Sigma-1 Receptor Modulates CFA-Induced Inflammatory Pain via Sodium Channels in Small DRG Neurons
Abstract
:1. Introduction
2. Method
2.1. The Complete Freund’s Adjuvant (CFA) Treated Animal Model
2.2. Behavior Test
2.3. Investigation of the Electrophysiological Properties of Dissociated DRG Neurons
2.4. Immunohistochemistry
2.5. Single-Cell PCR
2.6. Chemicals
2.7. Analysis
3. Results
3.1. CFA Treatment Increased the Expression of Sig-1R and Led to Its Recruitment from Intracellular Compartments Toward the Membrane
3.2. Blocking Sig-1R Partially Rescued CFA-Induced Allodynia
3.3. Effects of Sig1-R Agonist on the Electrophysiological Properties of DRG Neurons
3.4. Effects of Sig1-R Agonist on Fast and Slow Sodium Current
3.5. Effects of Sig-1R Agonist on the mRNA Levels of Nav1.6-1.9
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kourrich, S.; Su, T.P.; Fujimoto, M.; Bonci, A. The sigma-1 receptor: Roles in neuronal plasticity and disease. Trends Neurosci. 2012, 35, 762–771. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, H.R.; Kruse, A.C. The Molecular Function of σ Receptors: Past, Present, and Future. Trends Pharmacol. Sci. 2019, 40, 636–654. [Google Scholar] [CrossRef] [PubMed]
- Brindley, R.L.; Bauer, M.B.; Hartley, N.D.; Horning, K.J.; Currie, K. Sigma-1 receptor ligands inhibit catecholamine secretion from adrenal chromaffin cells due to block of nicotinic acetylcholine receptors. J. Neurochem. 2017, 143, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Zhao, Z.; Lan, L.; Wei, X.; Wang, L.; Liu, X.; Yan, H.; Zheng, J. Sigma-1 Receptor Plays a Negative Modulation on N-type Calcium Channel. Front. Pharmacol. 2017, 8, 302. [Google Scholar] [CrossRef]
- Bangaru, M.L.; Weihrauch, D.; Tang, Q.B.; Zoga, V.; Hogan, Q.; Wu, H.E. Sigma-1 receptor expression in sensory neurons and the effect of painful peripheral nerve injury. Mol. Pain 2013, 9, 47. [Google Scholar] [CrossRef]
- Mavlyutov, T.A.; Duellman, T.; Kim, H.T.; Epstein, M.L.; Leese, C.; Davletov, B.A.; Yang, J. Sigma-1 receptor expression in the dorsal root ganglion: Reexamination using a highly specific antibody. Neuroscience 2016, 331, 148–157. [Google Scholar] [CrossRef]
- Puente, B.; Nadal, X.; Portillo-Salido, E.; Sánchez-Arroyos, R.; Ovalle, S.; Palacios, G.; Muro, A.; Romero, L.; Entrena, J.M.; Baeyens, J.M.; et al. Sigma-1 receptors regulate activity-induced spinal sensitization and neuropathic pain after peripheral nerve injury. Pain 2009, 145, 294–303. [Google Scholar] [CrossRef]
- Gris, G.; Portillo-Salido, E.; Aubel, B.; Darbaky, Y.; Deseure, K.; Vela, J.M.; Merlos, M.; Zamanillo, D. The selective sigma-1 receptor antagonist E-52862 attenuates neuropathic pain of different aetiology in rats. Sci. Rep. 2016, 6, 24591. [Google Scholar] [CrossRef]
- Nieto, F.R.; Cendán, C.M.; Sánchez-Fernández, C.; Cobos, E.J.; Entrena, J.M.; Tejada, M.A.; Zamanillo, D.; Vela, J.M.; Baeyens, J.M. Role of sigma-1 receptors in paclitaxel-induced neuropathic pain in mice. J. Pain 2012, 13, 1107–1121. [Google Scholar] [CrossRef]
- Romero, L.; Zamanillo, D.; Nadal, X.; Sánchez-Arroyos, R.; Rivera-Arconada, I.; Dordal, A.; Montero, A.; Muro, A.; Bura, A.; Segalés, C.; et al. Pharmacological properties of S1RA, a new sigma-1 receptor antagonist that inhibits neuropathic pain and activity-induced spinal sensitization. Br. J. Pharmacol. 2012, 166, 2289–2306. [Google Scholar] [CrossRef]
