Next Article in Journal
All-Trans Retinoic Acid Attenuates Fibrotic Processes by Downregulating TGF-β1/Smad3 in Early Diabetic Nephropathy
Next Article in Special Issue
Identification, Classification and Screening for γ-Amino-butyric Acid Production in Lactic Acid Bacteria from Cambodian Fermented Foods
Previous Article in Journal
Combination of Transcriptomic, Proteomic, and Metabolomic Analysis Reveals the Ripening Mechanism of Banana Pulp
Previous Article in Special Issue
Dose-Dependent Alterations to In Vitro Human Microbiota Composition and Butyrate Inhibition by a Supercritical Carbon Dioxide Hops Extract
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Prevalence, Antibiotic Resistance and Biofilm Formation of Staphylococcus aureus in Bulk Ready-To-Eat Foods

1
College of Biomass Science and Engineering, and Healthy Food Evaluation Research Center, Sichuan University, Chengdu 610065, China
2
Chengdu Institute for Food and Drug Control, Chengdu 610045, China
*
Authors to whom correspondence should be addressed.
Biomolecules 2019, 9(10), 524; https://doi.org/10.3390/biom9100524
Submission received: 2 August 2019 / Revised: 18 September 2019 / Accepted: 21 September 2019 / Published: 23 September 2019
(This article belongs to the Special Issue Function of Microorganism in Food Production)

Abstract

:
The prevalence of Staphylococcus aureus in 2160 bulk ready-to-eat foods from the Sichuan province of China during 2013–2016 was investigated. The antibiotic resistance and the associated genes, as well as biofilm formation capacity of the S. aureus isolates were measured. Furthermore, the relationship between the antibiotic resistance and the resistant genes was discussed. It was found that 54 S. aureus isolates were recovered, and their prevalence in meat products, dairy, fruit and vegetables, and desserts were 31 (2.6%), six (3.0%), nine (2.2%) and eight (2.3%), respectively. Most strains (52/54) were resistant to at least one of the antibiotics, and 21 isolates were identified as multidrug-resistant (MDR) S. aureus. Three isolates were found to be methicillin-resistant S. aureus. Penicillin, erythromycin, clindamycin, tetracycline and inducible clindamycin resistance were determined as the predominant antibiotics, and the isolates with the phenotypic resistance on these five antibiotics were all determined positive for the resistant gene associated. In total, 33 of 54 S. aureus isolates showed biofilm formation capacity, including two strong biofilm producers, one moderate and 30 weak ones. Two S. aureus isolates with strong biofilm formation abilities showed multi-drug resistance, and one moderate biofilm producer was resistant to two categories of antibiotics.

1. Introduction

Ready-to-eat food in bulk (RTEIB food) is one of the main categories of food sold in market. It is popular by consumers for its good flavor, nutrition and convenient processing without heat treatment or with low heat treatment. Due to weak sterilization intensity and lack of packing, RTEIB food could be easily contaminated by microorganisms and chemical hazards during transportation, sale and storage. Remarkably, Staphylococcus aureus is considered as one of the main food safety hazards [1]. S. aureus is one of important foodborne pathogens and can produce Staphylococcal enterotoxins, which can induce severe symptoms; i.e. nausea, violent vomiting, abdominal cramping and diarrhea [2,3]. This pathogen has been detected from some ready-to-eat foods, such as vegetables salads, cooked noodles, cooked meat and desserts [4,5]. Therefore, investigating the prevalence of S. aureus could be of great significance for evaluating the food safety risks of RTEIB foods.
The antibiotic resistance of pathogenic bacteria poses great harm to human health and public safety. As is reported, S. aureus with antibiotic resistance has caused foodborne outbreaks [6,7,8]. Therefore, understanding the resistance of S. aureus on common antibiotics and factors influencing microbial resistance will help with the prevention and elimination of food-borne, resistant S. aureus. The antibiotic resistance of S. aureus is generally considered to be associated with specific resistance genes. Jarajreh and Ng found that the resistance of S. aureus to erythromycin, clindamycin and inducible clindamycin was mainly due to ermA or ermC genes [9,10]. Ng found the resistance of S. aureus to tetracycline was related to tetM and tetK genes [9]. Moreover, biofilms may also have an impact on the antibiotic resistance of pathogenic bacteria [11]. A biofilm is a mixed extracellular matrix, which is mainly composed of polysaccharides, proteins and RNA or DNA [12]. Kaplan and Wu found that the bacteria in biofilms exhibited 10 to 1500 times more resistance to antibiotics than free cells [13,14]. Biofilms can prevent the access of antibiotics and improve bacterial resistance [12]. To the best of our knowledge, the prevalence of and antibiotic resistance of S. aureus in RTEIB foods in the Sichuan province of China are low. In this study, the prevalence of S. aureus in 2160 RTEIB food samples collected from Sichuan province, China during 2013–2016, including meat product, dairy, fruit and vegetables, and desserts, was detected. The antibiotic resistance, resistance genes and biofilm forming ability of S. aureus isolated from samples were determined. Furthermore, the relationship between the antibiotic resistance and the resistant genes was discussed.

2. Materials and Methods

2.1. Sample Collection

A total of 2160 RTEIB food samples, including 1209 meat products, 200 dairy products, 401 fruit and vegetables, and 350 desserts, were collected from Sichuan province, China, from 2013 to 2016. Samples were placed in sterile bags and packed in insulated containers with ice for storage. Samples were transported directly to laboratory for testing within 4 h.

2.2. Isolation and Identification of Staphylococcus Aureus

Both the isolation and identification of S. aureus were performed as previously described by Wang, with minor modifications [15]. Briefly, RTEIB food was ground, and a 25 g minced sample was placed into a sterilized plastic bag, and manually rinsed in 400 mL of buffered peptone water (BPW, Beijing Land Bridge Technology Ltd, China) for 2 min, ensuring that all surfaces were rinsed. The rinsed powder was then incubated at 37 °C for 24 h. A 5 mL aliquot of pre-enrichment product was transferred to 50 mL of trypticase soy broth (TSB, Beijing Land Bridge Technology Ltd.) containing 7.5% NaCl. After incubation at 37 °C for 24 h, a loop of the culture was streaked onto Baird-Parker agar (BPA, Beijing Land Bridge Technology Ltd.) plates with 5% egg yolk and tellurite. Following incubation at 37 °C for 24 h, one or two presumptive coagulase-positive colonies on each sample were selected and transferred into trypticase soy agar (TSA, Beijing Land Bridge Technology Ltd.) plates with 0.6% yeast extract for further purification. Strains isolated were confirmed using VITEK 2 automatic bacteria identification system (BioMerieux, Lyon, France) and 16S rDNA sequencing by Shenggong Biotechnology Co., Ltd., Shanghai, China.

2.3. Antimicrobial Susceptibility Testing

Antibiotic resistance to 17 common drugs covered 13 antimicrobial categories, as shown in Table 1. These categories were applied for the determinations of multidrug-resistant (MDR) and extensively drug-resistant (XDR) S. aureus. Multidrug-resistant (MDR) was defined as acquired resistance to at least one agent in three or more antimicrobial categories, and XDR was resistant to at least one agent in all, but susceptible to two or more antimicrobial categories [16]. The minimum inhibitory concentrations (MICs) of 17 drugs were assessed on VITEK 2 system (BioMerieux) using AST-GP67 test card according to the manufacturer’s instructions. Interpretive breakpoints for susceptibility and resistance were consistent with Clinical and Laboratory Standards Institute guidelines (CLSI) in 2018.

2.4. The Detection of Antibiotic Resistant Genes

DNA was extracted using a bacterial genomic DNA extraction kit (TIANGEN, Beijing, China) according to the manufacturer’s instruction. S. aureus isolates were tested by polymerase chain reaction for the methicillin resistance gene (mecA) to confirm methicillin-resistant S. aureus (MRSA). Other antibiotic resistance genes (blaZ, ermC, ermA, tetK, tetM and tetL) were also investigated. All primer sequences are shown in Table 2. The PCR reactions were performed using 96 Well Thermal Cycler PCR (Thermo Flsher Scientific, Shanghai, China). Each PCR reaction contained 1 µL (10 µM) of forward primer, 1 µL (10 µM) of reverse primer, 25 µL Taq HS Perfect Mix (TaKaRa, Beijing, China) and 1 µL of DNA extract. The final volume was 50 µL, made up by adding sterile water. Polymerase chain reactions were performed using an initial denaturation step 94 °C for 5 s, followed by 35 cycles of 94 °C for 5 s, 55 °C for 25 s and 68 °C for 20 s. The PCR products were stained and electrophoresed in 1.5% agarose gel at 120 V for 20 min.

2.5. Biofilm Formation Assays

The biofilm formation ability of the strain tested was estimated using the crystal violet staining method described by Jitendra Patel with minor modifications [20]. Overnight cultures of individual S. aureus grown in tryptic soy broth (TSB) were adjusted to 0.5 McFarland units with 1/10 TSB. The suspension was then 1:10 diluted with 1/10 TSB, and 200 µL of the diluted suspension was deposited in a sterile 96-well polystyrene microtiter plate. Growth medium devoid of bacterial inoculum served as a negative control. After 48 h of incubation at 28 °C, 200 µL of culture was completely removed by aspiration and the wells were washed five times with sterile distilled water. The plates were air-dried for 20 min, and 200 µL of crystal violet solution (0.41% w/v dye, Phygene, Fujian, China) was added and incubated at an ambient temperature for 20 min. After the plates were further washed and air-dried, 200 µL of 95% ethanol was added to dissolve the crystal violet dye. Biofilm formation capacity was characterized by measuring the optical density at 570 nm (OD570) with a microplate spectrophotometer (BioTek Instruments, Winooski, VT, USA). S. aureus strain ATCC 6538 was used as a reference strain. All experiments were carried out in triplicate. The cut-off OD (ODc) was defined as three standard deviations above the mean OD of the negative controls. Strains were classified into four categories: not-at-all biofilm producers when OD/ODc ≤ 1, weak biofilm producers when 1 < OD/ODc ≤ 2, moderate biofilm producers when 2 < OD/ODc ≤ 4, or strong biofilm producers when 4 < OD/ODc [21].

2.6. Statistical Analyses

Data analyses were performed using statistical product and service solutions (SPSS) for Windows version 22.0 (IBM company, Armonk, NY, USA).

3. Result and Discussion

3.1. The Prevalence of Staphylococcus Aureus Separated from Ready-to-Eat Food in Bulk in Sichuan Province, China

A total of 2160 RTEIB foods (meat products, n = 1209; dairy, n = 200; fruit and vegetables, n = 401; desserts, n = 350) were collected from Sichuan province, China during 2013–2016. It was found that 42 (1.9%) RTEIB samples were detected positive for S. aureus; that is, 24 (2.0%) meat products, four (2.0%) dairy, seven (1.8%) fruit and vegetables, and seven (2.0%) desserts, as shown in Table 3. The occurrence of S. aureus was almost the same in meat products, dairy and desserts, and was slightly higher compared with the prevalence in fruit and vegetables. Fifty-four S. aureus isolates were recovered. The prevalence of S. aureus in meat products, dairy, vegetables and fruit, and desserts was 2.6% (31/1209), 3.0% (6/200), 2.2% (9/401) and 2.3% (8/350), respectively. Yang et al. found that 1.1% (39/3417) of bulk ready-to-eat meat products collected from China in 2016 had S. aureus at more than 100 CFU/g (colony-forming units/g), and meat with sauce showed the highest microbial contamination rate of 1.6% (30/1909) compared with other four categories of RTEIB meat products [1]. Harada et al. detected 16 (5.7%) S. aureus strains from 282 ready-to-eat foods, including six (6.3%) strains from lightly pickled vegetables; seven (8.0%) from a western-style dessert; and three (3.1%) from ready-to-eat fish and seafood products, retailed from Osaka Prefecture, Japan [22]. Kim, Yun and Rhee found that 6.0% (197/3293) of refrigerated ready-to-eat foods (sushi, kimbab and California rolls) were contaminated with S. aureus [23]. Those results suggested that the prevalence of S. aureus in RTEIB foods from Sichuan province of China was at a relatively low level compared with that from other regions or food types, which might be related with raw material origins, processing technology and analytical methods. However, this study revealed that the S. aureus contamination in RTEIB foods from Sichuan province of China should cause more concern.

3.2. Phenotypic Resistance and the Associated Genes of Staphylococcus Aureus Isolates

Antimicrobial susceptibility testing showed that all 54 S. aureus isolates were susceptible to vancomycin, tigecycline, linezolid and quinupristin/dalfopristin. Antibiotics resistance associated with product types are shown in Table 4. Forty-nine (90.7%), 25 (46.3%) and 22 (40.7%) of the 54 isolates were resistant to penicillin, erythromycin and clindamycin, respectively, followed by 12 (22.2%) isolates that were resistant to tetracycline. 10 (18.5%) had inducible clindamycin resistance. Only several isolates were resistant to ciprofloxacin (13.0%), gentamicin (13.0%), trimethoprim/sulfamethoxazole (11.1%), levofloxacin (7.4%), moxifloxacin (7.4%), cefoxitin (5.6%), oxacillin (5.6%) and rifampin (1.9%). These results could be due to the fact that antibiotics have been used increasingly for treatment of bacterial diseases in humans and animals. Several antibiotics, especially for β-lactams (penicillin), macrolides (erythromycin) and lincosamide (clindamycin), are generally applied in veterinary medicine [24]. The low resistance rate of the isolates to oxacillin may be due to the fact that oxacillin is not commonly used in pesticides, feed and food raw materials. This finding is quite different from the high resistance (70.3%, 52/74) to oxacillin in clinical samples; oxacillin is the drug indicated for the treatment of infections caused by S. aureus [25]. Li et al. isolated 104 S. aureus strains from 507 raw chicken from retail markets, and 95 (91.3%) isolates showed resistance to penicillin [26]. A total of 128 S. aureus isolates were recovered from 87 ready-to-eat foods collected in Bangladesh, and 100 (78.1%) and 52 (40.6%) isolates were resistant to erythromycin and tetracycline, respectively [27]. Zehra et al. detected 89 S. aureus strains in 409 retail meats from Punjab, India. Six (6.7%) and six (6.7%) isolates exhibited resistance to clindamycin and inducible clindamycin, respectively [28]. In addition, 21 (38.9%) isolates were identified as MDR (Table 3), and penicillin-erythromycin-clindamycin (P-E-CM) (n = 20), penicillin-erythromycin-clindamycin-inducible clindamycin resistance (P-E-CM-ICR) (n = 9), penicillin-erythromycin-clindamycin-gentamicin (P-E-CM-GM) (n = 7) and penicillin-erythromycin-clindamycin-trimethoprim/sulfamethoxazole (P-E-CM-SXT) (n = 6) were the main MDR profiles in the isolates. MDR isolates were distributed in four types of RTEIB foods, and it was noted that all the six isolates from dairy were determined to be MDR. Three (5.6%) isolates were identified as MRSA, one of which was isolated from a meat product and the other two were from desserts. None that were XDR were detected.
A combined comparison was carried out in four products categories. The S. aureus isolates from meat products showed resistance to 10 categories (13 kinds) of antibiotics, and the isolates from dairy, vegetables and fruit, and desserts, were resistant to seven categories (seven kinds), seven categories (nine kinds) and six categories (seven kinds), respectively. This founding could be correlated with the frequent administration of macrolide-class tylosin to animals, resulting in the development of cross-resistance to the Macrolides, Lincosamides and Streptogramins [29], but more meat product samples were tested than the other three foods in this study. It was found that penicillin resistance exhibited high rates in all four products. Erythromycin and clindamycin resistance rates are significantly higher in meat products and dairy compared to fruit, vegetables and desserts. The existence of inducible clindamycin resistance was only found in meat products and dairy. In addition, other antibiotic resistances were randomly distributed because of low performance of resistance.
Penicillin, erythromycin, clindamycin, tetracycline and inducible clindamycin resistance were determined as the predominant antibiotics resisted by the 54 S. aureus isolates (as shown in Table 4), and so their resistant genes, i.e. blaz, erm (ermA and/or ermC) and tet (tetL, tetM and/or tetK), were also measured. In total, 54 (100%), 47 (87%) and 51 (94.4%) of 54 isolates were positive for genes blaz, erm and tet, respectively. It is worth noting that the isolates with the phenotypic resistance od these five antibiotics, were all determined positive for the resistant gene associated, as shown in Table 5. Zelazny reported that ermA and ermC genes could encode methylase, which was involved in the modulation of resistance against clindamycin and erythromycin [30]. Therefore, a resistance gene can be used as an important reference for the evaluation of microbial resistance. However, the isolates with resistance genes do not always exhibit phenotypic resistance.

3.3. The Biofilm Formation Abilities of Staphylococcus aureus Isolates

As shown in Table 5, 33 (61.1%) of 54 S. aureus isolates showed biofilm formation capacity, including two (3.7%) strong biofilm producers, one (1.9%) moderate and 30 (55.6%) weak. It revealed that most (51/54) of the isolates in this study possessed no or weak biofilm formation ability, which is consistent with the S. aureus isolated from foods and is greatly different to that collected from clinical samples. Kroning et al. reported that the S. aureus isolates from handmade sweets were all characterized as not-at-all or weak biofilm producers [31]. Bimanand et al. found that 92 (95.8%) of the S. aureus isolates from clinical samples were biofilm producers, and the distributions of biofilm formation between isolates were four (4.2%), 52 (54.2%) and 44 (35.4%) as strong, moderate and weak, respectively [32]. Comparison from four products categories: 20 (64.5%) of 31 isolates from meat products had biofilm formation ability, and six (100%), three (33.3%) and four (50%) of the isolates were characterized as biofilm producers from dairy, vegetables and fruit, and desserts, respectively. The isolates from meat products showed varied biofilm formation ability, including two strong biofilm producers, one moderate, 17 weak and 11 not-at-all ones. The six isolates from dairy all had weak biofilm formation capacity, while the strains from fruit and vegetables, and desserts, exhibited weak or no ability. Aslantas and Demir found that the S. aureus with biofilm formation ability could be detected in cows, especially in bovine mastitis cases [33], which might be the reason for the high rate of biofilm producers detected from dairy in this study. Antibiotic resistant categories and the biofilm formation ability of the 54 S. aureus isolated from RTEIB foods are shown in Figure 1. Two S. aureus isolates with strong biofilm formation ability showed multidrug-resistance, and one moderate biofilm producer was resistant to two categories of antibiotics. The weak or not-at-at-all biofilm producers showed different antibiotic resistance ranges, from one to three or more categories, except two isolates.

4. Conclusions

Fifty-four S. aureus isolates were recovered from 2160 samples, and their presence in meat products, dairy, fruits and vegetables and desserts were 31/1209 (2.6%), 6/200 (3.0%), 9/401 (2.2%) and 8/350 (2.3%), respectively. Most strains (52/54) were resistant to at least one of the antibiotics, and 21 (38.9%) and three (5.6%) isolates were respectively identified as MDR and MRSA. These results suggested that the contamination and antibiotic resistance of S. aureus in RTEIB foods from the Sichuan province of China should cause more concern. The S. aureus isolates with the phenotypic resistance on the five predominant antibiotics; i.e., penicillin, erythromycin, clindamycin, tetracycline and inducible clindamycin resistance, were all determined positive for the resistance gene associated, and targeting the resistance gene can thus be used as an important reference for the evaluation of microbial resistance. Thirty-three (61.1%) S. aureus isolates were characterized as biofilm producers.

Author Contributions

Conceptualization, Q.L., H.S., Y.R. and Y.C.; data curation, Q.L.; methodology, Q.L. and H.S.; software, H.S.; supervision, J.C.; validation, K.Y. and Y.R.; visualization, J.C. and K.Y.; writing—original draft, Q.L. and H.S.; writing—review and editing, Y.C.

Funding

This research was financially supported by the National Natural Science Foundation of China (number 31601442) and the Key Research and Development Project of Sichuan Province (number 2019YFS0063).

Acknowledgments

We acknowledge Qixian Zhang and Jiaqi Zhang for the helpful discussion.

Conflicts of Interest

The authors state no conflict of interest.

References

  1. Yang, S.; Pei, X.; Yang, D.; Zhang, H.; Chen, Q.; Chui, H.; Qiao, X.; Huang, Y.; Liu, Q. Microbial contamination in bulk ready-to-eat meat products of China in 2016. Food Control. 2018, 91, 113–122. [Google Scholar] [CrossRef]
  2. Abdolshahi, A.; Naybandi-Atashi, S.; Heydari-Majd, M.; Salehi, B.; Kobarfard, F.; Ayatollahi, S.A.; Ata, A.; Tabanelli, G.; Sharifi-Rad, M.; Montanari, C.; et al. Antibacterial activity of some Lamiaceae species against Staphylococcus aureus in yoghurt-based drink (Doogh). Cell. Mol. Biol. 2018, 64, 71. [Google Scholar] [CrossRef]
  3. Argudin, M.A.; Mendoza, M.C.; Rodicio, M.R. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, W.; Liu, F.; Zulqarnain, B.; Zhang, C.S.; Ma, K.; Peng, Z.X.; Yan, S.F.; Hu, Y.J.; Gan, X.; Ping, Y.; et al. Genotypic Characterization of Methicillin-resistant Staphylococcus aureus Isolated from Pigs and Retail Foods in China. Biomed. Environ. Sci. 2017, 30, 570–580. [Google Scholar] [PubMed]
  5. Kotzekidou, P. Microbiological examination of ready-to-eat foods and ready-to-bake frozen pastries from university canteens. Food Microbiol. 2013, 34, 337–343. [Google Scholar] [CrossRef] [PubMed]
  6. Li, G.; Wu, S.; Luo, W.; Su, Y.; Luan, Y.; Wang, X. Staphylococcus aureus ST6-t701 isolates from food-poisoning outbreaks (2006–2013) in Xi’an, China. Foodborne Pathog. Dis. 2015, 12, 203–206. [Google Scholar] [CrossRef] [PubMed]
  7. Hyeon, J.-Y. A Foodborne Outbreak of Staphylococcus aureus Associated with Fried Chicken in Republic of Korea. J. Microbiol. Biotechnol. 2013, 23, 85–87. [Google Scholar] [CrossRef]
  8. Yan, X.; Wang, B.; Tao, X.; Hu, Q.; Cui, Z.; Zhang, J.; Lin, Y.; You, Y.; Shi, X.; Grundmann, H. Characterization of Staphylococcus aureus strains associated with food poisoning in Shenzhen, China. Appl. Environ. Microbiol. 2012, 78, 6637–6642. [Google Scholar] [CrossRef]
  9. Ng, L.-K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef]
  10. Jarajreh, D.; Aqel, A.; Alzoubi, H.; Al-Zereini, W. Prevalence of inducible clindamycin resistance in methicillin-resistant Staphylococcus aureus: The first study in Jordan. J. Infect. Dev. Ctries 2017, 11, 350–354. [Google Scholar] [CrossRef]
  11. Frieri, M.; Kumar, K.; Boutin, A. Antibiotic resistance. J. Infect. Public Health 2017, 10, 369–378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Jolivet-Gougeon, A.; Bonnaure-Mallet, M. Biofilms as a mechanism of bacterial resistance. Drug Discov. Today Technol. 2014, 11, 49–56. [Google Scholar] [CrossRef] [PubMed]
  13. Wu, J.A.; Kusuma, C.; Mond, J.J.; Kokai-Kun, J.F. Lysostaphin Disrupts Staphylococcus aureus and Staphylococcus epidermidis Biofilms on Artificial Surfaces. Antimicrob. Agents Chemother. 2003, 47, 3407–3414. [Google Scholar] [CrossRef] [PubMed]
  14. Kaplan, J.B. Antibiotic-induced biofilm formation. Int. J. Artif. Organs 2011, 34, 737–751. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, X.; Tao, X.; Xia, X.; Yang, B.; Xi, M.; Meng, J.; Zhang, J.; Xu, B. Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in retail raw chicken in China. Food Control. 2013, 29, 103–106. [Google Scholar] [CrossRef]
  16. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.; Carmeli, Y.; Falagas, M.E.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
  17. Nannini, E.C.; Stryjewski, M.E.; Singh, K.V.; Bourgogne, A.; Rude, T.H.; Corey, G.R.; Fowler, V.G.; Murray, B.E. Inoculum effect with cefazolin among clinical isolates of methicillin-susceptible Staphylococcus aureus: Frequency and possible cause of cefazolin treatment failure. Antimicrob. Agents Chemother. 2009, 53, 3437–3441. [Google Scholar] [CrossRef] [PubMed]
  18. Martineau, F.; Picard, F.J.; Lansac, N.; Roy, P.H.; Ouellette, M.; Bergeron, M.G.; Ménard, C. Correlation between the Resistance Genotype Determined by Multiplex PCR Assays and the Antibiotic Susceptibility Patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother. 2000, 44, 231–238. [Google Scholar] [CrossRef]
  19. Lina, G.; Quaglia, A.; Reverdy, M.-E.; Leclercq, R.; Vandenesch, F.; Etienne, J. Distribution of Genes Encoding Resistance to Macrolides, Lincosamides, and Streptogramins among Staphylococci. Antimicrob. Agents Chemother. 1999, 43, 1062–1066. [Google Scholar] [CrossRef] [Green Version]
  20. Patel, J.; Sharma, M. Differences in attachment of Salmonella enterica serovars to cabbage and lettuce leaves. Int. J. Food Microbiol. 2010, 139, 41–47. [Google Scholar] [CrossRef]
  21. Diez-Garcia, M.; Capita, R.; Alonso-Calleja, C. Influence of serotype on the growth kinetics and the ability to form biofilms of Salmonella isolates from poultry. Food Microbiol. 2012, 31, 173–180. [Google Scholar] [CrossRef] [PubMed]
  22. Harada, T.; Taguchi, M.; Kawahara, R.; Kanki, M.; Kawatsu, K. Prevalence and Antimicrobial Susceptibility of Bacterial Pathogens in Ready-to-Eat Foods Retailed in Osaka Prefecture, Japan. J. Food Prot. 2018, 81, 1450–1458. [Google Scholar] [CrossRef] [PubMed]
  23. Kim, N.; Yun, A.-R.; Rhee, M. Prevalence and classification of toxigenic Staphylococcus aureus isolated from refrigerated ready-to-eat foods (sushi, kimbab and California rolls) in Korea. J. Appl. Microbiol. 2011, 111, 1456–1464. [Google Scholar] [CrossRef] [PubMed]
  24. Cháfer-Pericás, C.; Maquieira, Á.; Puchades, R. Fast screening methods to detect antibiotic residues in food samples. TrAC Trends in Anal. Chem. 2010, 29, 1038–1049. [Google Scholar] [CrossRef]
  25. Cheatham, S.; Thapaliya, D.; Taha, M.; Milliken, K.; Dalman, M.R.; Kadariya, J.; Grenier, D.; Smith, T.C. Prevalence of Staphylococcus aureus and methicillin-resistant S. aureus on environmental surfaces in Ohio nursing homes. Am. J. Infect. Control. 2019. [Google Scholar] [CrossRef] [PubMed]
  26. Li, Q.; Li, Y.; Tang, Y.; Meng, C.; Ingmer, H.; Jiao, X. Prevalence and characterization of Staphylococcus aureus and Staphylococcus argenteus in chicken from retail markets in China. Food Control. 2019, 96, 158–164. [Google Scholar] [CrossRef]
  27. Xing, X.; Li, G.; Zhang, W.; Wang, X.; Xia, X.; Yang, B.; Meng, J. Prevalence, Antimicrobial Susceptibility, and Enterotoxin Gene Detection of Staphylococcus aureus Isolates in Ready-to-Eat Foods in Shaanxi, People’s Republic of China. J. Food Prot. 2014, 77, 331. [Google Scholar] [CrossRef]
  28. Zehra, A.; Gulzar, M.; Singh, R.; Kaur, S.; Gill, J. Prevalence, multidrug resistance and molecular typing of methicillin-resistant Staphylococcus aureus (MRSA) in retail meat from Punjab, India. J. Glob. Antimicrob. Resist. 2019, 16, 152–158. [Google Scholar] [CrossRef]
  29. Thumu, S.C.; Halami, P.M. Acquired resistance to macrolide-lincosamide-streptogramin antibiotics in lactic Acid bacteria of food origin. Indian J. Microbiol. 2012, 52, 530–537. [Google Scholar] [CrossRef]
  30. Zelazny, A.M.; Ferraro, M.J.; Glennen, A.; Hindler, J.F.; Mann, L.M.; Munro, S.; Murray, P.R.; Reller, L.B.; Tenover, F.C.; Jorgensen, J.H. Selection of strains for quality assessment of the disk induction method for detection of inducible clindamycin resistance in Staphylococci: A CLSI collaborative study. J. Clin. Microbiol. 2005, 43, 2613–2615. [Google Scholar] [CrossRef]
  31. Kroning, I.S.; Iglesias, M.A.; Sehn, C.P.; Gandra, T.K.V.; Mata, M.M.; Da Silva, W.P. Staphylococcus aureus isolated from handmade sweets: Biofilm formation, enterotoxigenicity and antimicrobial resistance. Food Microbiol. 2016, 58, 105–111. [Google Scholar] [CrossRef]
  32. Bimanand, L.; Taherikalani, M.; Jalilian, F.A.; Sadeghifard, N.; Ghafourian, S.; Mahdavi, Z.; Mohamadi, S.; Sayehmiri, K.; Hematian, A.; Pakzad, I. Association between biofilm production, adhesion genes and drugs resistance in different SCCmec types of methicillin resistant Staphylococcus aureus strains isolated from several major hospitals of Iran. Iran J. Basic Med. Sci. 2018, 21, 400–403. [Google Scholar]
  33. Aslantas, O.; Demir, C. Investigation of the antibiotic resistance and biofilm-forming ability of Staphylococcus aureus from subclinical bovine mastitis cases. J. Dairy Sci. 2016, 99, 8607–8613. [Google Scholar] [CrossRef]
Figure 1. Antibiotic resistance categories and the biofilm formation abilities of the 54 S. aureus isolates from RTEIB foods, including meat products, dairy, fruit and vegetables, and desserts. No biofilm formation ability when OD/cut-off OD (ODc) ≤ 1, weak when 1 < OD/ODc ≤ 2, moderate when 2 < OD/ODc ≤ 4, strong when 4 < OD/ODc.
Figure 1. Antibiotic resistance categories and the biofilm formation abilities of the 54 S. aureus isolates from RTEIB foods, including meat products, dairy, fruit and vegetables, and desserts. No biofilm formation ability when OD/cut-off OD (ODc) ≤ 1, weak when 1 < OD/ODc ≤ 2, moderate when 2 < OD/ODc ≤ 4, strong when 4 < OD/ODc.
Biomolecules 09 00524 g001
Table 1. Antimicrobial categories and agents used in this study.
Table 1. Antimicrobial categories and agents used in this study.
Antimicrobial CategoryAntimicrobial Agent
PenicillinsPenicillin
AminoglycosidesGentamicin
AnsamycinsRifampin
Anti-staphylococcal β-lactamsOxacillin
Cefoxitin
FluoroquinolonesCiprofloxacin
Levofloxacin
Moxifloxacin
Folate pathway inhibitorsTrimethoprim/sulphamethoxazole
GlycopeptidesVancomycin
Tigecycline
MacrolideErythromycin
LincosamideClindamycin
OxazolidinonesLinezolid
Streptogramins BQuinupristin/dalfopristin
TetracyclinesTetracycline
Macrolide-Lincosamide-Streptogramin BInducible Clindamycin Resistance
Table 2. Antibiotic resistant genes and primers used in this study.
Table 2. Antibiotic resistant genes and primers used in this study.
AntibioticsTarget GenePrimer Sequence (5’-3’)Size (bp)Reference
PenicillinblaZF: CAAAGATGATATAGTTGCTTATTC355[17]
R: CATATGTTATTGCTTGCACCAC
Cefoxitin
Oxacillin
mecAF: AACAGGTGAATTATTAGCACTTGTAAG173[18]
R: ATTGCTGTTAATATTTTTTGAGTTGAA
Inducible clindamycin resistance
Erythromycin
Clindamycin
ermAF: GTTCAAGAACAATCAATACAGAG421[19]
R: GGATCAGGAAAAGGACATTTTAC
ermCF: GCTAATATTG TTTAAATCGT CAATTCC572
R: GGATCAGGAAAAGGACATTTTAC
TetracyclinetetLF: TCGTTAGCGTGCTGTCATTC267[9]
R: GTATCCCACCAATGTAGCCG
tetMF: GTGGACAAAGGTACAACGAG406
R: CGGTAAAGT TCG TCACACAC
tetKF: TCGATAGGAACAGCAGTA169
R: CAGCAGATCCTACTCCTT
Table 3. The prevalence of Staphylococcus aureus—multidrug-resistant (MDR), extensively drug-resistant (XDR) and methicillin-resistant S. aureus (MRSA) types in 2160 RTEIB foods, including meat, dairy, fruit and vegetables, and desserts.
Table 3. The prevalence of Staphylococcus aureus—multidrug-resistant (MDR), extensively drug-resistant (XDR) and methicillin-resistant S. aureus (MRSA) types in 2160 RTEIB foods, including meat, dairy, fruit and vegetables, and desserts.
Types of RTEIBTotal No. of Samples Detection of S. aureus
No. (%) of SamplesNo. S. aureusNo. MDR aNo. XDR bNo. MRSA
Meat product120924 (2.0)311001
Dairy2004 (2.0)6600
Fruit and vegetable4017 (1.8)9300
Dessert3507 (2.0)8202
Total216042 (1.9)542103
a MDR is defined as acquired resistance to at least one agent in three or more antimicrobial categories. b XDR is defined as resistance to at least one agent in all but just susceptibility to two or fewer antimicrobial categories.
Table 4. Antimicrobial resistance profiles of S. aureus isolates from Ready-to-eat food in bulk (RTEIB foods), including meat, dairy, fruits and vegetables, and desserts.
Table 4. Antimicrobial resistance profiles of S. aureus isolates from Ready-to-eat food in bulk (RTEIB foods), including meat, dairy, fruits and vegetables, and desserts.
Source *Antimicrobial Resistance Profiles **
PECMTEICRCIPGMSXTLEVMXFFOXOXRD
Meat product2714118742233111
Dairy666 3232
Fruit and vegetable8331 11211
Dessert8223 1 22
Total (54 isolates)492522121077644331
* All 54 isolates were susceptible to vancomycin, tigecycline, linezolid and quinupristin/dalfopristin, and the data is not shown. ** P, penicillin; E, erythromycin; CM, clindamycin; TE, tetracycline; ICR, inducible clindamycin resistance; CIP, ciprofloxacin; GM, gentamicin; SXT, trimethoprim/sulfamethoxazole; LEV, levofloxacin; MXF, moxifloxacin; FOX, cefoxitin; OX, oxacillin; RD, rifampin.
Table 5. Phenotypic resistance (P) and the associated genes (G), as well as the biofilm formation abilities of 54 S. aureus isolates from RTEIB foods, including meat, dairy, fruit and vegetables, and desserts.
Table 5. Phenotypic resistance (P) and the associated genes (G), as well as the biofilm formation abilities of 54 S. aureus isolates from RTEIB foods, including meat, dairy, fruit and vegetables, and desserts.
PenicillinErythromycinClindamycinTetracyclineInducible Clindamycin ResistanceBiofilm Formation Ability **
PG (blaZ)PG (erm) *PG (erm) *PG (tet) *PG (erm) *
Meat product
MT01R ***+R+R+R+ +None
MT02R+R+R+ +R+Strong
MT03R+R+R+ +R+Strong
MT04R+R+R+ + +Weak
MT05R+R+R+R+R+Weak
MT06R+R+R+ +R+None
MT07R+R+R+ +R+Weak
MT08R+R+R+ +R+Weak
MT09R+R+R+ + +None
MT10 +R+R+ +R+Weak
MT11R+R+ +R+ +Weak
MT12R+ + + +None
MT13 +R+R+ + +None
MT14R+ + +R+ +Moderate
MT15R+ + +R+ +Weak
MT16R+ + +R+ +Weak
MT17R+ R+ Weak
MT18R+R+ +R+ +Weak
MT19R+R+ + + +Weak
MT20 + + +R+ +Weak
MT21R+ + + + +Weak
MT22R+ + + + +None
MT23R+ + + + +Weak
MT24R+ + + + +None
MT25R+ + + + +Weak
MT26R+ + + + +None
MT27R+ + None
MT28R+ + Weak
MT29R+ + Weak
MT30R+ None
MT31R+ + + + +None
Dairy
DY01R+R+R+ + +Weak
DY02R+R+R+ + +Weak
DY03R+R+R+ + +Weak
DY04R+R+R+ +R+Weak
DY05R+R+R+ +R+Weak
DY06R+R+R+ +R+Weak
Fruit and vegetable
FV01R+R+R+ + +None
FV02R+R+R+ + +None
FV03R+R+R+ + +None
FV04R+ + + + +None
FV05R+ + +R+ +Weak
FV06R+ + + + +Weak
FV07R+ + + + +None
FV08R+ None
FV09 + + + + +Weak
Dessert
CY01R+R+R+R+ +Weak
CY02R+R+R+R+ +None
CY03R+ + +R+ +None
CY04R+ + + + +Weak
CY05R+ + Weak
CY06R+ + + + +Weak
CY07R+ + + + +None
CY08R+ + + + +None
* Genes erm include ermA and/or ermC; genes tet include tetL, tetM and/or tetK. ** No biofilm formation ability means OD/ODc ≤ 1, weak—1 < OD/ODc ≤ 2, moderate 2 < OD/ODc ≤ 4, strong (4 < OD/ODc). *** R represents resistance, and + represents detected.

Share and Cite

MDPI and ACS Style

Lin, Q.; Sun, H.; Yao, K.; Cai, J.; Ren, Y.; Chi, Y. The Prevalence, Antibiotic Resistance and Biofilm Formation of Staphylococcus aureus in Bulk Ready-To-Eat Foods. Biomolecules 2019, 9, 524. https://doi.org/10.3390/biom9100524

AMA Style

Lin Q, Sun H, Yao K, Cai J, Ren Y, Chi Y. The Prevalence, Antibiotic Resistance and Biofilm Formation of Staphylococcus aureus in Bulk Ready-To-Eat Foods. Biomolecules. 2019; 9(10):524. https://doi.org/10.3390/biom9100524

Chicago/Turabian Style

Lin, Qi, Honghu Sun, Kai Yao, Jiong Cai, Yao Ren, and Yuanlong Chi. 2019. "The Prevalence, Antibiotic Resistance and Biofilm Formation of Staphylococcus aureus in Bulk Ready-To-Eat Foods" Biomolecules 9, no. 10: 524. https://doi.org/10.3390/biom9100524

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop