxes through PSII, including Je(PCR), Je(PCO), Ja, Ja(O2-dependent), and Ja(O2-independent), were analyzed using formulae reported previously by Krall et al. [29] (Table 2). The parameters Je(CEF-PSI), Y(CEF), and Y(CEF)/Y(II) were used for estimation of the extent of CEF [30] (Table 2).

3.5. ROS Generation and Lipid-Peroxidation-Related Analyses

Malondialdehyde (MDA) levels in cells were measured with thiobarbituric acid to assess lipid peroxidation levels [31]. Hydrogen peroxide (H2O2) levels were assessed as reported by Yu et al. [32], while superoxide anion (O2−) generation rates were determined as reported by Elstner et al. [33]. Relative conductivity was computed as per Ma et al. [34]. Schiff’s reagent, which is capable of detecting lipid-peroxidation-derived aldehydes, was used for histochemical analyses of lipid peroxidation. Briefly, leaves were placed in Schiff’s reagent for 1 h followed by immersion in boiling ethanol for bleaching until a red/purple color consistent with lipid peroxidation was visible. The histochemical localization of H2O2 and O2− in seedling leaves was assessed per the protocol published by Thordal-Christensen et al. [35], with H2O2 (brown spot) and O2− (dark blue) being colored using solutions of 1% 3,3-diaminobenzidine (DAB) and 0.1% nitroblue tetrazolium chloride (NBT), respectively.

3.6. Antioxidant Metabolite Analyses

Oxidized glutathione (GSSG) concentrations were measured as reported previously by Nagalakshmi [36]. Total glutathione and GSSG absorptivity were measured at 412 nm. Reduced glutathione (GSH) levels were calculated based on the difference between total glutathione and GSSG levels.

3.7. Antioxidant Enzyme Activity Assays

Tomato leaves (0.3 g) were taken and placed in a pre-chilled mortar, and 3 mL of pre-chilled 0.05 mol L−1 phosphate buffer (pH 7.8) was added. It was then ground into a homogenate on an ice bath, centrifuged at 12,000× g for 20 min at 4 °C, and the supernatant was separated as the enzyme extract and stored at 4 °C.
The activity of superoxidase dismutase (SOD) was assessed as reported previously by El-Shabrawi et al. [37], with one unit of SOD activity corresponding to the amount of enzyme necessary for a 50% reduction in NBT content as detected at 560 nm in a colorimetric assay. The activity of peroxidase (POD) was detected as reported previously by Cakmak et al. [38] using a 2.9 mL reaction solution containing 0.1 M phosphate buffer (pH 7.0), 0.04 mL of 0.1 M H2O2, 0.04 mL of 1% guaiacol, and 0.02 mL of the enzyme extraction solution. Absorbance was analyzed for 3 min at 470 nm. Catalase (CAT) activity levels were measured as described by Hasanuzzaman et al. [39]. Briefly, 0.1 mL enzyme extract samples were combined with 1.7 mL of 25 mM phosphate buffer (pH 7.0) and 0.2 mL of 100 mM H2O2. Changes in absorbance (240 nm) were then assessed within 1 min. Ascorbate peroxidase (APX) activity was measured as in a previous study reported by Nakano et al. [40]. Briefly, 0.1 mL enzyme extract samples were combined with 1.7 mL of 25 mM phosphate buffer (pH 7.0), 0.1 mL of 5 mM AsA, and 0.1 mL of 20 mM H2O2. Absorbances were read at 290 nm after 1 min. The activity of monodehydroascorbate reductase (MDHAR) was measured as described by Hossain et al. [41], combining 0.1 mL of enzyme extract and 1.7 mL of 25 mM phosphate buffer (pH 7.0), 0.05 mL ascorbate oxidase, and 0.01 mL of 4 mM NADH before measuring the absorbance at 340 nm. The activity of dehydroascorbate reductase (DHAR) was measured as reported by Costa et al. [42] by mixing 0.1 mL enzyme extract samples and 1.7 mL of 25 mM phosphate buffer (pH 7.0), 0.1 mL of GSH, and 0.01 mL of 8 mM dehydroascorbate (DHA) prior to measuring absorbance for 1 min at 265 nm. Glutathione reductase (GR) activity was measured using the method reported by Cakmak et al. [38]. Decreases in the absorbance (340 nm) associated with NADPH oxidation were measured for 1 min, and activity was calculated based on an extinction coefficient of 6.2 mmol L−1 cm−1.

3.8. qPCR

TRIzol was used to extract total RNA from tomato leaves, after which a HyperScriptTM III RT SuperMix for qPCR (EnzyArtisan Biotech, Shanghai, China) with gDNA Remover was used to prepare cDNA based on the provided directions. Then, a 2 × S6 Universal SYBR qPCR Mix (EnzyArtisan Biotech, China) was used for qPCR using appropriate primers (Table 3). Three biological replicate samples were analyzed for each condition, and relative gene expression was calculated by the 2−ΔΔCt method.

3.9. Statistical Analysis

Data were expressed as means ± standard deviation (SD) and were compared with SPSS v 19.0 using ANOVAs and Duncan’s multiple interval test. p < 0.05 was the significance threshold, and Origin 9 was used to construct all figures in this study.