- Yoon, S.Y.; Roh, D.H.; Seo, H.S.; Kang, S.Y.; Han, H.J.; Beitz, A.J.; Lee, J.H. Intrathecal injection of the neurosteroid, DHEAS, produces mechanical allodynia in mice: Involvement of spinal sigma-1 and GABA receptors. Br. J. Pharmacol. 2009, 157, 666–673. [Google Scholar] [CrossRef] [PubMed]
- Tejada, M.Á.; Montilla-García, Á.; González-Cano, R.; Bravo-Caparrós, I.; Ruiz-Cantero, M.C.; Nieto, F.R.; Cobos, E.J. Targeting immune-driven opioid analgesia by sigma-1 receptors: Opening the door to novel perspectives for the analgesic use of sigma-1 antagonists. Pharmacol. Res. 2018, 131, 224–230. [Google Scholar] [CrossRef] [PubMed]
- Bruna, J.; Videla, S.; Argyriou, A.A.; Velasco, R.; Villoria, J.; Santos, C.; Nadal, C.; Cavaletti, G.; Alberti, P.; Briani, C.; et al. Efficacy of a Novel Sigma-1 Receptor Antagonist for Oxaliplatin-Induced Neuropathy: A Randomized, Double-Blind, Placebo-Controlled Phase IIa Clinical Trial. Neurotherapeutics 2018, 15, 178–189. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Cantero, M.C.; Cortés-Montero, E.; Jain, A.; Montilla-García, Á.; Bravo-Caparrós, I.; Shim, J.; Sánchez-Blázquez, P.; Woolf, C.J.; Baeyens, J.M.; Cobos, E.J. The sigma-1 receptor curtails endogenous opioid analgesia during sensitization of TRPV1 nociceptors. Br. J. Pharmacol. 2023, 180, 1148–1167. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Cantero, M.C.; González-Cano, R.; Tejada, M.Á.; Santos-Caballero, M.; Perazzoli, G.; Nieto, F.R.; Cobos, E.J. Sigma-1 receptor: A drug target for the modulation of neuroimmune and neuroglial interactions during chronic pain. Pharmacol. Res. 2021, 163, 105339. [Google Scholar] [CrossRef]
- Xiong, J.; Zhuang, T.; Ma, Y.; Xu, J.; Ye, J.; Ma, R.; Zhang, S.; Liu, X.; Liu, B.F.; Hao, C.; et al. Optimization of bifunctional piperidinamide derivatives as σ(1)R Antagonists/MOR agonists for treating neuropathic pain. Eur. J. Med. Chem. 2021, 226, 113879. [Google Scholar] [CrossRef]
- Ortíz-Rentería, M.; Juárez-Contreras, R.; González-Ramírez, R.; Islas, L.D.; Sierra-Ramírez, F.; Llorente, I.; Simon, S.A.; Hiriart, M.; Rosenbaum, T.; Morales-Lázaro, S.L. TRPV1 channels and the progesterone receptor Sig-1R interact to regulate pain. Proc. Natl. Acad. Sci. USA 2018, 115, E1657–E1666. [Google Scholar] [CrossRef]
- Marcotti, A.; Fernández-Trillo, J.; González, A.; Vizcaíno-Escoto, M.; Ros-Arlanzón, P.; Romero, L.; Vela, J.M.; Gomis, A.; Viana, F.; De La Peña, E. TRPA1 modulation by Sigma-1 receptor prevents oxaliplatin-induced painful peripheral neuropathy. Brain 2023, 146, 475–491. [Google Scholar] [CrossRef]
- Tejada, M.A.; Montilla-García, A.; Sánchez-Fernández, C.; Entrena, J.M.; Perazzoli, G.; Baeyens, J.M.; Cobos, E.J. Sigma-1 receptor inhibition reverses acute inflammatory hyperalgesia in mice: Role of peripheral sigma-1 receptors. Psychopharmacology 2014, 231, 3855–3869. [Google Scholar] [CrossRef]
- Tejada, M.A.; Montilla-García, A.; Cronin, S.J.; Cikes, D.; Sánchez-Fernández, C.; González-Cano, R.; Ruiz-Cantero, M.C.; Penninger, J.M.; Vela, J.M.; Baeyens, J.M.; et al. Sigma-1 receptors control immune-driven peripheral opioid analgesia during inflammation in mice. Proc. Natl. Acad. Sci. USA 2017, 114, 8396–8401. [Google Scholar] [CrossRef]
- Djouhri, L.; Newton, R.; Levinson, S.R.; Berry, C.M.; Carruthers, B.; Lawson, S.N. Sensory and electrophysiological properties of guinea-pig sensory neurones expressing Nav 1.7 (PN1) Na+ channel alpha subunit protein. J. Physiol. 2003, 546 Pt 2, 565–576. [Google Scholar] [CrossRef]
- Djouhri, L.; Fang, X.; Okuse, K.; Wood, J.N.; Berry, C.M.; Lawson, S.N. The TTX-resistant sodium channel Nav1.8 (SNS/PN3): Expression and correlation with membrane properties in rat nociceptive primary afferent neurons. J. Physiol. 2003, 550 Pt 3, 739–752. [Google Scholar] [CrossRef]
- Fang, X.; Djouhri, L.; Black, J.A.; Dib-Hajj, S.D.; Waxman, S.G.; Lawson, S.N. The presence and role of the tetrodotoxin-resistant sodium channel Na(v)1.9 (NaN) in nociceptive primary afferent neurons. J. Neurosci. 2002, 22, 7425–7433. [Google Scholar] [CrossRef] [PubMed]
- Djouhri, L.; Bleazard, L.; Lawson, S.N. Association of somatic action potential shape with sensory receptive properties in guinea-pig dorsal root ganglion neurones. J. Physiol. 1998, 513 Pt 3, 857–872. [Google Scholar] [CrossRef]
- Dib-Hajj, S.; Black, J.A.; Cummins, T.R.; Waxman, S.G. NaN/Nav1.9: A sodium channel with unique properties. Trends Neurosci. 2002, 25, 253–259. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Effraim, P.R.; Carrara, J.; Zhao, P.; Dib-Hajj, F.B.; Dib-Hajj, S.D.; Waxman, S.G. Pharmacological characterization of a rat Nav1.7 loss-of-function model with insensitivity to pain. Pain 2020, 161, 1350–1360. [Google Scholar] [CrossRef] [PubMed]
- Dib-Hajj, S.D.; Black, J.A.; Waxman, S.G. NaV1.9: A sodium channel linked to human pain. Nat. Rev. Neurosci. 2015, 16, 511–519. [Google Scholar] [CrossRef]
- Nascimento, D.L.A.; Zhang, H.; Chen, L.; Effraim, P.R.; Gomis-Perez, C.; Cheng, X.; Huang, J.; Waxman, S.G.; Dib-Hajj, S.D. Nav1.8 in small dorsal root ganglion neurons contributes to vincristine-induced mechanical allodynia. Brain 2024, 147, 3157–3170. [Google Scholar] [CrossRef]
- Urru, M.; Muzzi, M.; Coppi, E.; Ranieri, G.; Buonvicino, D.; Camaioni, E.; Coppini, R.; Pugliese, A.M.; Tanaka, B.; Estacion, M.; et al. Dexpramipexole blocks Nav1.8 sodium channels and provides analgesia in multiple nociceptive and neuropathic pain models. Pain 2020, 161, 831–841. [Google Scholar] [CrossRef]
- Djouhri, L.; Lawson, S.N. Changes in somatic action potential shape in guinea-pig nociceptive primary afferent neurones during inflammation in vivo. J. Physiol. 1999, 520 Pt 2, 565–576. [Google Scholar] [CrossRef]
- Antkowiak, B. Different Actions of General Anesthetics on the Firing Patterns of Neocortical Neurons Mediated by the GABAA Receptor. Anesthesiology 1999, 91, 500–511. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Zhang, M.; Tao, X.; Xu, Z.; Zheng, Y.; Zhu, M.; Zhang, L.; Qiao, J.; Gao, L. Difference of acute dissociation and 1-day culture on the electrophysiological properties of rat dorsal root ganglion neurons. J. Physiol. Biochem. 2018, 74, 207–221. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Saint, D.A. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal. Biochem. 2002, 302, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Bravo-Caparros, I.; Perazzoli, G.; Yeste, S.; Cikes, D.; Baeyens, J.M.; Cobos, E.J.; Nieto, F.R. Sigma-1 Receptor Inhibition Reduces Neuropathic Pain Induced by Partial Sciatic Nerve Transection in Mice by Opioid-Dependent and -Independent Mechanisms. Front. Pharmacol. 2019, 10, 613. [Google Scholar] [CrossRef]
- Bravo-Caparrós, I.; Ruiz Cantero, M.D.C.; Perazzoli, G.; Cronin, S.F.J.; Vela, J.M.; Hamed, M.F.; Penninger, J.M.; Baeyens Cabrera, J.M.; Cobos del Moral, E.J.; Nieto López, F.R. Sigma-1 receptors control neuropathic pain and macrophage infiltration into the dorsal root ganglion after peripheral nerve injury. FASEB J. 2020, 34, 5951–5966. [Google Scholar] [CrossRef]
- Shin, S.M.; Wang, F.; Qiu, C.; Itson-Zoske, B.; Hogan, Q.H.; Yu, H. Sigma-1 receptor activity in primary sensory neurons is a critical driver of neuropathic pain. Gene Ther. 2022, 29, 1–15. [Google Scholar] [CrossRef]
- Lachance, V.; Belanger, S.; Hay, C.; Le Corvec, V.; Banouvong, V.; Lapalme, M.; Tarmoun, K.; Beaucaire, G.; Lussier, M.P.; Kourrich, S. Overview of Sigma-1R Subcellular Specific Biological Functions and Role in Neuroprotection. Int. J. Mol. Sci. 2023, 24, 1971. [Google Scholar] [CrossRef]
- Miki, Y.; Mori, F.; Kon, T.; Tanji, K.; Toyoshima, Y.; Yoshida, M.; Sasaki, H.; Kakita, A.; Takahashi, H.; Wakabayashi, K. Accumulation of the sigma-1 receptor is common to neuronal nuclear inclusions in various neurodegenerative diseases. Neuropathology 2014, 34, 148–158. [Google Scholar] [CrossRef]
- Baker, M.D.; Wood, J.N. Involvement of Na+ channels in pain pathways. Trends Pharmacol. Sci. 2001, 22, 27–31. [Google Scholar] [CrossRef]
- Balasuriya, D.; Stewart, A.P.; Crottes, D.; Borgese, F.; Soriani, O.; Edwardson, J.M. The sigma-1 receptor binds to the Nav1.5 voltage-gated Na+ channel with 4-fold symmetry. J. Biol. Chem. 2012, 287, 37021–37029. [Google Scholar] [CrossRef]
- Docherty, R.J.; Farmer, C.E. The pharmacology of voltage-gated sodium channels in sensory neurones. In Handbook of Experimental Pharmacology; Springer: Berlin/Heidelberg, Germany, 2009; pp. 519–561. [Google Scholar]
- Ekberg, J.; Adams, D.J. Neuronal voltage-gated sodium channel subtypes: Key roles in inflammatory and neuropathic pain. Int. J. Biochem. Cell Biol. 2006, 38, 2005–2010. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Yao, J.; He, Y.; Hu, C.; Mei, Y. Sigma-1 receptor agonists directly inhibit Nav1.2/1.4 channels. PLoS ONE 2012, 7, e49384. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, H.R.; Betz, R.M.; Dror, R.O.; Kruse, A.C. Structural basis for sigma(1) receptor ligand recognition. Nat. Struct. Mol. Biol. 2018, 25, 981–987. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Djouhri, L.; McMullan, S.; Berry, C.; Okuse, K.; Waxman, S.G.; Lawson, S.N. trkA is expressed in nociceptive neurons and influences electrophysiological properties via Nav1.8 expression in rapidly conducting nociceptors. J. Neurosci. 2005, 25, 4868–4878. [Google Scholar] [CrossRef]
Primers | Forward (5’-3’) | Reverse (5’-3’) |
---|---|---|
Nav1.6 | GAAGAGCTGGAAGAGTCTCAGAGAAA | AAACTTATACCAGCACGGTGGG |
Nav1.7 | GAGCCCGTAAACGCAGATGA | CACACAACCATCTGTAAAGCAGG |
Nav1.8 | GGCTGGATGGACATAATGTATGC | ACTGTTGATCTCTCCGGAATCAA |
Nav1.9 | GACGATGCCTCTAAAAATCCACA | GGACAGTCGTTTGGTCTGCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, Y.; Xu, Z.; Zhang, L.; Gao, L. Sigma-1 Receptor Modulates CFA-Induced Inflammatory Pain via Sodium Channels in Small DRG Neurons. Biomolecules 2025, 15, 73. https://doi.org/10.3390/biom15010073
Song Y, Xu Z, Zhang L, Gao L. Sigma-1 Receptor Modulates CFA-Induced Inflammatory Pain via Sodium Channels in Small DRG Neurons. Biomolecules. 2025; 15(1):73. https://doi.org/10.3390/biom15010073
Chicago/Turabian StyleSong, Yuanlong, Zifen Xu, Liangpin Zhang, and Linlin Gao. 2025. "Sigma-1 Receptor Modulates CFA-Induced Inflammatory Pain via Sodium Channels in Small DRG Neurons" Biomolecules 15, no. 1: 73. https://doi.org/10.3390/biom15010073
APA StyleSong, Y., Xu, Z., Zhang, L., & Gao, L. (2025). Sigma-1 Receptor Modulates CFA-Induced Inflammatory Pain via Sodium Channels in Small DRG Neurons. Biomolecules, 15(1), 73. https://doi.org/10.3390/biom15010073