Straw Mulch Induced Indoleamines Alleviate Reproductive Depression in Cold Sensitive Hazelnut Cultivars
Abstract
:1. Introduction
2. Results
2.1. Reproductive Phase Development in Hazelnut
2.2. Phenology
2.3. Separation of Metabolites and Metabolite Detection (UPLC-MS)—Snowmelt Percolation Study
2.4. Separation of Metabolites and Metabolite Detection (UPLC-MS)—Straw Mulch Study
2.5. Changes in the Expression of Indoleamine Pathway Genes—Snowmelt Percolation Study
2.6. Changes in the Expression of Indoleamine Pathway Genes—Straw Mulch Study
3. Discussion
3.1. Expression Patterns of Indoleamine Pathway Genes and Associated Metabolite Titers—Snowmelt Percolation Study
3.2. Percent Female Flowers, Expression Patterns of Indoleamine Pathway Genes and Associated Metabolite Titers—Straw Mulch Study
4. Materials and Methods
4.1. Reproductive Phase Development in Hazelnut
4.2. Field Experiment—Snowmelt Percolation Study (Figure 1)
4.3. Field Experiment—Straw Mulch Study (Figure 1)
4.4. Sample Collection
4.5. Separation of Metabolites and Metabolite Detection (UPLC-MS)
4.6. Identification of Orthologous Gene Sequences
4.7. RNA Extraction, cDNA Synthesis and Gene Expression Analysis
4.8. Data Analyses
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Murch, S.J.; Alan, A.R.; Cao, J.; Saxena, P.K. Melatonin and Serotonin in Flowers and Fruits of Datura metel L. J. Pineal Res. 2009, 47, 277–283. [Google Scholar] [CrossRef]
- Murch, S.J.; KrishnaRaj, S.; Saxena, P.K. Tryptophan Is a Precursor for Melatonin and Serotonin Biosynthesis in in Vitro Regenerated St. John’s Wort (Hypericum perforatum L. cv. Anthos) Plants. Plant Cell Rep. 2000, 19, 698–704. [Google Scholar] [CrossRef]
- Uchendu, E.E.; Shukla, M.R.; Reed, B.M.; Saxena, P.K. An Efficient Method for Cryopreservation of St John’s Wort and Tobacco: Role of Melatonin. Acta Hortic. 2014, 1039, 233–241. [Google Scholar] [CrossRef]
- Erland, L.A.E.; Yasunaga, A.; Li, I.T.S.; Murch, S.J.; Saxena, P.K. Direct Visualization of Location and Uptake of Applied Melatonin and Serotonin in Living Tissues and Their Redistribution in Plants in Response to Thermal Stress. J. Pineal Res. 2019, 66, e12527. [Google Scholar] [CrossRef] [Green Version]
- Bajwa, V.S.; Shukla, M.R.; Sherif, S.M.; Murch, S.J.; Saxena, P.K. Role of Melatonin in Alleviating Cold Stress in Arabidopsis thaliana. J. Pineal Res. 2014, 56, 238–245. [Google Scholar] [CrossRef]
- Chang, J.; Guo, Y.; Zhang, Z.; Wei, C.; Zhang, Y.; Ma, J.; Yang, J.; Zhang, X.; Li, H. CBF-Responsive Pathway and Phytohormones Are Involved in Melatonin-Improved Photosynthesis and Redox Homeostasis under Aerial Cold Stress in Watermelon. Acta Physiol. Plant 2020, 42, 159. [Google Scholar] [CrossRef]
- Fenollosa, E.; Gámez, A.; Munné-Bosch, S. Plasticity in the Hormonal Response to Cold Stress in the Invasive Plant Carpobrotus edulis. J. Plant Physiol. 2018, 231, 202–209. [Google Scholar] [CrossRef] [PubMed]
- Friedman, M. Analysis, Nutrition, and Health Benefits of Tryptophan. Int. J. Tryptophan Res. 2018, 11, 1178646918802282. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Williams, C.C.; Last, R.L. Induction of Arabidopsis Tryptophan Pathway Enzymes and Camalexin by Amino Acid Starvation, Oxidative Stress, and an Abiotic Elicitor. Plant Cell 1998, 10, 359–370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanjaya; Hsiao, P.Y.; Su, R.C.; Ko, S.S.; Tong, C.G.; Yang, R.Y.; Chan, M.T. Overexpression of Arabidopsis thaliana Tryptophan Synthase Beta 1 (AtTSB1) in Arabidopsis and Tomato Confers Tolerance to Cadmium Stress. Plant Cell Environ. 2008, 31, 1074–1085. [Google Scholar] [CrossRef] [PubMed]
- Erland, L.A.E.; Saxena, P. Auxin Driven Indoleamine Biosynthesis and the Role of Tryptophan as an Inductive Signal in Hypericum perforatum (L.). PLoS ONE 2019, 14, e0223878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erland, L.A.E.; Shukla, M.R.; Singh, A.S.; Murch, S.J.; Saxena, P.K. Melatonin and Serotonin: Mediators in the Symphony of Plant Morphogenesis. J. Pineal Res. 2018, 64, e12452. [Google Scholar] [CrossRef]
- Kang, S.; Kang, K.; Lee, K.; Back, K. Characterization of Rice Tryptophan Decarboxylases and Their Direct Involvement in Serotonin Biosynthesis in Transgenic Rice. Planta 2007, 227, 263–272. [Google Scholar] [CrossRef]
- Wang, B.; Chu, J.; Yu, T.; Xu, Q.; Sun, X.; Yuan, J.; Xiong, G.; Wang, G.; Wang, Y.; Li, J. Tryptophan-Independent Auxin Biosynthesis Contributes to Early Embryogenesis in Arabidopsis. Proc. Natl. Acad. Sci. USA 2015, 112, 4821–4826. [Google Scholar] [CrossRef]
- Fujiwara, T.; Maisonneuve, S.; Isshiki, M.; Mizutani, M.; Chen, L.; Ling Wong, H.; Kawasaki, T.; Shimamoto, K. Sekiguchi Lesion Gene Encodes a Cytochrome P450 Monooxygenase That Catalyzes Conversion of Tryptamine to Serotonin in Rice. J. Biol. Chem. 2010, 285, 11308–11313. [Google Scholar] [CrossRef] [Green Version]
- Taghavi, T.; Dale, A.; Kelly, J.M.; Galic, D.; Rahemi, A. Performance of Hazelnut Cultivars and Selections in Southern Ontario. Can. J. Plant Sci. 2020, 100, 537–548. [Google Scholar] [CrossRef]
- Ayyanath, M.-M.; Shukla, M.R.; Saxena, P.K. Role of Water Percolation in Reproductive Physiology of Hazelnut (Corylus spp.). Environ. Exp. Bot. 2021, 182, 104278. [Google Scholar] [CrossRef]
- Bavougian, C.M.; Read, P.E. Mulch and Groundcover Effects on Soil Temperature and Moisture, Surface Reflectance, Grapevine Water Potential, and Vineyard Weed Management. PeerJ 2018, 6, e5082. [Google Scholar] [CrossRef]
- Subrahmaniyan, K.; Zhou, W. Soil Temperature Associated with Degradable, Non-Degradable Plastic and Organic Mulches and Their Effect on Biomass Production, Enzyme Activities and Seed Yield of Winter Rapeseed (Brassica napus L.). J. Sustain. Agric. 2008, 32, 611–627. [Google Scholar] [CrossRef]
- Liu, C.; Lu, M.; Cui, J.; Li, B.; Fang, C. Effects of Straw Carbon Input on Carbon Dynamics in Agricultural Soils: A Meta-Analysis. Glob. Chang. Biol. 2014, 20, 1366–1381. [Google Scholar] [CrossRef]
- Kaur, H.; Mukherjee, S.; Baluska, F.; Bhatla, S.C. Regulatory Roles of Serotonin and Melatonin in Abiotic Stress Tolerance in Plants. Plant Signal. Behav. 2015, 10, e1049788. [Google Scholar] [CrossRef] [Green Version]
- Odlum, K.D.; Blake, T.J.; Kim, Y.T.; Glerum, C. Influence of Photoperiod and Temperature on Frost Hardiness and Free Amino Acid Concentrations in Black Spruce Seedlings. Tree Physiol. 1993, 13, 275–282. [Google Scholar] [CrossRef]
- Zhao, D.; Yao, Z.; Zhang, J.; Zhang, R.; Mou, Z.; Zhang, X.; Li, Z.; Feng, X.; Chen, S.; Reiter, R.J. Melatonin Synthesis Genes N-Acetylserotonin Methyltransferases Evolved into Caffeic Acid O-Methyltransferases and both Assisted in Plant Terrestrialization. J. Pineal Res. 2021, 71, e12737. [Google Scholar] [CrossRef]
- Xu, F.; Liu, W.; Wang, H.; Alam, P.; Zheng, W.; Faizan, M. Genome Identification of the Tea Plant (Camellia sinensis) ASMT Gene Family and Its Expression Analysis under Abiotic Stress. Genes 2023, 14, 409. [Google Scholar] [CrossRef] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Functions of Melatonin in Plants: A Review. J. Pineal Res. 2015, 59, 133–150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Laing, C.; Zheng, G.; Li, W.; Wang, Y.; Hu, B.; Wu, H.; Zhu, X. Melatonin Delays Leaf Senescence and Enhances Salt Stress Tolerance in Rice. J. Pineal Res. 2015, 59, 91–101. [Google Scholar] [CrossRef]
- Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-Term Exogenous Application of Melatonin Delays Drought-Induced Leaf Senescence in Apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef]
- Muñoz, K.; Thiele-Bruhn, S.; Kenngott, K.G.J.; Meyer, M.; Diehl, D.; Steinmetz, Z.; Schaumann, G.E. Effects of Plastic versus Straw Mulching Systems on Soil Microbial Community Structure and Enzymes in Strawberry Cultivation. Soil Syst. 2022, 6, 21. [Google Scholar] [CrossRef]
- Dugan, I.; Pereira, P.; Barcelo, D.; Telak, L.J.; Filipovic, V.; Filipovic, L.; Kisic, I.; Bogunovic, I. Agriculture Management and Seasonal Impact on Soil Properties, Water, Sediment and Chemicals Transport in a Hazelnut Orchard (Croatia). Sci. Total Environ. 2022, 839, 156346. [Google Scholar] [CrossRef]
- Boyoucos, G. An Investigation of Soil Temperatures and Some of the Factors Influencing It. Mich. Agric. Coll. Exp. Stn. Tech. Bull. 1913, 1–196. [Google Scholar]
- Michailidis, M.; Karagiannis, E.; Tanou, G.; Sarrou, E.; Adamakis, I.D.; Karamanoli, K.; Martens, S.; Molassiotis, A. Metabolic Mechanisms Underpinning Vegetative Bud Dormancy Release and Shoot Development in Sweet Cherry. Environ. Exp. Bot. 2018, 155, 1–11. [Google Scholar] [CrossRef]
- Zhang, H.; Wang, L.; Shi, K.; Shan, D.; Zhu, Y.; Wang, C.; Bai, Y.; Yan, T.; Zheng, X.; Kong, J. Apple Tree Flowering Is Mediated by Low Level of Melatonin under the Regulation of Seasonal Light Signal. J. Pineal Res. 2019, 66, e12551. [Google Scholar] [CrossRef] [PubMed]
- Germain, E. The Reproduction of Hazelnut (Corylus avellana L.): A Review. Acta Hortic. 1994, 351, 195–210. [Google Scholar] [CrossRef]
- Freixas-Coutin, J.A.; An, S.; Postman, J.; Bassil, N.V.; Yates, B.; Shukla, M.; Saxena, P.K. Development of a Reliable Corylus sp. Reference Database through the Implementation of a DNA Fingerprinting Test. Planta 2019, 249, 1863–1874. [Google Scholar] [CrossRef]
- Rowley, E.R.; Fox, S.E.; Bryant, D.W.; Sullivan, C.M.; Priest, H.D.; Givan, S.A.; Mehlenbacher, S.A.; Mockler, T.C. Assembly and Characterization of the European Hazelnut “Jefferson” Transcriptome. Crop Sci. 2012, 52, 2679–2686. [Google Scholar] [CrossRef]
- Rowley, E.R.; VanBuren, R.; Bryant, D.W.; Priest, H.D.; Mehlenbacher, S.A.; Mockler, T.C. A Draft Genome and High-Density Genetic Map of European Hazelnut (Corylus avellana L.). bioRxiv 2018, 469015. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Zhang, J.; Liu, Q.; Guo, W.; Zhao, T.; Ma, Q.; Wang, G. Transcriptome Sequencing and Identification of Cold Tolerance Genes in Hardy Corylus Species (C. heterophylla Fisch) Floral Buds. PLoS ONE 2014, 9, e108604. [Google Scholar] [CrossRef] [Green Version]
- Gasic, K.; Hernandez, A.; Korban, S.S. RNA Extraction from Different Apple Tissues Rich in Polyphenols and Polysaccharides for cDNA Library Construction. Plant Mol. Biol. Rep. 2004, 22, 437. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ayyanath, M.-M.; Shukla, M.R.; Saxena, P.K. Indoleamines Impart Abiotic Stress Tolerance and Improve Reproductive Traits in Hazelnuts. Plants 2023, 12, 1233. [Google Scholar] [CrossRef]
Gene Name | Forward | Reverse |
---|---|---|
TDC | GCCCGGTTATCTTCGTGGAA | TGGGCTTTGCCAATGGGTTA |
SNAT | GCGATCATATGGGACGTGGT | TCCCTTTGGATGACAGCTCG |
ASMT | GCAAACGTTGGTGAAGGCAT | ACCCCCGACATGTTCAACTC |
COMT | CACCGGCACTTTCCTCTCAT | GCTTAGCATCCGGTCCAGAA |
Actin | GATGATGCTCCAAGGGCAGT | TTTCGACTGGGCCTCATCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ayyanath, M.-M.; Shukla, M.R.; Hezema, Y.S.; Saxena, P.K. Straw Mulch Induced Indoleamines Alleviate Reproductive Depression in Cold Sensitive Hazelnut Cultivars. Plants 2023, 12, 2577. https://doi.org/10.3390/plants12132577
Ayyanath M-M, Shukla MR, Hezema YS, Saxena PK. Straw Mulch Induced Indoleamines Alleviate Reproductive Depression in Cold Sensitive Hazelnut Cultivars. Plants. 2023; 12(13):2577. https://doi.org/10.3390/plants12132577
Chicago/Turabian StyleAyyanath, Murali-Mohan, Mukund R. Shukla, Yasmine S. Hezema, and Praveen K. Saxena. 2023. "Straw Mulch Induced Indoleamines Alleviate Reproductive Depression in Cold Sensitive Hazelnut Cultivars" Plants 12, no. 13: 2577. https://doi.org/10.3390/plants12132577