4. Discussion

In an earlier study, we demonstrated that the exogenous application of AsA was sufficient to alleviate salt-stress-induced PSII photoinhibition through both increases in endogenous AsA content and enhanced photosynthetic performance [22]. PSII is generally regarded as the system primarily affected by photoinhibition under stress conditions, but some authors have suggested that PSI may also be susceptible [43,44,45]. Here, significant reductions in Fv/Fm and Pm were observed in tomato seedlings exposed to salt stress, suggesting inhibition of both PSI and PSII [46,47]. Salt stress reduced the Y(II) and qP of tomato seedling leaves, whereas 1–qP was increased, suggesting that excitation pressure increases in PSII (1–qP) were attributable to a reduced capacity for CO2 assimilation and reduced electron transfer efficiency [48]. Increases in Y(NO) that were observed in salt-stress-exposed plants (Figure 2) suggested the disruption of the PSII supercomplex and/or damage to the D1 protein by excess light energy, which impacts its turnover [49,50]. By applying exogenous AsA, it was possible to mitigate the impact of salinity on Y(II), qP, and Y(NO). AsA is reportedly a cofactor of violaxanthin de-epoxidase that is involved in dissipating excess excitation energy from the xanthophyll cycle under stress conditions [51]. Higher AsA levels within plants can drive D1 protein accumulation under conditions of cold stress, for example, thereby alleviating PSII photoinhibition [52]. To further probe the role of AsA, we applied lycorine (an inhibitor of L-galactono-γ-lactone dehydrogenase activity, which is a key enzyme in AsA synthesis) on the leaves of salt-stressed tomato seedlings with or without AsA treatment. LYC was used to reduce endogenous AsA content [53]. In this work, we found that Lycorine treatment could reduce the endogenous AsA content in leaves of salt-stressed tomato seedlings with or without AsA application (Figure S1). Meanwhile, a decrease in Y(II) and qP and an increase in 1–qP and Y(NO) were observed under NaCl + lycorine and NaCl + lycorine + AsA treatment compared with salt stress and NaCl + AsA treatment, respectively (Figure 1 and Figure 2). Therefore, Applying AsA may therefore be capable of preserving PSII supercomplex stability or enhancing the turnover of the D1 protein while also augmenting photosynthetic electron transport and Calvin-cycle-associated NADPH and ATP demands [54,55]. Higher NPQ values and lower 1–qP values following treatment with AsA indicated a reduction in PSII reaction center excitation pressure, an increased capacity for heat dissipation, and a reduction in the degree of photoinhibition [56,57]. In addition, a decreased capacity for CO2 assimilation can contribute to a proportion of reduced electron carriers being unable to undergo PSI donor-side oxidation, resulting in the over-reduction of P700 or excess NADP accumulation, which in turn enhances ·OH formation and contributes to PSI damage [58]. Here, Y(I) and [Y(ND)] decreased under stress conditions, whereas Y(NA) increased (Figure 2), thus demonstrating that PSI was sensitive to salt stress and its activity was reduced in relation to P700 over-reduction and PSI impairment. Exogenous AsA application was sufficient to reverse the impact of NaCl or NaCl + lycorine treatment on these indices (Figure 2). AsA was thus able to maintain P700 at a higher oxidation state under salt stress conditions while attenuating ·OH-mediated PSI damage.
State transition is a mechanism through which organisms that rely on photosynthesis can control the relative allocation of excitation energy to PSI and PSII and decrease excitation-energy-related stress in PSII reaction centers [59]. Under adverse conditions, maintaining a balanced distribution of excitation energy is a prerequisite for the efficient operation of PSII and PSI and the coordinated completion of the LEF (linear electron flow) [60]. Here, salt stress was found to result in reductions in p and α values and increases in D, β, Ex, and β/α-1, indicating an imbalanced distribution of excitation energy between PSI and PSII. Additionally, an increase in PSII excitation energy stress and the portion of light energy allocated to light reactions (p) was significantly decreased, whereas the portion of light energy dissipated as energy from non-photochemical reactions (Ex) increased. This may contribute to the reductions in photosynthetic efficiency and PSII damage under salt stress conditions (Figure 3). The application of lycorine led to a further imbalance in the allocation of excitation energy between PSI and PSII in tomato seedlings exposed to salt stress, suggesting reduced regulatory ability of the photosystem energy redistribution mechanism (Figure 3). Exogenous AsA application was able to balance the distribution of excitation energy between PSI and PSII, thus increasing PSII reaction center openness (qP) under NaCl and NaCl + lycorine treatment conditions, which allowed more energy for photochemical reactions (p) and reduced PSII damage resulting from exposure to excess light energy (Ex), as evidenced by Fv/Fm and Y(II) enhancement. AsA can thus maintain an appropriate distribution of absorbed light energy between PSI and PSII under salt stress conditions, improving the light energy utilization efficiency.
Light energy absorbed by plants is used primarily for electron transfer that drives electron-consuming processes such as photorespiration (PCO) and photosynthetic carbon reduction (PCR) [61]. The total electron flux in PSII [Je(PSII)] can be separated into both Je(PCR) and Je(PCO) as well as the alternative electron flux (Ja). Ja comprises both Ja(O2-independent) and Ja(O2-dependent), the latter of which corresponds to the Mehler reaction, which is a key source of ROS such that increased Ja(O2-dependent) can trigger ROS production under adverse conditions [62]. Under normal conditions, PCR functions as a key sink for light energy that has been absorbed, whereas the inhibition of PCR under stress conditions can alter photorespiration, the Mehler reaction, and nitrogen-metabolism-related electron flow [11]. Haupt-Herting et al. [63] found that tomato seedlings exposed to water stress exhibited significant reductions in Je(PCR) and Ja(O2-dependent) together with an increase in Je(PCR). Moreover, Zhou et al. [64] analyzed PSII electron flux and found that cold-induced reductions in Je(PCR) were largely compensated by Ja(O2-dependent) rather than by Je(PCO). Here, salt stress was found to inhibit Je(PCR) and Je(PCO) while enhancing Ja(O2-dependent) and Ja(O2-independent) (Figure 4). These results indicate the trapping of large quantities of excess energy that are then consumed via O2 partial-pressure-dependent alternative electron flux, resulting in excessive ROS production. Melatonin and brassinolide (BR) reportedly improve cucumber seedling cold tolerance through mechanisms associated with increases in Je(PCR) and decreases in Ja(O2-dependent) [61,65]. Zhang et al. [66] utilized transgenic rice overexpressing l-galactono-γ-lactone dehydrogenase (GLDH) and demonstrated that higher levels of endogenous AsA were associated with increases in Je(PCR) and Je(PCR)/Je(PSII) together with reductions in Ja/Je(PSII), implying a role for AsA in photosynthetic electron flow allocation in rice. Here, we found AsA to maintain high Je(PCR), Je(PCO)/Je(PSII), and Je(PCR)/Je(PSII) levels while significantly suppressing increases in Ja/Je(PSII) and Ja(O2-dependent) in tomato seedlings exposed to salt stress (Figure 5). The application of AsA further reversed the impact of lycorine treatment by inhibiting electron flow allocation to carbon assimilation and inducing Mehler reaction allocation under salt stress conditions. AsA is thus capable of maintaining the ability of PCO and PCR to consume excessive photosynthesis-related electrons, thus reducing O2 partial-pressure-dependent alternative electron flux. Excessive light energy can, under stress conditions, contribute to ROS production within chloroplasts that can damage both PSII and PSI. CEF-PSI can effectively protect against photodamage, and many prior reports have demonstrated that CEF can shield PSI from stressors including cold [67], heat [68], drought [69], and other adverse conditions [70]. By oxidizing PSI acceptor-side components through the recycling of electrons from PSI to the plastoquinone (PQ) pool and Cyt b6/f, CEF can mitigate acceptor-side reduction [71]. Here, the exogenous AsA stimulated Y(CEF) in tomato seedlings subjected to salt stress with or without lycorine treatment while improving the Y(CEF)/Y(II) ratio and Je(CEF-PSI) (Figure 6). Application of AsA was thus able to stimulate increased CEF activity, transferring PSI electrons to PQ and growing the PQ pool, thus facilitating PQ pool oxidization in these tomato leaves that had been subjected to salt stress. Applying AsA can thus facilitate absorbed light energy distribution to PSI reaction centers, reducing PSI donor-side electron accumulation [72]. In summary, exogenous AsA activated CEF and thereby alleviated PSI photoinhibition under salt stress conditions.
Dysregulated ROS metabolism under stress conditions can cause damage to aerobic organisms and can contribute to photoinhibition resulting from damage to the photosynthetic apparatus. Elevated Ja(O2-dependent) under salt stress or other stress conditions implies enhanced Mehler reaction activity and ROS generation [73]. Here, salt stress increased Ja(O2-dependent) and caused concomitant increases in the accumulation of MDA and ROS (O2− and H2O2) as well as reduced antioxidant enzyme activity levels and increased electrolyte permeability (Figure 7 and Figure 9), indicating that the ROS production capacity was increased and ROS scavenging activity was impaired under salt stress, thereby contributing to oxidative damage. Plants have evolved a range of tightly regulated enzymatic and non-enzymatic mechanisms responsible for the scavenging of ROS, with the CAT, POD, SOD, and AsA–GSH pathways being the most prominent in this context. Both endogenous GSH levels and the GSH/GSSG ratio can offer important insight into redox homeostasis in plants [74,75,76,77]. The ability to maintain such redox homeostasis under stress conditions is critical, as it can shield against damage to the photosystems [78]. Endogenous AsA has been shown to serve as a key non-enzymatic component of these antioxidant defense pathways, as it serves as an electron donor for APX-mediated H2O2 scavenging in the AsA–GSH cycle when protecting plants against the potential oxidative stress induced by many abiotic stressors [79,80,81]. Exogenous AsA application can similarly improve stress tolerance and promote growth through the detoxification of ROS induced in response to various stressors [82,83,84]. Here, the spraying of AsA on tomato seedlings under salt stress conditions contributed to increases in photosynthetic electron flow, the inhibition of Mehler reaction activity, and reductions in ROS accumulation. Moreover, AsA was associated with improvements in the expression and activity levels of POD, CAT, SOD, APX, GR, DHAR, and MDAR, whereas in salt-stressed plants treated with lycorine, these enzymes were downregulated and suppresses while ROS levels were increased (Figure 7, Figure 9, Figure 10 and Figure 11). Treatment with exogenous AsA similarly promoted increases in the GSH content and GSH/GSSG ratio in the leaves of tomato seedlings exposed to NaCl or NaCl + lycorine treatment (Figure 8). These data further confirmed that exogenous AsA was able to increase photosynthetic electron flow, inhibit ROS production, enhance the detoxification of ROS, and maintain redox homeostasis in salt-stress-exposed plants. This pathway is one of the key mechanisms by which photosystem stability is maintained, and it mitigates photoinhibition in the presence of salt stress.

5. Conclusions

In summary, these results demonstrate the efficacy of AsA in the mitigation of photosystem inhibition in tomato seedlings under salt stress conditions. The findings showed that AsA could promote the thermal dissipation of PSII excitation energy and mitigate excessive PSI receptor side reduction under salt stress. This was accomplished primarily by balancing the allocation of excitation energy between PSI and PSII, thus activating NPQ mechanisms, photorespiration, and CEF, which maintained the stability of both photosystems and enhanced the quantum yield of PSII and PSI photochemistry. The exogenous application of AsA was also able to promote efficient electron transfer between the two photosystems and protect against photooxidative damage through the enhancement of ROS scavenging and photosynthetic electron flow, thereby effectively alleviating PSI and PSII photoinhibition and improving the photosynthetic performance of tomato seedlings exposed to high levels of salinity (Figure 12).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants12061379/s1, Figure S1: Values of reduced ascorbic acid (AsA) content in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).

Author Contributions

The work presented here was carried out in collaboration between all authors. H.L., M.D. and X.C. defined the research theme. X.C. designed methods and experiments, carried out the laboratory experiments, analyzed the data, interpreted the results, and wrote the paper. H.H., Y.C., X.L., W.Z., W.W., J.C. and W.X. co-worked on analysis of chlorophyll fluorescence parameters and P700 redox state and discussed analyses and interpretation. H.L. and M.D. conceived and coordinated the study. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Key program of National Natural Science Foundation of China—Xinjing Joint Funds (Grant No. U1903202) and National Natural Science Foundation of China (Grant No. 31860550).

Data Availability Statement

Not available.

Acknowledgments

I have ensured that all individuals included in this section have consented to the acknowledgement.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Hossain, M.S.; Alam, M.U.; Rahman, A.; Hasanuzzaman, M.; Nahar, K.; Mahmud, J.A.; Fujita, M. Use of iso-osmotic solution to understand salt stress responses in lentil (Lens culinaris Medik.). S. Afr. J. Bot. 2017, 113, 346–354. [Google Scholar] [CrossRef]
  2. Bailey-Serres, J.; Parker, J.E.; Ainsworth, E.A.; Oldroyd, G.E.D.; Schroeder, J.I. Genetic strategies for improving crop yields. Nature 2019, 575, 109–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Wang, J.; Huang, R. Modulation of ethylene and ascorbic acid on reactive oxygen species scavenging in plant salt response. Front. Plant Sci. 2019, 10, 319. [Google Scholar] [CrossRef] [Green Version]
  4. Mushtaq, Z.; Faizan, S.; Gulzar, B. Salt stress, its impacts on plants and the strategies plants are employing against it: A review. J. Appl. Biol. Biotechnol. 2020, 8, 81–91. [Google Scholar] [CrossRef]
  5. Wada, M. Chloroplast movement. Plant Sci. 2013, 9, 177–182. [Google Scholar] [CrossRef]
  6. Allen, J.F. Plastoquinone redox control of chloroplast thylakoid protein phosphorylation and distribution of excitation energy between photosystems: Discovery, background, implications. Photosynth. Res. 2002, 73, 139. [Google Scholar] [CrossRef]
  7. Chen, H.X.; An, S.Z.; Li, W.J.; Gao, H.Y.; Zou, Q. Enhancement of the mehler-peroxidase reaction in salt-stressed Rumex K-1 leaves. J. Integr. Plant Biol. 2004, 46, 811–818. [Google Scholar]
  8. Pinnola, A.; Bassi, R. Molecular mechanisms involved in plant photoprotection. Biochem. Soc. Trans. 2018, 46, 467–482. [Google Scholar] [CrossRef]
  9. Huang, W.; Fu, P.L.; Jiang, Y.J.; Zhang, J.L.; Zhang, S.B.; Hu, H.; Cao, K.F. Differences in the responses of photosystem I and photosystem II of three tree species Cleistanthus sumatranus, Celtis philippensis and Pistacia weinmannifolia exposed to a prolonged drought in a tropical limestone forest. Tree Physiol. 2013, 33, 211–220. [Google Scholar] [CrossRef]
  10. Huang, W.; Yang, Y.J.; Hu, H.; Cao, K.F.; Zhang, S.B. Sustained diurnal stimulation of cyclic electron flow in two tropical tree species Erythrophleum guineense and Khaya ivorensis. Front. Plant Sci. 2016, 7, 1068. [Google Scholar] [CrossRef] [Green Version]
  11. Yi, X.P.; Zhang, Y.L.; Yao, H.S.; Zhang, X.J.; Luo, H.H.; Gou, L.; Zhang, W.F. Alternative electron sinks are crucial for conferring photoprotection in field-grown cotton under water deficit during flowering and boll setting stages. Funct. Plant Biol. 2014, 41, 737–747. [Google Scholar] [CrossRef]
  12. Smirnoff, N. Ascorbate biosynthesis and function in photoprotection. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2000, 355, 1455–1464. [Google Scholar] [CrossRef] [PubMed]
  13. Yabuta, Y.; Motoki, T.; Yoshimura, K.; Takeda, T.; Ishikawa, T.; Shigeoka, S. Thylakoid membrane-bound ascorbate peroxidase is a limiting factor of antioxidative systems under photo-oxidative stress. Plant J. 2002, 32, 915–925. [Google Scholar] [CrossRef] [PubMed]
  14. Yu, L.; Liu, Y.; Tong, J.; Ding, J.; Wang, R.; Peng, C.; Xiao, L. Reduced grain chalkiness and its possible physiological mechanism in transgenic rice overexpressing L-GalLDH. Crop. J. 2015, 3, 125–134. [Google Scholar] [CrossRef] [Green Version]
  15. Yu, L.; Liu, Y.; Lu, L.; Zhang, Q.; Chen, Y.; Zhou, L.; Chen, H.; Peng, C. Ascorbic acid deficiency leads to increased grain chalkiness in transgenic rice for suppressed of L-GalLDH. J. Plant Physiol. 2017, 211, 13–26. [Google Scholar] [CrossRef]
  16. Khazaei, Z.; Estaji, A. Effect of foliar application of ascorbic acid on sweet pepper (Capsicum annuum) plants under drought stress. Acta Physiol. Plant. 2020, 42, 118. [Google Scholar] [CrossRef]
  17. Alayafi, A.A.M. Exogenous ascorbic acid induces systemic heat stress tolerance in tomato seedlings: Transcriptional regulation mechanism. Environ. Sci. Pollut. Res. 2020, 27, 19186–19199. [Google Scholar] [CrossRef]
  18. Elkelish, A.; Qari, S.H.; Mazrou, Y.S.A.; Abdelaal, K.A.A.; Hafez, Y.M.; Abu-Elsaoud, A.M.; EI-Saber Batiha, G.; EI-Esawi, M.A.; EI Nahhas, N. Exogenous ascorbic acid induced chilling tolerance in tomato plants through modulating metabolism, osmolytes, antioxidants, and transcriptional regulation of catalase and heat shock proteins. Plants 2020, 9, 431. [Google Scholar] [CrossRef] [Green Version]
  19. Sharma, R.; Bhardwaj, R.; Thukral, A. Oxidative stress mitigation and initiation of antioxidant and osmoprotectant responses mediated by ascorbic acid in Brassica juncea L. subjected to copper (II) stress. Ecotoxicol. Environ. Saf. 2019, 182, 109436. [Google Scholar] [CrossRef]
  20. Niu, J.; Chen, Z.; Yu, S.; Wang, Q. Ascorbic acid regulates nitrogen, energy, and gas exchange metabolisms of alfalfa in response to high-nitrate stress. Environ. Sci. Pollut. Res. 2022, 29, 24085–24097. [Google Scholar] [CrossRef] [PubMed]
  21. Billah, M.; Rohman, M.M.; Hossain, N.; Shalim Uddin, M. Exogenous ascorbic acid improved tolerance in maize (Zea mays L.) by increasing antioxidant activity under salinity stress. Afr. J. Agric. Res. 2017, 12, 1437–1446. [Google Scholar] [CrossRef] [Green Version]
  22. Chen, X.; Zhou, Y.; Cong, Y.; Zhu, P.; Xing, J.; Cui, J.; Xu, W.; Shi, Q.; Diao, M.; Liu, H.Y. Ascorbic acid-induced photosynthetic adaptability of processing tomatoes to salt stress probed by fast OJIP fluorescence rise. Front. Plant Sci. 2021, 12, 1650. [Google Scholar] [CrossRef] [PubMed]
  23. Terashima, I.; Funayama, S.; Sonoike, K. The site of photoinhibition in leaves of Cucumis sativus L. at low temperatures is photosystem I., not photosystem II. Planta 1994, 193, 300–306. [Google Scholar] [CrossRef]
  24. Yang, X.; Li, Y.; Chen, H.; Huang, J.; Zhang, Y.; Qi, M.; Liu, Y.; Li, T. Photosynthetic Response Mechanism of Soil Salinity-Induced Cross-Tolerance to Subsequent Drought Stress in Tomato Plants. Plants 2020, 9, 363. [Google Scholar] [CrossRef] [Green Version]
  25. Barták, M.; Gloser, J.; Hájek, J. Visualized photosynthetic characteristics of the lichen Xanthoria elegans related to daily courses of light, temperature and hydration: A field study from Galindez Island, maritime Antarctica. Lichenologist 2005, 37, 433–443. [Google Scholar] [CrossRef]
  26. Demmig-Adams, B.; Adams, W.W., III; Barker, D.H.; Logan, B.A.; Bowling, D.R.; Verhoeven, A.S. Using chlorophyll fluorescence to assess the fraction of absorbed light allocated to thermal dissipation of excess excitation. Physiol. Plant. 1996, 98, 253–264. [Google Scholar] [CrossRef]
  27. Miyake, C.; Yokota, A. Determination of the rate of photoreduction of O2 in the water-water cycle in watermelon leaves and enhancement of the rate by limitation of photosynthesis. Plant Cell Physiol. 2000, 41, 335–343. [Google Scholar] [CrossRef] [Green Version]
  28. Sharkey, T.D.; Bernacchi, C.J.; Farquhar, G.D.; Singsaas, E.L. Fitting photosynthetic carbon dioxide response curves for C(3) leaves. Plant Cell Environ. 2007, 30, 1035–1040. [Google Scholar] [CrossRef] [PubMed]
  29. Krall, J.P.; Edwards, G.E. Relationship between photosystem II activity and CO2 fixation in leaves. Physiol. Plant. 1992, 86, 180–187. [Google Scholar] [CrossRef]
  30. Lu, T.; Yu, H.; Li, Q.; Chai, L.; Jiang, W. Improving plant growth and alleviating photosynthetic inhibition and oxidative stress from low-light stress with exogenous GR24 in tomato (Solanum lycopersicum L.) seedlings. Front. Plant Sci. 2019, 10, 490. [Google Scholar] [CrossRef]
  31. Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
  32. Yu, C.W.; Murphy, T.M.; Lin, C.H. Hydrogen peroxide-induced chilling tolerance in mung beans mediated through ABA-independent glutathione accumulation. Funct. Plant Biol. 2003, 30, 955–963. [Google Scholar] [CrossRef] [PubMed]
  33. Elstner, E.F.; Heupel, A. Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef] [PubMed]
  34. Ma, X.; Zheng, J.; Zhang, X.; Hu, Q.; Qian, R. Salicylic acid alleviates the adverse effects of salt stress on dianthus superbus (Caryophyllaceae) by activating photosynthesis, protecting morphological structure, and enhancing the antioxidant system. Front. Plant Sci. 2017, 8, 600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Thordal-Christensen, H.; Zhang, Z.; Wei, Y.; Collinge, D.B. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley—Powdery mildew interaction. Plant J. 1997, 11, 1187–1194. [Google Scholar] [CrossRef]
  36. Nagalakshmi, N.; Prasad, M.N.V. Responses of glutathione cycle enzymes and glutathione metabolism to copper stress in Scenedesmus bijugatus. Plant Sci. 2001, 160, 291–299. [Google Scholar] [CrossRef]
  37. El-Shabrawi, H.; Kumar, B.; Kaul, T.; Reddy, M.K.; Singla-Pareek, S.L.; Sopory, S.K. Redox homeostasis, antioxidant defense, and methylglyoxal detoxification as markers for salt tolerance in Pokkali rice. Protoplasma 2010, 245, 85–96. [Google Scholar] [CrossRef]
  38. Cakmak, I.; Strbac, D.; Marschner, H. Activities of hydrogen peroxide-scavenging enzymes in germinating wheat seeds. J. Exp. Bot. 1993, 44, 127–132. [Google Scholar] [CrossRef]
  39. Hasanuzzaman, M.; Hossain, M.A.; Fujita, M. Nitric oxide modulates antioxidant defense and the methylglyoxal detoxification system and reduces salinity-induced damage of wheat seedlings. Plant Biotechnol. Rep. 2011, 5, 353. [Google Scholar] [CrossRef]
  40. Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
  41. Hossain, M.A.; Nakano, Y.; Asada, K. Monodehydroascorbate reductase in spinach chloroplasts and its participation in regeneration of ascorbate for scavenging hydrogen peroxide. Plant Cell Physiol. 1984, 25, 385–395. [Google Scholar] [CrossRef]
  42. Costa, H.; Gallego, S.M.; Tomaro, M.L. Effect of UV-B radiation on antioxidant defense system in sunflower cotyledons. Plant Sci. 2002, 162, 939–945. [Google Scholar] [CrossRef]
  43. Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcus sp. Plant Physiol. 2000, 123, 1047–1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Murata, N. Inactivation of photosystems I and II in response to osmotic Stress in Synechococcus. Contribution of Water Channels1. Plant Physiol. 2000, 122, 1201–1208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Allakhverdiev, S.I.; Murata, N. Salt stress inhibits photosystems II and I in cyanobacteria. Photosynth. Res. 2008, 98, 529–539. [Google Scholar] [CrossRef]
  46. Takahashi, S.; Murata, N. How do environmental stresses accelerate photoinhibition? Trends Plant Sci. 2008, 13, 178–182. [Google Scholar] [CrossRef]
  47. Huang, W.; Zhang, S.B.; Cao, K.F. The different effects of chilling stress under moderate light intensity on photosystem II compared with photosystem I and subsequent recovery in tropical tree species. Photosynth. Res. 2010, 103, 175–182. [Google Scholar] [CrossRef]
  48. Talaat, N.B. Effective microorganisms: An innovative tool for inducing common bean (Phaseolus vulgaris L.) salt-tolerance by regulating photosynthetic rate and endogenous phytohormones production. Sci. Hortic. 2019, 250, 254–265. [Google Scholar] [CrossRef]
  49. Jia, X.M.; Wang, H.; Svetla, S.; Zhu, Y.F.; Hu, Y.; Cheng, L.; Zhao, T.; Wang, Y.X. Comparative physiological responses and adaptive strategies of apple Malus halliana to salt, alkali and saline-alkali stress. Sci. Hortic. 2019, 245, 154–162. [Google Scholar] [CrossRef]
  50. Elshoky, H.A.; Yotsova, E.; Farghali, M.A.; Farroh, K.Y.; El-Sayed, K.; Elzorkany, H.E.; Rashkov, G.; Dobrikova, A.; Borisova, P.; Stefanov, M.; et al. Impact of foliar spray of zinc oxide nanoparticles on the photosynthesis of Pisum sativum L. under salt stress. Plant Physiol. Biochem. 2021, 167, 607–618. [Google Scholar] [CrossRef]
  51. Yang, D.Y.; Ma, N.N.; Zhuang, K.Y.; Zhu, S.B.; Liu, Z.M.; Yang, X.H. Overexpression of tomato SlGGP-LIKE gene improves tobacco tolerance to methyl viologen-mediated oxidative stress. J. Plant Physiol. 2017, 209, 31–41. [Google Scholar] [CrossRef] [PubMed]
  52. Wang, L.; Meng, X.; Yang, D.; Ma, N.; Wang, G.; Meng, Q. Overexpression of tomato GDP-l-galactose phosphorylase gene in tobacco improves tolerance to chilling stress. Plant Cell Rep. 2014, 33, 1441–1451. [Google Scholar] [CrossRef]
  53. Arrigoni, O.; Gara, L.D.; Paciolla, C.; Evidente, A.; Pinto, M.C.D.; Liso, R. Lycorine: A powerful inhibitor of L-galactono-γ-lactone dehydrogenase activity. J. Plant Physiol. 1997, 150, 362–364. [Google Scholar] [CrossRef]
  54. Nishiyama, Y.; Murata, N. Revised scheme for the mechanism of photoinhibition and its application to enhance the abiotic stress tolerance of the photosynthetic machinery. Appl. Microbiol. Biotechnol. 2014, 98, 8777–8796. [Google Scholar] [CrossRef] [PubMed]
  55. Cheng, X.; Fang, T.; Zhao, E.; Zheng, B.; Huang, B.; An, Y.; Zhou, P. Protective roles of salicylic acid in maintaining integrity and functions of photosynthetic photosystems for alfalfa (Medicago sativa L.) tolerance to aluminum toxicity. Plant Physiol. Biochem. 2020, 155, 570–578. [Google Scholar] [CrossRef] [PubMed]
  56. Quaas, T.; Berteotti, S.; Ballottari, M.; Flieger, K.; Bassi, R.; Wilhelm, C.; Goss, R. Non-photochemical quenching and xanthophyll cycle activities in six green algal species suggest mechanistic differences in the process of excess energy dissipation. J. Plant Physiol. 2015, 172, 92–103. [Google Scholar] [CrossRef]
  57. Li, X.; Wang, S.; Chen, X.; Cong, Y.; Cui, J.; Shi, Q.; Liu, H.; Diao, M. The positive effects of exogenous sodium nitroprusside on the plant growth, photosystem II efficiency and Calvin cycle of tomato seedlings under salt stress. Sci. Hortic. 2022, 299, 111016. [Google Scholar] [CrossRef]
  58. Sonoike, K. Photoinhibition of photosystem I. Physiol Plant. 2011, 142, 56–64. [Google Scholar] [CrossRef] [PubMed]
  59. Rochaix, J.D. Regulation and dynamics of the light-harvesting system. Annu. Rev. Plant Biol. 2014, 65, 287–309. [Google Scholar] [CrossRef]
  60. Lu, T.; Shi, J.W.; Sun, Z.P.; Qi, M.F.; Liu, Y.F.; Li, T.L. Response of linear and cyclic electron flux to moderate high temperature and high light stress in tomato. J. Zhejiang Univ. Sci. B 2017, 18, 635–648. [Google Scholar] [CrossRef] [Green Version]
  61. Jiang, Y.P.; Huang, L.F.; Cheng, F.; Zhou, Y.H.; Xia, X.J.; Mao, W.H.; Shi, K.; Yu, J.Q. Brassinosteroids accelerate recovery of photosynthetic apparatus from cold stress by balancing the electron partitioning, carboxylation and redox homeostasis in cucumber. Physiol. Plant. 2013, 148, 133–145. [Google Scholar] [CrossRef]
  62. Kono, M.; Noguchi, K.; Terashima, I. Roles of the cyclic electron flow around PSI (CEF-PSI) and O₂-dependent alternative pathways in regulation of the photosynthetic electron flow in short-term fluctuating light in Arabidopsis thaliana. Plant Cell Physiol. 2014, 55, 990–1004. [Google Scholar] [CrossRef] [Green Version]
  63. Haupt-Herting, S.; Fock, H.P. Oxygen exchange in relation to carbon assimilation in water-stressed leaves during photosynthesis. Ann. Bot. 2002, 89, 851–859. [Google Scholar] [CrossRef] [Green Version]
  64. Zhou, Y.H.; Yu, J.Q.; Huang, L.F.; Nogués, S. The relationship between CO2 assimilation, photosynthetic electron transport and water–water cycle in chill-exposed cucumber leaves under low light and subsequent recovery. Plant Cell Rep. 2004, 27, 1503–1514. [Google Scholar] [CrossRef]
  65. Zhao, H.; Ye, L.; Wang, Y.; Zhou, X.; Yang, J.; Wang, J.; Cao, K.; Zou, Z. Melatonin increases the chilling tolerance of chloroplast in cucumber seedlings by regulating photosynthetic electron flux and the ascorbate-glutathione cycle. Front. Plant Sci. 2016, 7, 1814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Zhang, Q.; Cai, M.; Lu, L.; Gao, H.; Peng, C. Effects of endogenous ascorbic acid on the distribution of photosynthetic electron flow in rice leaves. Crop Pasture Sci. 2019, 70, 849–857. [Google Scholar] [CrossRef]
  67. Wei, Y.; Chen, H.; Wang, L.; Zhao, Q.; Wang, D.; Zhang, T. Cold acclimation alleviates cold stress-induced PSII inhibition and oxidative damage in tobacco leaves. Plant Signal. Behav. 2022, 17, 2013638. [Google Scholar] [CrossRef] [PubMed]
  68. Tan, S.L.; Yang, Y.J.; Liu, T.; Zhang, S.B.; Huang, W. Responses of photosystem I compared with photosystem II to combination of heat stress and fluctuating light in tobacco leaves. Plant Sci. 2020, 292, 110371. [Google Scholar] [CrossRef]
  69. Luo, Y.; Xie, Y.; He, D.; Wang, W.; Yuan, S. Exogenous trehalose protects photosystem II by promoting cyclic electron flow under heat and drought stresses in winter wheat. Plant Biol. 2021, 23, 770–776. [Google Scholar] [CrossRef]
  70. Yi, X.P.; Zhang, Y.L.; Yao, H.S.; Han, J.M.; Chow, W.S.; Fan, D.Y.; Zhang, W.F. Changes in activities of both photosystems and the regulatory effect of cyclic electron flow in field-grown cotton (Gossypium hirsutum L) under water deficit. J. Plant Physiol. 2018, 220, 74–82. [Google Scholar] [CrossRef] [Green Version]
  71. Tikkanen, M.; Rantala, S.; Aro, E.M. Electron flow from PSII to PSI under high light is controlled by PGR5 but not by PSBS. Front. Plant Sci. 2015, 6, 521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Guo, Y.Y.; Li, H.J.; Zhao, C.F.; Xue, J.Q.; Zhang, R.H. Exogenous melatonin improves drought tolerance in maize seedlings by regulating photosynthesis and the ascorbate–glutathione cycle. Russ. J. Plant Physiol. 2020, 67, 809–821. [Google Scholar] [CrossRef]
  73. Asada, K. THE WATER-WATER CYCLE IN CHLOROPLASTS: Scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 601–639. [Google Scholar] [CrossRef] [PubMed]
  74. Khalid, A.M.; Nasim, A.R. Salicylic acid-mediated alleviation of cadmium toxicity in maize leaves. Plant Sci. 2014, 2, 276–281. [Google Scholar] [CrossRef]
  75. Shan, C.; Zhang, S.; Ou, X. The roles of H2S and H2O2 in regulating AsA-GSH cycle in the leaves of wheat seedlings under drought stress. Protoplasma 2018, 255, 1257–1262. [Google Scholar] [CrossRef]
  76. Jiang, D.; Lu, B.; Liu, L.; Duan, W.; Chen, L.; Li, J.; Zhang, K.; Sun, H.; Zhang, Y.; Dong, H.; et al. Exogenous melatonin improves salt stress adaptation of cotton seedlings by regulating active oxygen metabolism. PeerJ 2020, 8, e10486. [Google Scholar] [CrossRef]
  77. Yao, M.; Ge, W.; Zhou, Q.; Zhou, X.; Luo, M.; Zhao, Y.; Wei, B.; Ji, S. Exogenous glutathione alleviates chilling injury in postharvest bell pepper by modulating the ascorbate-glutathione (AsA-GSH) cycle. Food Chem. 2021, 352, 129458. [Google Scholar] [CrossRef] [PubMed]
  78. Zhou, Y.; Diao, M.; Cui, J.X.; Chen, X.J.; Wen, Z.L.; Zhang, J.W.; Liu, H.Y. Exogenous GSH protects tomatoes against salt stress by modulating photosystem II efficiency, absorbed light allocation and H2O2-scavenging system in chloroplasts. J. Integr. Agric. 2018, 17, 2257–2272. [Google Scholar] [CrossRef] [Green Version]
  79. Duan, M.; Ma, N.N.; Li, D.; Deng, Y.S.; Kong, F.Y.; Lv, W.; Meng, Q.W. Antisense-mediated suppression of tomato thylakoidal ascorbate peroxidase influences anti-oxidant network during chilling stress. Plant Physiol. Biochem. 2012, 58, 37–45. [Google Scholar] [CrossRef] [PubMed]
  80. Heyneke, E.; Luschin-Ebengreuth, N.; Krajcer, I.; Wolkinger, V.; Müller, M.; Zechmann, B. Dynamic compartment specific changes in glutathione and ascorbate levels in Arabidopsis plants exposed to different light intensities. BMC Plant Biol. 2013, 13, 104. [Google Scholar] [CrossRef] [Green Version]
  81. Foyer, C.H.; Kyndt, T.; Hancock, R.D. Vitamin C in plants: Novel concepts, new perspectives, and outstanding issues. Antioxid. Redox Signal. 2020, 32, 463–485. [Google Scholar] [CrossRef] [PubMed]
  82. Xu, Y.; Xu, Q.; Huang, B. Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb.). Front. Plant Sci. 2015, 6, 807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  83. Chen, K.; Zhang, M.; Zhu, H.; Huang, M.; Zhu, Q.; Tang, D.; Han, X.; Li, J.; Sun, J.; Fu, J. Ascorbic acid alleviates damage from heat stress in the photosystem II of tall fescue in both the photochemical and thermal phases. Front. Plant Sci. 2017, 8, 1373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  84. Wang, Z.; Li, Q.; Wu, W.; Guo, J.; Yang, Y. Cadmium stress tolerance in wheat seedlings induced by ascorbic acid was mediated by NO signaling pathways. Ecotoxicol. Environ. Saf. 2017, 135, 75–81. [Google Scholar] [CrossRef]
Plants 12 01379 g001 550
Figure 1. Values of the maximal photochemical efficiency of PSII (Fv/Fm) (A), false-color images of Fv/Fm (B), maximal P700 changes (Pm) (C), non-photochemical quenching coefficient (NPQ) (D), photochemical quenching coefficient (qP) (E), and PSII excitation pressure (1–qP) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 1. Values of the maximal photochemical efficiency of PSII (Fv/Fm) (A), false-color images of Fv/Fm (B), maximal P700 changes (Pm) (C), non-photochemical quenching coefficient (NPQ) (D), photochemical quenching coefficient (qP) (E), and PSII excitation pressure (1–qP) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g001
Plants 12 01379 g002 550
Figure 2. Values of the effective quantum yield of PSI (Y(I)) (A), effective quantum yield of PSII (Y(II)) (B), false-color images of Y(II) (C), fraction of over P700 that is oxidized in a given state (Y(ND)) (D), the quantum yield of regulated non-photochemical energy dissipation of PSII (Y(NPQ)) (E), false-color images of Y (NPQ) (F), fraction of over P700 that cannot be oxidized in a given state (Y(NA)) (G), the quantum yield of non-regulated energy dissipation of PSII (Y(NO)) (H), and false-color images of Y(NO) (I) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 2. Values of the effective quantum yield of PSI (Y(I)) (A), effective quantum yield of PSII (Y(II)) (B), false-color images of Y(II) (C), fraction of over P700 that is oxidized in a given state (Y(ND)) (D), the quantum yield of regulated non-photochemical energy dissipation of PSII (Y(NPQ)) (E), false-color images of Y (NPQ) (F), fraction of over P700 that cannot be oxidized in a given state (Y(NA)) (G), the quantum yield of non-regulated energy dissipation of PSII (Y(NO)) (H), and false-color images of Y(NO) (I) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g002
Plants 12 01379 g003 550
Figure 3. Values of the photon activity distribution coefficients of PSI (α) (A), the photon activity distribution coefficients of PSII (β) (B), the relative deviation from full balance (β/α–1) between PSI and PSII (β/α−1) (C), the fraction of photon energy absorbed in PSII antennae utilized for photosynthetic electron transport (p) (D), the estimate of the fraction of excess excitation energy that is neither dissipated in the PSII antennae nor utilized for photochemistry (Ex) (E), and the fraction of photon energy absorbed in PSII antennae and dissipated via thermal energy in the antenna (D) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 3. Values of the photon activity distribution coefficients of PSI (α) (A), the photon activity distribution coefficients of PSII (β) (B), the relative deviation from full balance (β/α–1) between PSI and PSII (β/α−1) (C), the fraction of photon energy absorbed in PSII antennae utilized for photosynthetic electron transport (p) (D), the estimate of the fraction of excess excitation energy that is neither dissipated in the PSII antennae nor utilized for photochemistry (Ex) (E), and the fraction of photon energy absorbed in PSII antennae and dissipated via thermal energy in the antenna (D) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g003
Plants 12 01379 g004 550
Figure 4. Values of the rate of electron transport through PSII Je(PSII) (A), electron flux for the photosynthetic carbon reduction cycle (Je(PCR)) (B), electron flux for photorespiration (Je(PCO)) (C), alternative electron flux (Ja) (D), the O2-dependent alternative electron flux (Ja(O2-dependent)) (E), and the O2-independent alternative electron flux (Ja(O2-independent)) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 4. Values of the rate of electron transport through PSII Je(PSII) (A), electron flux for the photosynthetic carbon reduction cycle (Je(PCR)) (B), electron flux for photorespiration (Je(PCO)) (C), alternative electron flux (Ja) (D), the O2-dependent alternative electron flux (Ja(O2-dependent)) (E), and the O2-independent alternative electron flux (Ja(O2-independent)) (F) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g004
Plants 12 01379 g005 550
Figure 5. Ratio of Je(PCR)/Je(PSII), Je(PCO)/Je(PSII), Ja/Je(PSII), Ja(O2-dependent)/Je(PSII), and Ja(O2-independent)/Je(PSII) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3).
Figure 5. Ratio of Je(PCR)/Je(PSII), Je(PCO)/Je(PSII), Ja/Je(PSII), Ja(O2-dependent)/Je(PSII), and Ja(O2-independent)/Je(PSII) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3).
Plants 12 01379 g005
Plants 12 01379 g006 550
Figure 6. Values of the rate of electron transport through PSI (Je(PSI)) (A), the quantum yield of cyclic electron flow (CEF) around PS I (Y(CEF)) (B), Y(CEF)/Y (II) (C), and the electron flux through CEF-PSI (Je(CEF-PSI)) (D) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 6. Values of the rate of electron transport through PSI (Je(PSI)) (A), the quantum yield of cyclic electron flow (CEF) around PS I (Y(CEF)) (B), Y(CEF)/Y (II) (C), and the electron flux through CEF-PSI (Je(CEF-PSI)) (D) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g006
Plants 12 01379 g007 550
Figure 7. Values of histochemical detection of superoxide anion (O2−) (A), O·− content (B), histochemical detection of hydrogen peroxide (H2O2) (C), H2O2 content (D), histochemical detection of MDA (E), MDA content (F), and relative conductivity (G) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 7. Values of histochemical detection of superoxide anion (O2−) (A), O·− content (B), histochemical detection of hydrogen peroxide (H2O2) (C), H2O2 content (D), histochemical detection of MDA (E), MDA content (F), and relative conductivity (G) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g007
Plants 12 01379 g008 550
Figure 8. Values of reduced glutathione (GSH) content (A) and the ratio of GSH/GSSG (reduced glutathione/oxidized glutathione) (B) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 8. Values of reduced glutathione (GSH) content (A) and the ratio of GSH/GSSG (reduced glutathione/oxidized glutathione) (B) in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g008
Plants 12 01379 g009 550
Figure 9. Values of superoxidase dismutase (SOD) (A), peroxidase (POD) (B), and catalase (CAT) (C) activity in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 9. Values of superoxidase dismutase (SOD) (A), peroxidase (POD) (B), and catalase (CAT) (C) activity in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g009
Plants 12 01379 g010 550
Figure 10. Values of ascorbate peroxidase (APX) (A), glutathione reductase (GR) (B), dehydroascorbate reductase (DHAR) (C), and monodehydroascorbate reductase (MDHAR) (D) activity in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 10. Values of ascorbate peroxidase (APX) (A), glutathione reductase (GR) (B), dehydroascorbate reductase (DHAR) (C), and monodehydroascorbate reductase (MDHAR) (D) activity in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, added 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g010
Plants 12 01379 g011 550
Figure 11. Expression of SOD (superoxidase dismutase gene) (A), CAT (catalase gene) (B), POD (peroxidase gene) (C), APX (ascorbate peroxidase gene) (D), MDHAR (monodehydroascorbate reductase gene) (E), DHAR (dehydroascorbate reductase gene) (F), and GR (glutathione reductase gene) (G) genes in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, addition of 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Figure 11. Expression of SOD (superoxidase dismutase gene) (A), CAT (catalase gene) (B), POD (peroxidase gene) (C), APX (ascorbate peroxidase gene) (D), MDHAR (monodehydroascorbate reductase gene) (E), DHAR (dehydroascorbate reductase gene) (F), and GR (glutathione reductase gene) (G) genes in leaves of salt-stressed tomato seedlings with or without exogenous reduced ascorbic acid (AsA) and lycorine (AsA synthesis inhibitor) spraying. Abbreviations 3d, 6d, and 9d represent the third, sixth, and ninth day after treatment, respectively. Control, no added NaCl and sprayed with distilled water; NaCl, addition of 100 mmol·L–1 NaCl and sprayed with distilled water; NaCl + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.5 mmol·L–1 AsA; NaCl + lycorine, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine; NaCl + lycorine + AsA, added 100 mmol·L–1 NaCl and sprayed with 0.25 mmol·L–1 lycorine plus 0.5 mmol·L–1 AsA. Values are means ± SD (n = 3). Values with a different letter within a sampling date are significantly different (p < 0.05).
Plants 12 01379 g011
Plants 12 01379 g012 550
Figure 12. Schematic diagram of the effects of ascorbic acid (AsA) on photosynthetic electron transfer, current distribution, and reactive oxygen species (ROS) scavenging in the leaves of tomato seedlings under salt stress conditions. Note: the solid and dashed lines correspond to promotion and inhibition, respectively, while the relative thickness of arrows denotes an increase or decrease. Electrons generated by photosystem II (PSII) are transferred to photosystem I (PSI) via plastoquinone (PQ), the cytochrome b6/f (Cyt b6/f) complex, and plastocyanin (PC), and they ultimately reduce NADP+ to NADPH via Fd (black arrow). In the context of cyclic electron flow (CEF) around PSI, Fd can transfer electrons back to PQ and then back to PSI via Cyt b6/f and PC (orange arrow). These electron transfer reactions are coupled with proton pumping into the thylakoid lumen and produce a proton gradient across the thylakoid membrane (ΔpH). AsA promotes an increase in CEF rate under salt stress and NaCl + lycorine treatment conditions, and this increase in CEF rate contributes to the formation of ΔpH, which in turn induces an increase in non-photochemical quenching (NPQ), allocation of photosynthetic electron flux primarily to carbon assimilation and nitrogen metabolism, and a decrease in Mehler reaction electron flow. Increased NPQ induces increased photosynthetic electron flux, which is primarily allocated to carbon assimilation and nitrogen metabolism. This decreases Mehler reaction electron flow and increases the strength of the antioxidant system and the activity of key enzymes in the ascorbate–glutathione (AsA–GSH) cycle. This, in turn, reduces ROS levels, signals to the nucleus, increases gene expression, and provides negative feedback to the chloroplast, which ultimately alleviates oxidative damage to the electron donor and acceptor side of PSII. In addition, the increase in ΔpH maintained the regulation of electron transfer by Cyt b6/f and avoided the excessive accumulation of electrons at PSI to reduce the oxidative damage on the acceptor side of PSI.
Figure 12. Schematic diagram of the effects of ascorbic acid (AsA) on photosynthetic electron transfer, current distribution, and reactive oxygen species (ROS) scavenging in the leaves of tomato seedlings under salt stress conditions. Note: the solid and dashed lines correspond to promotion and inhibition, respectively, while the relative thickness of arrows denotes an increase or decrease. Electrons generated by photosystem II (PSII) are transferred to photosystem I (PSI) via plastoquinone (PQ), the cytochrome b6/f (Cyt b6/f) complex, and plastocyanin (PC), and they ultimately reduce NADP+ to NADPH via Fd (black arrow). In the context of cyclic electron flow (CEF) around PSI, Fd can transfer electrons back to PQ and then back to PSI via Cyt b6/f and PC (orange arrow). These electron transfer reactions are coupled with proton pumping into the thylakoid lumen and produce a proton gradient across the thylakoid membrane (ΔpH). AsA promotes an increase in CEF rate under salt stress and NaCl + lycorine treatment conditions, and this increase in CEF rate contributes to the formation of ΔpH, which in turn induces an increase in non-photochemical quenching (NPQ), allocation of photosynthetic electron flux primarily to carbon assimilation and nitrogen metabolism, and a decrease in Mehler reaction electron flow. Increased NPQ induces increased photosynthetic electron flux, which is primarily allocated to carbon assimilation and nitrogen metabolism. This decreases Mehler reaction electron flow and increases the strength of the antioxidant system and the activity of key enzymes in the ascorbate–glutathione (AsA–GSH) cycle. This, in turn, reduces ROS levels, signals to the nucleus, increases gene expression, and provides negative feedback to the chloroplast, which ultimately alleviates oxidative damage to the electron donor and acceptor side of PSII. In addition, the increase in ΔpH maintained the regulation of electron transfer by Cyt b6/f and avoided the excessive accumulation of electrons at PSI to reduce the oxidative damage on the acceptor side of PSI.
Plants 12 01379 g012
Table
Table 1. Parameters of chlorophyll fluorescence.
Table 1. Parameters of chlorophyll fluorescence.
Parameter and FormulaExplanation
Fv/FmThe maximal photochemical efficiency of PSII
PmThe maximal P700 changes
NPQ = (Fm − Fm′)/Fm′Non-photochemical quenching coefficient
qP = (Fm′ − Fs)/(Fm′ − Fo′)Photochemical quenching coefficient
1–qP = (F − Fo′)/(Fm′ − Fo′)PSII excitation pressure
Y(II) = (Fm′ − Fs)/ Fm′Effective quantum yield of PSII
Y(NPQ) = (Fs/Fm′) − (Fs/Fm)The quantum yield of regulated non-photochemical energy dissipation of PSII
Y(NO) = Fs/FmThe quantum yield of non-regulated energy dissipation of PSII
Y(I) = 1 − Y(ND) − Y(NA)The effective quantum yield of PSI
Y(ND) = 1 − P700redFraction of over P700 that is oxidized in a given state
Y(NA) = (Pm − Pm′)/PmFraction of over P700 that cannot be oxidized in a given state
D = (1 − Fv′/Fm′) × 100%The fraction of photon energy absorbed in PSII antennae and dissipated via thermal energy in the antenna
p = Fv′/Fm′ × qP × 100%The fraction of photon energy absorbed in PSII antennae utilized for photosynthetic electron transport
Ex = Fv′/Fm′ × (1 − qP)The estimate of the fraction of excess excitation energy that is neither dissipated in the PSII antennae nor utilized for photochemistry
Β = 1/(1 + f) and α = f/(1 + f)
f = (Fm′ − Fs)/(Fm′ − Fo′)		β and α represent the photon activity distribution coefficients of PSII and PSI, and f represents the opening degree of PSII reaction center
β/α – 1 = (1 – f)/fThe relative deviation from full balance (β/α − 1) between PSI and PSII
Table
Table 2. Parameters of the linear electron flow (LEF) and cycle electron flux (CEF) transport rate.
Table 2. Parameters of the linear electron flow (LEF) and cycle electron flux (CEF) transport rate.
Parameter and FormulaExplanation
Je(PSI) = Y(II) × PPFD × 0.84 × 0.5Electron transport rates through PSII. The value 0.5 corresponds to the assumption that excitation is equally distributed between PSI and PSII, while 0.84 corresponds to the general absorptivity of the leaves of C3 plants.
Je(PSII) = Y(II) × PPFD × 0.84 × 0.5Electron transport rates through PSI.
VC = (Pn + RP)/[1 − pO2/(2 × Sr × Cc)]The rate of Rubisco carboxylation. Pn represents net CO2 assimilation rate; RP represents the rate of day respiration; pO2 represents the ambient partial pressure of O2; Sr represents CO2/O2 relative specificity of RuBisCO; and Cc represents the partial pressure of CO2 at the carboxylation site.
VO = (VC × pO2)/(Sr × Cc)The rate of Rubisco oxygenation.
Je(PCR) = 4 × VCThe electron flux for the photosynthetic carbon reduction (PCR) cycle.
Je(PCO) = 4 × VOThe electron fluxes associated with
photorespiration (PCO) cycle.
Ja = Je(PSII) − Je(PCR) − Je(PCO)Alternative PSII electron flux not utilized by the PCR or PCO cycles.
Ja(O2-dependent) = Ja(21%O2) − Ja(2%O2)Alternative O2-dependent electron flux.
Ja(O2-independent) = Ja(2%O2)Alternative O2-independent electron flux.
Je(CEF-PSI) = Je(PSI) − Je(PSII)Electron transport rates through CEF around PSI.
Y(CEF) = Y(II) − Y(I)The quantum yield of CEF around PSI.
Y(CEF)/Y(II) = [Y(I) − Y(II)]/Y(II)The ratio of the quantum yield of CEF around PSI to the effective quantum yield of PSII.
Table
Table 3. Sequences of primers used for qRT-PCR.
Table 3. Sequences of primers used for qRT-PCR.
Gene NamePrimerSequence(5′ to 3′)
Actin (NM_001323002.1)FORWARDTGACTACGAGCAGGAACTTGAAACC
REVERSEAACGGAACCTCTCAGCACCAATG
SOD (M37151.1)FORWARDCGGGTGACCTGGGAAACATAGTG
REVERSEACCACAAGTGCTCGTCCAACAAC
CAT (NM_001247898.1)FORWARDGCTCCCAGTTAATGCTCCCAAGTG
REVERSECAAGAAGGAATCGGGTACTGCTCAG
POD (L13654.1)FORWARDGAGAGGTCTGTTCCAATCCGATGC
REVERSETTCGTTGAGTGGTCCATCTACAAGC
APX (AY974805.1)FORWARDAATTGGCTGGTGTTGTTGCTGTTG
REVERSEGGTGGTTCTGGTTTGTCCTCTCTG
MDHAR (NM_001247084.2)FORWARDGGGTTCTTCTTGAAAGTGGGAGTCC
REVERSEGAGCCTCTTCAACCGACGATGC
DHAR (NM_001247893.2)FORWARDAAGAAGTGGAGTGTGCCTGAAAGC
REVERSEAGCCTTGGTTTTCTGGAACGACTC
GR (NM_001321393.1)FORWARDAGGTTGAATCTGGATGCTGTTGGTG
REVERSEAATGCTGGGTATATTGGTGCGTGAG
Note: Actin (internal control gene); SOD (superoxidase dismutase gene), CAT (catalase gene), POD (peroxidase gene), APX (ascorbate peroxidase gene), MDHAR (monodehydroascorbate reductase gene), DHAR (dehydroascorbate reductase gene), GR (glutathione reductase gene).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, X.; Han, H.; Cong, Y.; Li, X.; Zhang, W.; Wan, W.; Cui, J.; Xu, W.; Diao, M.; Liu, H. The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress. Plants 2023, 12, 1379. https://doi.org/10.3390/plants12061379

AMA Style

Chen X, Han H, Cong Y, Li X, Zhang W, Wan W, Cui J, Xu W, Diao M, Liu H. The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress. Plants. 2023; 12(6):1379. https://doi.org/10.3390/plants12061379

Chicago/Turabian Style

Chen, Xianjun, Hongwei Han, Yundan Cong, Xuezhen Li, Wenbo Zhang, Wenliang Wan, Jinxia Cui, Wei Xu, Ming Diao, and Huiying Liu. 2023. "The Protective Effect of Exogenous Ascorbic Acid on Photosystem Inhibition of Tomato Seedlings Induced by Salt Stress" Plants 12, no. 6: 1379. https://doi.org/10.3390/plants12061379

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop