The Effects of Housing on Growth, Immune Function and Antioxidant Status of Young Female Lambs in Cold Conditions
by
, and
Jin Xiao
1,
Wenliang Guo
1,
Zhipeng Han
1,
Yuanqing Xu
1,
Yuanyuan Xing
1,
Clive J. C. Phillips
2,3 and
Binlin Shi
1,* 1
College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Curtin University Sustainability Policy (CUSP) Institute, Curtin University, Perth, WA 6845, Australia
3
Institute of Veterinary Medicine and Animal Science, Estonia University of Life Sciences, Kreutzwaldi 1, 51014 Tartu, Estonia
*
Author to whom correspondence should be addressed.
Animals 2024, 14(3), 518; https://doi.org/10.3390/ani14030518
Submission received: 28 December 2023
/
Revised: 31 January 2024
/
Accepted: 2 February 2024
/
Published: 5 February 2024
(This article belongs to the Section Small Ruminants)
Abstract
:Simple Summary
In the winter in northern China, the type of housing or outdoor management may affect the growth and health of sheep, especially if they are young. We compared growth performance, immune function and antioxidant status of female lambs housed there in an enclosed building, a polytunnel or kept outdoors for 28 days. Compared to lambs kept outdoors at −14 °C, those in the enclosed house and polytunnel had improved growth rates, immune function and antioxidant status. We conclude that the polytunnel is best for the sheep’s welfare, followed by the enclosed house, with the outdoor treatment being the worst.
Abstract
Cold conditions in northern China during winter may reduce sheep growth and affect their health, especially if they are young, unless housing is provided. We allocated 45 two-month-old female lambs to be housed in an enclosed building, a polytunnel, or kept outdoors, for 28 days. The daily weight gain and scalp and ear skin temperature of outdoor lambs were less than those of lambs that were housed in either a house or polytunnel; however, rectal temperature was unaffected by treatment. There was a progressive change in blood composition over time, and by the end of the experiment, outdoor lambs had reduced total antioxidant capacity (T-AOC), catalase (CAT), glutathione peroxidase (GSH-Px) and total superoxide dismutase (T-SOD) and increased malondialdehyde compared to those in the house or polytunnel. In relation to immune responses in the lambs’ serum, in the polytunnel, immunoglobulin A (IgA), tumor necrosis factor-α (TNF-α) and interleukin-4 (IL-4) were higher and immunoglobulin G (IgG) lower compared with the concentrations in lambs that were outdoors. Over the course of the experiment, genes expressing heat shock proteins and antioxidant enzymes increased in lambs in the outdoor treatment, whereas they decreased in lambs in the indoor treatments. It is concluded that although there were no treatment effects on core body temperature, the trends for progressive changes in blood composition and gene expression indicate that the outdoor lambs were not physiologically stable; hence, they should not be kept outdoors in these environmental conditions for long periods.
1. Introduction
Inner Mongolia is the main area producing sheep meat in China, and it has severe cold, heavy snow and strong winds for nearly half the year. Cold stress induced by low temperatures in winter is a very common challenge for sheep in feedlots. It reduces growth and feed efficiency and increases energy consumption, sometimes leading to death if the metabolic heat production is insufficient to maintain body temperature [1,2,3,4,5]. Acute cold exposure improves a sheep’s adaptive capacity, but long-term chronic cold exposure disturbs metabolism and thermal homeostasis, increases the production of reactive oxygen species (ROS), causes oxidation imbalance [6,7], reduces immune cytokine levels and immunoglobulin secretion and suppresses immune function [8,9,10,11]. Heat shock protein (HSP) is a molecular chaperone protein that plays an important role in defending the animal from inflammation and oxidative imbalance by maintaining cytoarchitecture and signal transduction [12,13].
In winter, providing sheds for sheep to withstand the harsh environment, especially when low temperatures are coupled with heavy snowfall and cold winds, can alleviate cold stress and improve animal welfare [14]. Keeping ewes in warm sheds during winter and spring can improve the lambing rate and the lambs’ growth rates [15]. Compared to winter grazing, providing conserved feed indoors enhances their welfare, as evidenced by faster growth and better physiological and biochemical characteristics in the blood [16]. Oat hay is a suitable supplement to grazing in such conditions, as it can reverse a negative nitrogen balance and improve a sheep’s energy status [17]. Cold exposure not only reduces a sheep’s growth, but it also increases immune globulin levels to increase their ability to resist acute cold stress [18]. However, the consumption of large amounts of nutrients to counteract the cold may result in oxidative damage. In one study, antioxidant enzymes levels in sheep were increased in the cold, but the concentration of MDA, which reflects cell damage, was decreased [19]. However, there was no other evidence that the sheep experienced oxidative damage [19].
In Inner Mongolia, farmers with feedlots for fattening lambs mostly use enclosed houses. However, polytunnels with a transparent roof to allow maximum solar radiation to enter and walls to protect from wind and snow may provide a lower cost alternative that copes better with the extreme conditions, as it allows radiant heat from the sun to penetrate to the sheep. In the Inner Mongolian sheep production systems, lambs are usually weaned at two months of age, after which they may be particularly prone to cold stress. Therefore, we selected weaned two-month-old female lambs as the research subjects for a comparison of growth performance, immune function and antioxidant status in winter in enclosed houses, a polytunnel and outdoors.
2. Materials and Methods
2.1. Animals and Experiment Design
The experiment was conducted at the experimental farm of the Inner Mongolia Agricultural University, Hohhot, China. Sheep were cared for in accordance with the guidelines for animal experiments of the Inner Mongolia Agricultural University. The experimental protocol (No: NND20212037) was approved by the Institutional Ethics Committee of the Inner Mongolia Agricultural University. A total of 45 two-month-old Dorper × Mongolian crossbred female lambs (body weight 16.42 ± 2.52 kg) were randomly allocated to three treatments with five replications each and three lambs in each replicate. The three treatments were enclosed housing (House), outdoor pens (Outdoor) and a polytunnel (Polytunnel). The adjacent enclosed houses each had four breeze block walls, a door and a window on the front wall and an opaque roof. The polytunnel lambs were in individual pens in a metal-framed construction with translucent plastic sides and roof. Outdoor lambs were kept in pens in a relatively exposed open area with each pen delineated by a metal mesh fence.
All experimental lambs received the same total mixed ration offered twice daily (at 08:00 and 15:00 h) with residual feed weighed and recorded daily. The experimental diet of the lambs was formulated according to the nutritional requirements and physiological state of the sheep, as prescribed in American standards [20] (NRC 2007). The physical composition and nutrient levels are shown in Table 1. The lambs were given free access to water throughout the experiment. Lambs were weighed on d 1 and 28 of the experiment and recorded as initial body weight (IBW) and final body weight (FBW), respectively. Average daily gain (ADG) and average daily feed intake (ADFI) were determined from these measurements.
2.2. Measurement of Ambient Indexes
The environmental indicators, namely air temperature, relative humidity and wind speed, in the house, outdoor pens and polytunnel were measured at 06:00, 14:00 and 19:00 h daily by a digital thermometer (Digital Thermometer ar847+, Smart Sensor, Dongguan City, China) and a small vane anemometer (testo 416-Small vane anemometer, Testo SE & Co. KGaA, West Chester, PA, USA).
2.3. Blood Collection and Analysis
Two blood samples were collected into 10 mL non-heparinised tubes and 10 mL heparinized tubes from the jugular vein of each lamb at 08:00 h on day 7, 14, 21 and 28. The blood samples in the 10 mL tubes were centrifuged for 20 min at 3000× g to collect the serum and frozen at −20 °C to analyze the concentrations of INS, HSP70, HSP90, IL-1, IL-4, TNF-α, IgA, IgG, CAT, GSH-Px, T-SOD, T-AOC and MDA. The blood samples in the 10 mL heparinized tubes were centrifuged for 20 min at 3000× g to collect the leukocytes and frozen at −80 °C to determine the gene expression of HSF-1, HSP70, HSP90, Nrf2, CAT, GPX-Px, SOD1, SOD2, NF-κBp50, NF-κBp65, IL-1β, IL-4 and TNF-α. The levels of INS, HSP70, HSP90, IL-1, IL-4, TNF-α, IgA, IgG and IgM in serum were determined by lamb-specific ELISA kits (Ruixin Biological Technology Co., Ltd., Quanzhou, China) according to the manufacturer’s instructions. The concentrations of CAT, GSH-Px, T-SOD, T-AOC and MDA were determined with commercial kits (Nanjing Jiancheng Institute of Bioengineering, Nanjing, China).
2.4. Total RNA Extraction and Quantitative RT-PCR Analysis
Total RNA in the leukocytes was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and then the isolated RNA was quantitatively and qualitatively determined as described previously [21]. RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit after removing genomic DNA contamination (Takara Bio Inc., Otsu, Japan), according to the manufacturer’s instructions. Quantification of the cDNA transcript was performed using a qPCR TB Green Kit with the gene-specific primer on the LightCycler 96 real-time PCR system. qRT-PCR was performed using 20 μL reactions and performed with cycling conditions as described previously [21]. The optimum annealing temperatures for the different genes are given in Table 2, and they were designed and synthesized by Shanghai Sangon Biotech (Shanghai, China). β-actin was used as a reference gene and the relative transcript quantities in the mRNA expression level were calculated using the 2−ΔΔCT method.
2.5. Statistical Analysis
Data were analyzed by one-way ANOVA using the GLM procedure in SAS (Version 9.2; SAS Institute, Inc., Cary, NC, USA). The multiple comparisons between treatments were conducted by Duncan’s multiple range test (DMRT) and considered significant at p < 0.05. Data are presented as mean ± SD.
3. Results
3.1. Shelter Conditions
The environmental indicators, temperature, relative humidity, wind speed and NH3 and CO2 contents are shown for the three treatments in Table 3. The temperatures in the House and Polytunnel treatments were similar, and both were significantly higher than those in the Outdoor treatment. The relative humidities (RH) of the three treatments were significantly different, in the order RHHouse > RHPolytunnel > RHOutdoor. The wind speed in the outdoor treatment was significantly higher than those in the House or Polytunnel treatments. The level of CO2 in the Outdoor treatment was significantly lower than those in the House or Polytunnel treatments. NH3 concentrations of the three treatments were significantly different, in the order NH3(House) > NH3(Polytunnel) > NH3(Outdoor).
3.2. Growth Performance and Body Temperature
The IBW, FBW and ADFI of the lambs were not statistically different between the treatments. However, the ADG of lambs in the House and Polytunnel treatments were similar and significantly greater than that of lambs in the Outdoor treatment (Table 4).
3.3. Body Temperature
Scalp and ear skin temperatures of lambs in the House and Polytunnel treatments were significantly greater than that of lambs in the Outdoor treatment. The rectal temperature of the lambs was not statistically different between the three treatments (Table 5).
3.4. Serum Insulin and Heat Shock Proteins
As shown in Table 6, the levels of insulin, HSP90 and HSP70 in the serum of the lambs in the House, Outdoor and Polytunnel treatments were unaffected by treatment on d 7 and d 14. On d 21, the serum HSP90 level of lambs in the polytunnel was significantly higher than that of lambs in the Outdoor treatment (p < 0.05), but neither were different from that of the lambs in the house. On day 28, compared to lambs in Outdoor treatments, the insulin level was significantly lower and HSP90 was significantly higher in the lambs in the polytunnel or house.
3.5. Serum Antioxidant Status Indicators
As shown in Table 7, serum CAT, GSH-Px, T-SOD, T-AOC and MDA levels of the lambs were not significantly different between the three groups on day 7. On d 14, serum T-SOD activity of the lambs in the Outdoor treatment was significantly lower than those in the other two groups (p < 0.05), and serum MDA content of the lambs was significantly higher than that in the polytunnel (p < 0.05), but not different from that in the house. On d 21 and 28, outdoor lambs had significantly lower levels of serum CAT, GSH-Px and T-SOD and significantly higher levels of MDA than those of lambs in the other two treatments. On d 28, outdoor lambs also had significantly lower levels of serum T-AOC than those in the other two treatments.
3.6. Immunity indicators
Serum interleukins and immunoglobulins of the lambs in the House, Outdoor and Polytunnel treatments are shown in Table 8. On d 7 and 14, serum IgA, IgG, IgM, IL-1β, IL-4 and TNF-α levels of the lambs were not significantly different between the three treatments (p > 0.10). On d 21 and 28, serum IgG level was higher for lambs in the Polytunnel than those in the Outdoor and House treatments, and also on d 21, the level of TNF-α was lower for lambs in the Outdoor treatment than lambs in the Polytunnel or House treatments. On d 28, IgA and IgG levels were higher for lambs in the Polytunnel, compared with lambs in the House and Outdoor treatments, which were similar. Also, on d 28, IL-4 level was higher in lambs in the Polytunnel treatment, lowest in lambs in the Outdoor treatment and intermediate in lambs in the House treatment, and TNF-α level was higher for lambs in the House and Polytunnel treatments compared with lambs in the Outdoor treatment.
3.7. The Relative Expression of mRNA
As shown in Figure 1, Figure 2 and Figure 3, over the course of the experiment, lambs in the Outdoor treatment gradually increased the gene expression of HSF-1 and Nrf2 compared with the other two groups (p < 0.05). From d 14, lambs in the Outdoor treatment also increased the gene expression of HSP90, HSP70, Nrf2 and SOD1 (p < 0.05) and decreased the gene expression of RIP2, NF-κBp50, NF-κBp65 and IL-1β compared with the other two treatments; they also increased the gene expression of CAT, GSH-Px and SOD2 compared with the Polytunnel (p < 0.05). On days 21 and 28, the Outdoor treatment increased the gene expression of HSF-1, HSP90, HSP70, Nrf2, CAT, GSH-Px, SOD1 and SOD2 and decreased the gene expression of RIP2, NF-κBp50, NF-κBp65, IL-1β, IL-4 and TNF-α, compared with the other two treatments. Collectively, with the increase of cold exposure over time, HSP and antioxidant enzyme-related gene expression showed an increasing trend, and cytokine-related gene expression showed a decreasing trend.
4. Discussion
Continuous cold exposure in winter is an important cause of reduced animal welfare; and low profitability of the farming system. The different accommodation systems on farms and feedlots may affect the growth and health of sheep. Therefore, the House, Outdoor and Polytunnel treatments were designed to evaluate their effects on the growth performance, immune function and antioxidant status of young female lambs in winter in northern China.
4.1. Environmental Parameters, Growth and Temperature
Keeping lambs outdoors reduced their weight gain and adversely impacted on immunocompetence and antioxidant status, while the indoor systems (House and Polytunnel) alleviated the above situation. The polytunnel probably had greater effects on the lambs’ immune function than the house or outdoors because it provided exposure to radiant heat. Over the course of the experiment, the fact that the gene expressions of HSP and antioxidant enzymes increased, and the gene expressions of inflammatory cytokines decreased, suggests that there were cumulative effects of cold exposure.
Average gaily gain (ADG) and the scalp and ear skin temperature of lambs in the Outdoor treatment were lower than those in the House and Polytunnel. In the outdoors, the low temperature and increased wind speed environment would have increased the heat loss of the lambs, leading to reduced skin temperatures and a reduced growth rate, because energy consumption would have been increased to maintain body temperature. There was no difference between treatments in core body temperature, indicating that the sheep were relatively stable thermally; however, the cumulative biochemical effects on their blood and gene expression parameters indicate that had the experiment progressed beyond 28 d, there may have been more serious consequences.
The lower critical temperature of sheep is about −3 °C, depending on factors such as fleece length, wind speed, etc., and for every 1 °C drop from −3 °C, the daily maintenance metabolizable energy requirement of a 60 kg sheep increases by 0.14~0.64 MJ [22]. A previous study in a Tibetan winter found that the growth rate of ewes raised outdoors decreased by 28 g/d, compared with ewes raised in a shed [16]. Similarly, the ADG and feed efficiency of cattle has been reported to be lower in March, compared with a warmer April [2,3]. The air temperatures in our house and polytunnel were similar and about 10 °C higher than that of the outdoors, and the wind speed was highest outdoors. The resulting wind chill was sufficient to reduce average daily gain, but this was not compensated by increased feed intake. It is likely that the diet was not of sufficiently high nutrient concentration to allow the lambs to increase intake to counteract the cold without reducing growth rates. The polytunnel had relatively warm sunlight entering, which kept radiant heat in the house and reduced the energy loss caused by cold exposure, which was probably the main reason for the beneficial impact of the polytunnel on concentrations of immune and antioxidative indicators. NH3 and CO2 in livestock houses are also important factors affecting their health and growth. Enclosed sheep sheds that are poorly ventilated cause NH3 and CO2 accumulation in the shed, leading to a decline in immune and antioxidative function and an increase in body energy consumption for detoxification [23]. The lack of ventilation was evident, with increased concentrations of NH3 and CO2 in the house and polytunnel compared with those in the outdoor treatment.
4.2. Gene Expression and Antioxidants
Heat shock proteins (HSPs) are a class of highly conserved molecular chaperone proteins that participate in signal transduction by regulating the structure and function of proteins [24]. Animals increase the level of HSP transcription to adapt to changes in the external environment [25]. Banerjee et al. [26] found that the gene expressions of HSPA1A and HSPA8 in goat lymphocytes were increased significantly by low temperature in winter. Richi et al. [27] observed that the expression of the HSP70 gene was higher in liver and kidney tissues, compared to heart and spleen, and the HSP70 protein exhibited overexpression in the liver and heart tissues, compared to kidney and spleen tissues, in both the summer and winter seasons. In the present study, the levels of insulin, HSP70 and HSP90 in serum were not significantly different between the three treatments in the first two weeks. This may be because changes could not be programmed in the sheeps’ bodies within that time period. However, as the experiment progressed, the serum HSP90 content and HSP90 mRNA expression in the leukocyte of the lambs in the Outdoor treatment were increased to maintain the intracellular structure and function to adapt to the cold environment [28]. The hypothalamus of livestock reacts to cold stress signals, activates the sympathetic nervous system, reduces serum insulin and increases serum glucose concentrations to compensate for increased energy expenditure [5]. The reduction in insulin releases HSF-1 through insulin-like receptor decay accelerating factor 2 (DAF-2), and the nucleus and heat shock protein element (HSE) combine to increase the level of HSP transcription [29]. Therefore, compared with lambs in the house and polytunnel, the lower serum insulin levels and higher HSP levels appear to have been caused by greater cold stress in the lambs in the outdoor treatment. This result suggests that there were hormonal changes caused by the low temperatures which affected the expression of molecular chaperones.
Reactive oxygen species (ROS) are free radicals produced by the oxidative respiration of cell mitochondria. They are usually kept at a low level by the cellular antioxidant defense mechanism. However, the enhanced metabolism caused by the low temperatures would have produced a large amount of ROS and oxidized unsaturated fatty acids to increase MDA production. The latter was increased in the lambs kept outdoors by almost 50% by the end of the experiment. The antioxidant enzyme system can remove MDA to protect the body against oxidative stress. During cold exposure, serum GSH-Px and CAT activities of the lambs are decreased while MDA content increases [6]. Chronic cold stress reduced the activity of CAT, GSH-Px and SOD in chicken heart tissue [7]. In this study, the increased serum MDA content of outdoor lambs appears to have reduced the activity of serum antioxidant enzymes. Nrf2 is a key factor in the transcription of antioxidant enzyme genes. When cold stress causes oxidative imbalance, excess ROS and HSP90 can both interact with Kelch-like epichlorohydrin-related protein 1 (Keap1), dissociate the Keap1-Nrf2 complex and release Nrf2 into the nucleus to activate its downstream antioxidant genes transcription [12]. Frigault et al. [30] found that compared with squirrels reared at room temperature, the mRNA transcription level of Nrf2 in the heart tissue of thirteen hibernating ground squirrels at 4~6 °C was significantly higher, and the mRNA expression of Keap1 was significantly reduced. On the 7th day of this study, the expression of the Nrf2 gene in outdoor lambs was significantly higher than those of the other two groups. As the low temperature exposure period advanced, the transcription of Nrf2 and downstream antioxidant enzyme genes in blood leukocytes were significantly increased, which may be due to a massive release of ROS in blood, and the HSP90 in leukocytes increased the HSP90-Keap1 interaction and activated the transcription of Nrf2 and its downstream antioxidant enzyme genes in the lambs in the outdoor treatment. However, it is worth noting that although the expression of antioxidant enzyme-related genes was up-regulated, the serum antioxidant enzyme activity was still decreased. This may be because oxidative stress can increase the expression of antioxidant genes as a compensatory protective effect [31]. The antioxidant enzymes catalyze increased production of H2O2, which leads to the inhibition of the activity of antioxidant enzymes. Similar results have been found in another study, in which the expression of Nrf2 mRNA and protein increased in rat liver cells treated with garlic extract, but the activity of antioxidant enzymes was still lower than normal during oxidative stress [32]. Blood plays a key role in transporting nutrients in the organism: when outdoor lambs were subjected to oxidative stress, excessive MDA was produced in the organism and released into the blood, and antioxidant enzymes were transported to key organs, such as the heart and liver, leading to the decrease in the antioxidant enzyme activity in blood [33]. Therefore, the decrease in the level of antioxidant enzymes in serum in outdoor lambs indicated that the organism was in oxidative imbalance, and the overexpression of HSP90 and Nrf2 mRNA was the body’s protective mechanism against ROS damage. This study showed that outdoor lambs had lower serum antioxidant enzyme activity and higher MDA content, but increasing the temperature in the house and polytunnel could alleviate the oxidative and antioxidant imbalance in the young female lambs, This was especially true in the Polytunnel treatment, which had sunshine entering.
4.3. Immune Function
Serum immunoglobulins secreted by plasma B cells play a key role in the defense against pathogens. Low temperature conditions usually cause a reduction of immunoglobulins secretion. Guo et al. [19] found that chronic cold stress significantly reduced the serum IgG content in sheep. In this study, as the experimental period progressed, polytunnel lambs had a higher IgG level than the other two groups, which might be increased by the high content of IL-4 [24]. Immune cytokines in blood can regulate the immune response, and their levels in serum can reflect the immune status. The pro-inflammatory cytokine TNF-α and the anti-inflammatory cytokine IL-4 are both cellular cytokines that are secreted by T lymphocyte subtypes Th1 and Th2 cells. Inflammatory action caused by cold stress led to an alteration in Th1- and Th2-type cytokines secretion in serum [34]. In our study, long-term cold exposure outdoors significantly reduced the level of cytokines in sheep serum [19]. Cold stress inhibits humoral immunity in rats and reduces the proliferation of IL-1β and IL-4 levels in serum [8]. We found that outdoor sheep serum had lower IL-4 content, indicating that the low temperature resulted in the dysregulation of the Th1/Th2 cytokines profiles, adversely affecting the Th1/Th2 balance and inhibiting cytokine secretion. The decrease in cytokine content might also be caused by the decrease in nuclear factor kappa-B (NF-κB) regulation of its gene expression. NF-κB is a key transcription factor related to immune responses. The nucleotide-binding leucine-rich repeat-containing (NLR) family member NOD1 can combine receptor-interacting proteins 2 (RIP2), which activates the NF-κB pathway to increase the transcription of immune genes [13]. HSP90 can maintain the stability of NOD1 during low temperature, keeping it in an inhibited state and reducing the activation of NF-κB [35]. During cold stress, the mRNA expression of NF-κB and TNF-α in mouse hypothalamic cells is significantly down-regulated [36]. In this study, the expression of HSP90 mRNA was increased, and the expression of NF-κB mRNA was inhibited by NOD1, thereby reducing the expression of IL-1β and TNF-α mRNA. The overexpression of HSP could help the organism maintain homeostasis [24]. The upregulation of HSP not only increases the expression of antioxidant enzymes regulated by Nrf2 transcription [12] but also reduces immune responses regulated by NF-ĸB transcription [36], and Nrf2 and NF-κB also influence each other. Recent studies showed that Nrf2 inhibited the activation of the NF-κB pathway by increasing the transcription level of antioxidant enzymes, thereby reducing the ROS-mediated activation of NF-κB and the damage to the body caused by inflammation [37]. Moreover, HSP might be passively or actively released from the necrotic or stressed cells, respectively, and extracellular HSP can promote regulatory T cells, participate in antigen presentation and stimulate immune response to protect the immune system from immunosuppression [28]. Therefore, the decrease in cytokines caused by low temperature may be the result of HSP gene regulation, and the polytunnel had sunlight with radiant heat, which was beneficial to the immune function of young female lambs. The lambs in long-term cold exposure experienced inflammatory damage and anti-oxidant imbalance. Cold exposure impacted the expression of HSP, Nrf2 and NF-κB, which regulates immune responses and antioxidant function.
5. Conclusions
Outdoor keeping of young female lambs in winter at an ambient temperature of −14 °C and 55% relative humidity reduced their growth rate, serum immunocompetence and antioxidant status, compared with those in an enclosed house or a polytunnel. Although core body temperature was not adversely affected in the outdoor treatment, the serum biochemistry and gene expression parameters progressively changed in this treatment over the course of the 28-day experiment, indicating a lack of homeostasis at these temperatures. The polytunnel treatment was more conducive to good immune function and maintained the antioxidant balance best in the young female lambs. Therefore, polytunnels are recommended as the best option for the welfare of these sheep in these conditions, followed by enclosed housing, with the worst being keeping them outdoors.
Author Contributions
Conceptualization, J.X.; Methodology, J.X.; Formal analysis, W.G.; Investigation, J.X., W.G., Z.H., Y.X. (Yuanqing Xu) and Y.X. (Yuanyuan Xing); Data curation, W.G. and Z.H.; Writing—original draft, J.X.; Writing—review & editing, C.J.C.P. and B.S.; Supervision, C.J.C.P. and B.S. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by National Natural Science Foundation Fund (32260811), Inner Mongolia Autonomous Region key research and achievement transformation project (2022YFYZ0001), Inner Mongolia Autonomous Region Youth Science and Technology Talents Project (NJYT23014), High Level Research Project of College of Animal Science, Inner Mongolia Agricultural University (QT202204) and the International Animal Welfare Standards Project.
Institutional Review Board Statement
The experimental protocol (No: NND20212037) was approved by the Institutional Ethics Committee of Inner Mongolia Agricultural University. The research also complied with the national standard Guideline for Ethical Review of Animal Welfare (GB/T 35892-2018).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are available from the corresponding author on request.
Acknowledgments
The authors thank their laboratory colleagues for the assistance in sample collection and laboratory analysis.
Conflicts of Interest
The authors declare that there are no competing interests. Clive Phillips declares that he is a director of the Humane Society International in Australia.
References
- Hu, L.; Brito, L.F.; Abbas, Z.; Sammad, A.; Kang, L.; Wang, D.; Wu, H.; Liu, A.; Qi, G.; Zhao, M.; et al. Investigating the Short-Term Effects of Cold Stress on Metabolite Responses and Metabolic Pathways in Inner-Mongolia Sanhe Cattle. Animals 2021, 11, 2493. [Google Scholar] [CrossRef]
- Kang, H.J.; Lee, I.K.; Piao, M.Y.; Gu, M.J.; Yun, C.H.; Kim, H.J.; Kim, K.H.; Baik, M. Effects of ambient temperature on growth performance, blood metabolites, and immune cell populations in Korean cattle steers. Asian Australas. J. Anim. Sci. 2016, 29, 436–443. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.J.; Lee, J.; Park, S.J.; Jung, D.; Na, S.W.; Kim, H.J.; Baik, M. Effects of cold temperature and fat supplementation on growth performance and rumen and blood parameters in early fattening stage of Korean cattle steers. Anim. Feed Sci. Technol. 2020, 269, 114624. [Google Scholar] [CrossRef]
- Plush, K.L.; Brien, F.D.; Hebart, M.L.; Hynd, P.L. Thermogenesis and physiological maturity in neonatal lambs: A unifying concept in lamb survival. Anim. Prod. Sci. 2016, 56, 736–745. [Google Scholar] [CrossRef]
- Manfredi, L.H.; Zanon, N.M.; Garófalo, M.A.; Navegantes, L.C.C.; Kettelhut, I.C. Effect of short-term cold exposure on skeletal muscle protein breakdown in rats. J. Appl. Physiol. 2013, 115, 1496–1505. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, W.W.; Wang, R.F.; Meng, Z.Q.; Duan, Y.X.; An, X.P.; Qi, J.W. Dietary supplementation of ferulic acid improves performance and alleviates oxidative stress of lambs in a cold environment. Can. J. Anim. Sci. 2019, 99, 705–712. [Google Scholar] [CrossRef]
- Wei, H.D.; Zhang, R.X.; Su, Y.Y.; Bi, Y.J.; Li, X.; Zhang, X.; Li, J.H.; Bao, J. Effects of acute cold stress after long-term cold stimulation on antioxidant status, heat shock proteins, inflammation and immune cytokines in broiler heart. Front. Physiol. 2018, 9, 1589–1601. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.R.; Li, S.Z.; Fang, H.G.; Zhang, X.; Wang, J.F.; Guo, S.; Ji, H.; Zang, L.; Guo, L.; Zhen, L.; et al. Different Duration of Cold Stress Enhances Pro-Inflammatory Cytokines Profile and Alterations of Th1 and Th2 Type Cytokines Secretion in Serum of Wistar Rats. J. Anim. Vet. Adv. 2012, 11, 1538–1545. [Google Scholar]
- Demas, G.E.; Nelson, R.J. Photoperiod and Temperature Interact to Affect Immune Parameters in Adult Male Deer Mice (Peromyscus manicuiatus). J. Biol. Rhythm. 1996, 11, 94. [Google Scholar] [CrossRef]
- Rybakina, E.G.; Shanin, S.N.; Kozinets, I.A.; Fomicheva, E.E.; Korneva, E.A. Cellular mechanisms of cold stress-related immunosuppression and the action of interleukin 1. Int. J. Tissue React. 1997, 19, 135. [Google Scholar]
- Hu, G.Z.; Yang, S.J.; Hu, W.X.; Wen, Z.; He, D.; Zeng, L.F.; Xiang, Q.; Wu, X.M.; Zhou, W.Y.; Zhu, Q.X. Effect of cold stress on immunity in rats. Exp. Ther. Med. 2016, 11, 33–42. [Google Scholar] [CrossRef]
- Niture, S.K.; Jaiswal, A.K. HSP90 interaction with INrf2(Keap1) mediates stress-induced Nrf2 activation. J. Biol. Chem. 2010, 285, 36865–36875. [Google Scholar] [CrossRef]
- Hahn, J.S. Regulation of Nod1 by Hsp90 chaperone complex. FEBS Lett. 2005, 579, 4513–4519. [Google Scholar] [CrossRef]
- Can, M.E.; Boğa, M. The importance of sheep shelters in cold climate region. Black Sea J. Agric. 2018, 1, 1–5. [Google Scholar]
- Zhang, X.Q.; Kemp, D.; Hou, X.Y.; Langford, C.M.; Wang, K.; Yan, W.H. Effects of shed modifications on ewe reproductive performance and lamb growth rate in Inner Mongolia. Rangel. J. 2016, 38, 479–487. [Google Scholar] [CrossRef]
- Jin, Y.M.; Zhang, X.Q.; Badgery, W.B.; Li, P.; Wu, J.X. Effects of winter and spring housing on growth performance and blood metabolites of Pengbo semi-wool sheep in Tibet. Asian-Australas. J. Anim. Sci. 2019, 32, 1630–1639. [Google Scholar] [CrossRef]
- Abdelraheem, N.; Li, F.H.; Guo, P.H.; Sun, Y.; Liu, Y.; Cheng, Y.X.; Hou, F.J. Oat hay as winter feed improves digestibility, nitrogen balance and energy utilization of Tibetan sheep (Ovis aries) in the Qinghai Tibetan Plateau. Livest. Sci. 2019, 230, 103854–103863. [Google Scholar] [CrossRef]
- Su, Y.Y.; Li, S.; Xin, H.W.; Li, J.F.; Li, X.; Zhang, R.X.; Li, J.H.; Bao, J. Proper cold stimulation starting at an earlier age can enhance immunity and improve adaptability to cold stress in broilers. Poult. Sci. 2020, 99, 129–141. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Zhou, G.; Tian, G.; Liu, Y.; Dong, N.; Li, L.; Zhang, S.; Chai, H.; Chen, Y.; Yang, Y. Changes in Rumen Microbiota Affect Metabolites, Immune Responses and Antioxidant Enzyme Activities of Sheep under Cold Stimulation. Animals 2021, 11, 712. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids; The National Academies Press: Washington, DC, USA, 2007; 384p, ISBN 9780309102131.
- Shi, L.; Xu, Y.; Mao, C.; Wang, Z.Q.; Guo, S.W.; Jin, X.; Yan, S.M.; Shi, B.L. Effects of heat stress on antioxidant status and immune function and expression of related genes in lambs. Int. J. Biometeorol. 2020, 64, 2039–2104. [Google Scholar] [CrossRef] [PubMed]
- Cottle, D.J.; Pacheco, D. Prediction of fleece insulation after shearing and its impact on maintenance energy requirements of Romney sheep. Small Rumin. Res. 2017, 157, 14–22. [Google Scholar] [CrossRef]
- Beker, A.; Vanhooser, S.L.; Swartzlander, J.H.; Teeter, R.G. Atmospheric ammonia concentration effects on broiler growth and performance. J. Appl. Poult. Res. 2004, 13, 5–9. [Google Scholar] [CrossRef]
- Zuehlke, A.D.; Moses, M.A.; Neckers, L. Heat shock protein 90: Its inhibition and function. Philos. Trans. R. Soc. B 2018, 373, 527–532. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.M.; Singh, S.; Ganguly, I.; Nachiappan, R.K.; Ganguly, A.; Venkataramanan, R.; Chopra, A.; Narula, H.K. Association of heat stress protein 90 and 70 gene polymorphism with adaptability traits in Indian sheep (Ovis aries). Cell Stress Chaperones 2017, 22, 675–684. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, D.; Upadhyay, R.C.; Chaudhary, U.B.; Kumar, R.; Singh, S.; Ashutosh; Jagan, M.G.; Polley, S.; Mukherjee, A.; Das, T.K.; et al. Seasonal variation in expression pattern of genes under HSP70. Cell Stress Chaperones 2014, 19, 401–408. [Google Scholar] [CrossRef]
- Nagayach, R.; Gupta, U.D.; Prakash, A. Expression profiling of HSP70 gene during different seasons in goats (Capra hircus) under sub-tropical humid climatic conditions. Small Rumin. Res. 2017, 147, 41–47. [Google Scholar] [CrossRef]
- Stefan, T. Heat Shock Protein 70 as a Double Agent Acting Inside and Outside the Cell: Insights into Autoimmunity. Int. J. Mol. Sci. 2020, 21, 5298. [Google Scholar]
- Chiang, W.C.; Ching, T.T.; Lee, H.C.; Mousigian, C.; Hsu, A.L. HSF-1 regulators DDL-1/2 link insulin-like signaling to heat-shock responses and modulation of longevity. Cell 2012, 148, 322–334. [Google Scholar] [CrossRef] [PubMed]
- Frigault, J.J.; Gaudet, J.D.; Morin, P.J. Investigating Nrf2-associated non-coding RNAs in the hibernating ground squirrel, Ictidomys tridecemlineatus. J. Therm. Biol. 2018, 75, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Pamok, S.; Aengwanich, W.; Komutrin, T. Adaptation to oxidative stress and impact of chronic oxidative stress on immunity in heat-stressed broilers. J. Therm. Biol. 2009, 34, 353–357. [Google Scholar] [CrossRef]
- Kalayarasan, S.; Sriram, N.; Sureshkumar, A.; Sudhandiran, G. Chromium (VI)-induced oxidative stress and apoptosis is reduced by garlic and its derivativeS-allylcysteine through the activation of Nrf2 in the hepatocytes of Wistar rats. J. Appl. Toxicol. 2008, 28, 908–919. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Niu, Y.; Zhang, H.; Xu, T.; Zeng, Q.; Storey, K.; Chen, Q. The effect of long-term cold acclimation on redox state and antioxidant defense in the high-altitude frog, Nanorana pleskei. J. Therm. Biol. 2021, 99, 103008. [Google Scholar] [CrossRef] [PubMed]
- Jia, Z.; Chen, A.; Wang, C.; He, M.; Xu, J.; He, F.; Xin, Z.; Lv, W.; Guo, Z. Amelioration effects of Kaempferol on immune response following chronic intermittent cold-stress. Res. Vet. Sci. 2019, 125, 390–396. [Google Scholar] [CrossRef] [PubMed]
- Shao, S.C. The non-canonical NF-κB pathway in immunity and inflammation. Nat. Rev. Immunol. 2017, 17, 545–558. [Google Scholar]
- Lee, K.H.; Biswas, A.; Liu, Y.J.; Kobayashi, K.S. Proteasomal degradation of NOD2 protein mediates tolerance to bacterial cell wall components. J. Biol. Chem. 2012, 287, 39800–39811. [Google Scholar] [CrossRef]
- Sivandzade, F.; Prasad, S.; Bhalerao, A.; Cucullo, L. Nrf2 and NF-κB interplay in cerebrovascular and neurodegenerative disorders: Molecular mechanisms and possible therapeutic approaches. Redox Biol. 2019, 21, 101059–101075. [Google Scholar] [CrossRef]
Figure 1.
Effects of housing on HSF-1-, HSP70- and HSP90-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD (n = 10). Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Figure 1.
Effects of housing on HSF-1-, HSP70- and HSP90-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD (n = 10). Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Figure 2.
Effects of housing on Nrf2-, CAT-, GPX-Px-, SOD1- and SOD2-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD (n = 10). Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Figure 2.
Effects of housing on Nrf2-, CAT-, GPX-Px-, SOD1- and SOD2-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD (n = 10). Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Figure 3.
Effects of housing on NF-κBp50-, NF-κBp65-, IL-1β-, IL-4- and TNF-α-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD. Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Figure 3.
Effects of housing on NF-κBp50-, NF-κBp65-, IL-1β-, IL-4- and TNF-α-related gene expression in young female lambs. Housed lambs’ gene expression on d 7 was taken as the calibrator. Data represent the means ± SD. Means bearing different superscripts (a, b) differ significantly (p < 0.05) between treatments on the same day, n = 10.
Table 1.
Composition and nutrient level of the young female lambs’ diet (on an air-dried basis).
| Physical Composition | % | Nutrient Composition | %, Unless Otherwise Stated |
|---|---|---|---|
| Corn | 14.58 | DE/(MJ/kg) 2 | 11.12 |
| Asparagus | 50.00 | DM | 90.72 |
| Alfalfa hay | 8.80 | CP | 13.62 |
| Cottonseed meal | 8.26 | EE | 1.96 |
| Soybean meal | 5.30 | NDF | 44.08 |
| Wheat bran | 8.36 | ADF | 29.08 |
| DDGS | 3.30 | Ash | 8.01 |
| CaHPO4 | 0.12 | Ca | 0.83 |
| NaCl | 0.30 | P | 0.21 |
| NaHCO3 | 0.48 | ||
| Premix 1 | 0.50 | ||
| Total | 100 |
DDGS: dried distillers’ grains with solubles; DE: digestible energy; DM: dry matter; CP: crude protein; EE: ether extract; NDF: neutral detergent fiber; ADF: acid detergent fiber. 1 The premix provided the following per kg of diet: vitamin A 6000 IU, vitamin D3 2000 IU, vitamin E 15 IU, vitamin K3 1.8 mg, vitamin B1 0.35 mg, vitamin B2 8.5 mg, vitamin B6 0.9 mg, vitamin B12 0.03 mg, D-pantothenic acid 16 mg, nicotinic acid 22 mg, folic acid 1.5 mg, biotin 0.15 mg, Cu 8 g, Fe 40 mg, Mn 20 mg, Zn 40 mg, I 0.8 mg, Se 0.3 mg, Co 0.3 mg. 2 DE was a calculated value, all others were measured values.
Table 2.
Genes and their primer sequence.
| Gene | Gene Bank No. | Primer Sequence | Fragment Size | Annealing Temp (°C) |
|---|---|---|---|---|
| β-Actin | NM_001009784.1 | F- AGCGCAAGTACTCCGTGTG | 122 | 58 |
| R- CATTTGCGGTGGACGATG | ||||
| HSP70 | JN604434.1 | F- CCCACGAAGCAGACGCAGAT | 66 | 52 |
| R-GCAGGTTGTTGTCCCGAGTCAT | ||||
| HSP90 | EF091713.1 | F-GCATTCTCAGTTCATTGGCTATCC | 190 | 58 |
| R- GTCCTTCTTCTCTTCCTCCTCTTC | ||||
| HSF-1 | XM_015097629.1 | F-CAGCTGATGAAGGGGAAGCA | 158 | 56 |
| R- TTTGACTGCACCAGCGAGAT | ||||
| IL-1β | NM_001009465 | F- CGATGAGCTTCTGTGTGATG | 161 | 59 |
| R-CTGTGAGAGGAGGTGGAGAG | ||||
| IL-4 | AF1721681 | F-GCTGAACATCCTCACATCGAG | 87 | 60 |
| R- TTCTCAGTTGCGTTCTTTGG | ||||
| TNF-α | NM_001024860 | F- AGTCTGGGCAGGTCTACTTTG | 127 | 60 |
| R-GGTAACTGAGGTGGGAGAGG | ||||
| NF-κBp50 | XM_004009667.3 | F-AGCACCACTTATGACGGAACTACA | 168 | 60 |
| R- GACCCCTTCATCCTCTCCATC | ||||
| NF-κBp65 | XM_004020143.3 | F-GGAGGCCAAGGAACTGAAGA | 101 | 60 |
| R-TCAGGGGCAGAGGAAGGAG | ||||
| RIP2 | NC_040260.1 | F- CTCTGCGCTGTGTCCGTGTTC | 219 | 60 |
| R-CAGGCTTCATCATCTGGCTCAC | ||||
| Nrf2 | XM_004004557.1 | F:TGTGGAGGAGTTCAACGAGC | 88 | 61 |
| R:CGCCGCCATCTTGTTCTTG | ||||
| CAT | XM_004016396 | F:GAGCCCACCTGCAAAGTTCT | 148 | 60 |
| R:CTCCTACTGGATTACCGGCG | ||||
| GSH-Px | XM_004018462.1 | F:TGGTCGTACTCGGCTTCCC | 163 | 60 |
| R:AGCGGATGCGCCTTCTCG | ||||
| SOD1 | NM_001145185 | F:GGAGACCTGGGCAATGTGAA | 182 | 60 |
| R:CCTCCAGCGTTTCCAGTCTT | ||||
| SOD2 | NM_001280703.1 | F:AAACCGTCAGCCTTACACC | 116 | 60 |
| R:ACAAGCCACGCTCAGAAAC |
β-actin: beta-actin; HSF-1: heat shock transcription factor 1; NF-κBp50: nuclear factor kappa-B p50; NF-κBp65: nuclear factor kappa-B p65; RIP2: receptor-interacting proteins 2; Nrf2: nuclear factor erythroid 2-related factor 2; F: forward primer; R: reverse primer.
Table 3.
The environmental indicators of the three treatment groups during the test period.
| Item | Treatment | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| Temperature (°C) | −4.90 ± 3.60 a | −14.40 ± 4.70 b | −3.65 ± 3.98 a | 0.001 |
| Relative humidity (%) | 69.13 ± 8.86 a | 55.21 ± 11.16 c | 62.28 ± 10.65 b | 0.001 |
| Wind speed (m/s) | 0.06 ± 0.02 b | 0.45 ± 0.43 a | 0.07 ± 0.03 b | 0.001 |
| NH3 (mg/m3) | 2.36 ± 0.83 a | 0.00 ± 0.00 c | 1.70 ± 0.99 b | 0.001 |
| CO2 (mg/m3) | 372.83 ± 73.24 a | 274.44 ± 21.43 b | 326.15 ± 98.90 a | 0.001 |
a, b, c Different superscripts within the same row indicate a significant difference (p < 0.05). House: house; Outdoor: outdoor; Polytunnel: polytunnel.
Table 4.
Effects of housing on growth performance of young female lambs.
| Items | Treatment | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| IBW (kg) | 16.28 ± 2.66 | 16.61 ± 2.51 | 16.40 ± 2.56 | 0.901 |
| FBW (kg) | 18.61 ± 2.36 | 17.93 ± 2.61 | 18.99 ± 2.54 | 0.518 |
| ADG (g/d) | 83.17 ± 26.61 a | 47.19 ± 9.31 b | 92.50 ± 26.91 a | 0.001 |
| ADFI (g/d) | 577.40 ± 102.15 | 590.01 ± 123.05 | 633.68 ± 95.83 | 0.333 |
a, b Different superscripts within the same row indicate a significant difference (p < 0.05). House: lambs in the house, Outdoor: outdoor lambs, Polytunnel: lambs in the polytunnel, n = 15. IBW: initial body weight, FBW: final body weight, ADG: average daily gain, ADFI: average daily feed intake.
Table 5.
Effects of housing on scalp and ear skin temperature and rectal temperature of young female lambs.
Table 5.
Effects of housing on scalp and ear skin temperature and rectal temperature of young female lambs.
| Items | Groups | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| Scalp temperature (°C) | 13.66 ± 4.35 a | 10.39 ± 4.51 b | 12.83 ± 3.66 a | 0.001 |
| Ear skin temperature (°C) | 10.92 ± 4.11 a | 8.64 ± 4.69 b | 11.15 ± 4.69 a | 0.001 |
| Rectal temperature (°C) | 38.33 ± 0.54 | 38.37 ± 0.67 | 38.41 ± 0.63 | 0.770 |
a, b Different superscripts within the same row indicate significant difference (p < 0.05), n = 10. House: house, Outdoor: outdoor, Polytunnel: polytunnel.
Table 6.
Effects of housing condition on serum insulin and heat shock protein level of young female lambs.
Table 6.
Effects of housing condition on serum insulin and heat shock protein level of young female lambs.
| Items | Group | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| d 7 | ||||
| INS (μIU/mL) | 7.31 ± 0.41 | 7.84 ± 1.78 | 7.61 ± 2.02 | 0.623 |
| HSP70 (pg/mL) | 126.70 ± 24.91 | 134.60 ± 37.82 | 124.40 ± 18.21 | 0.648 |
| HSP90 (pg/mL) | 521.70 ± 52.88 | 564.60 ± 53.20 | 554.80 ± 53.31 | 0.219 |
| d 14 | ||||
| INS (μIU/mL) | 7.55 ± 0.53 | 7.48 ± 1.94 | 7.91 ± 1.57 | 0.374 |
| HSP70 (pg/mL) | 127.60 ± 6.08 | 133.60 ± 18.26 | 125.40 ± 8.74 | 0.335 |
| HSP90 (pg/mL) | 523.10 ± 59.16 | 575.60 ± 63.38 | 536.80 ± 41.66 | 0.130 |
| d 21 | ||||
| INS (μIU/mL) | 7.84 ± 0.96 | 7.12 ± 1.26 | 8.04 ± 1.49 | 0.080 |
| HSP70 (pg/mL) | 122.60 ± 16.15 | 129.50 ± 23.24 | 122.70 ± 10.45 | 0.617 |
| HSP90 (pg/mL) | 545.88 ± 71.24 ab | 593.96 ± 51.11 a | 531.78 ± 25.04 b | 0.046 |
| d 28 | ||||
| INS (μIU/mL) | 7.87 ± 1.24 a | 6.75 ± 1.43 b | 8.31 ± 2.34 a | 0.012 |
| HSP70 (pg/mL) | 123.3 ± 8.80 | 128.0 ± 12.12 | 120.2 ± 7.24 | 0.259 |
| HSP90 (pg/mL) | 543.2 ± 38.42 b | 601.2 ± 63.41 a | 526.4 ± 49.87 b | 0.012 |
a, b Different superscripts within the same row indicate a significant difference (p < 0.05), n = 10. House: house, Outdoor: outdoor, Polytunnel: polytunnel. INS: insulin, HSP70: heat shock protein 70, HSP90: heat shock protein 90.
Table 7.
Effects of housing on serum antioxidant concentrations in young female lambs.
| Item | Group | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| d 7 | ||||
| CAT (U/mL) | 1.48 ± 0.14 | 1.41 ± 0.16 | 1.53 ± 0.17 | 0.400 |
| GSH-Px (U/mL) | 107.9 ± 15.22 | 102.8 ± 18.55 | 119.39 ± 17.88 | 0.266 |
| T-SOD (U/mL) | 126.50 ± 11.16 | 115.18 ± 15.66 | 128.88 ± 11.44 | 0.126 |
| T-AOC (U/mL) | 0.42 ± 0.08 | 0.37 ± 0.10 | 0.43 ± 0.06 | 0.365 |
| MDA (nmol/mL) | 2.17 ± 0.29 | 2.20 ± 0.44 | 2.10 ± 0.36 | 0.863 |
| d 14 | ||||
| CAT (U/mL) | 1.46 ± 0.15 | 1.31 ± 0.20 | 1.56 ± 0.19 | 0.066 |
| GSH-Px (U/mL) | 115.04 ± 25.22 | 99.49 ± 20.86 | 127.29 ± 23.25 | 0.241 |
| T-SOD (U/mL) | 133.52 ± 11.13 a | 109.43 ± 15.30 b | 138.73 ± 16.78 a | 0.004 |
| T-AOC (U/mL) | 0.46 ± 0.04 | 0.42 ± 0.03 | 0.45 ± 0.04 | 0.118 |
| MDA (nmol/mL) | 2.10 ± 0.21 ab | 2.30 ± 0.25 a | 1.97 ± 0.44 b | 0.040 |
| d 21 | ||||
| CAT (U/mL) | 1.43 ± 0.19 a | 1.22 ± 0.15 b | 1.58 ± 0.21 a | 0.015 |
| GSH-Px (U/mL) | 125.27 ± 11.85 a | 97.33 ± 21.86 b | 137.18 ± 14.65 a | 0.009 |
| T-SOD (U/mL) | 135.46 ± 14.84 a | 107.82 ± 14.12 b | 145.08 ± 18.39 a | 0.014 |
| T-AOC (U/mL) | 0.45 ± 0.07 | 0.40 ± 0.05 | 0.46 ± 0.04 | 0.054 |
| MDA (nmol/mL) | 1.94 ± 0.32 b | 2.52 ± 0.35 a | 1.88 ± 0.24 b | 0.004 |
| d 28 | ||||
| CAT (U/mL) | 1.43 ± 0.22 a | 1.16 ± 0.17 b | 1.67 ± 0.20 a | 0.009 |
| GSH-Px (U/mL) | 132.17 ± 10.55 a | 93.25 ± 19.19 b | 148.15 ± 14.31 a | 0.001 |
| T-SOD (U/mL) | 136.84 ± 17.31 a | 104.02 ± 13.91 b | 151.07 ± 11.63 a | 0.006 |
| T-AOC (U/mL) | 0.44 ± 0.06 a | 0.39 ± 0.08 b | 0.45 ± 0.05 a | 0.063 |
| MDA (nmol/mL) | 1.91 ± 0.29 a | 2.70 ± 0.43 b | 1.82 ± 0.50 a | 0.001 |
a, b Different superscripts within the same row indicate significant difference (p < 0.05), n = 10. House: lambs in the house, Outdoor: outdoor lambs, Polytunnel: lambs in the polytunnel. CAT: catalase, GSH-Px: glutathione peroxidase, T-SOD: total superoxide dismutase, T-AOC: total antioxidant capacity, MDA: malondialdehyde, d: day.
Table 8.
Effects of housing on serum interleukins and immunoglobulins in young female lambs.
| Items | Group | p-Value | ||
|---|---|---|---|---|
| House | Outdoor | Polytunnel | ||
| 7 d | ||||
| IgA (μg/mL) | 47.06 ± 4.06 | 47.34 ± 4.74 | 48.05 ± 5.43 | 0.905 |
| IgG (mg/mL) | 12.35 ± 1.91 | 12.79 ± 2.93 | 12.43 ± 1.57 | 0.897 |
| IgM (μg/mL) | 352.91 ± 18.55 | 362.00 ± 31.08 | 362.62 ± 40.94 | 0.428 |
| IL-1β (pg/mL) | 12.37 ± 2.06 | 12.29 ± 2.21 | 11.82 ± 0.98 | 0.619 |
| IL-4 (pg/mL) | 10.55 ± 0.48 | 10.60 ± 1.00 | 10.12 ± 0.95 | 0.416 |
| TNF-α (pg/mL) | 26.70 ± 2.13 | 26.95 ± 2.64 | 27.22 ± 3.08 | 0.131 |
| 14 d | ||||
| IgA (μg/mL) | 46.49 ± 2.37 | 46.80 ± 1.73 | 49.22 ± 2.76 | 0.054 |
| IgG (mg/mL) | 12.33 ± 1.08 | 12.67 ± 1.60 | 13.55 ± 0.96 | 0.108 |
| IgM (μg/mL) | 349.80 ± 18.50 | 352.02 ± 22.62 | 370.41 ± 20.59 | 0.296 |
| IL-1β (pg/mL) | 12.85 ± 0.68 | 11.80 ± 1.22 | 12.47 ± 0.95 | 0.093 |
| IL-4 (pg/mL) | 10.70 ± 1.32 | 10.13 ± 1.03 | 11.01 ± 1.28 | 0.294 |
| TNF-α (pg/mL) | 29.92 ± 0.78 | 26.61 ± 1.89 | 28.72 ± 3.68 | 0.158 |
| 21 d | ||||
| IgA (μg/mL) | 43.64 ± 5.23 | 41.81 ± 2.29 | 44.82 ± 4.78 | 0.414 |
| IgG (mg/mL) | 12.77 ± 1.22 b | 12.05 ± 1.05 b | 13.67 ± 0.81 a | 0.030 |
| IgM (μg/mL) | 342.1 ± 25.41 | 336.4 ± 18.36 | 353.64 ± 45.29 | 0.588 |
| IL-1β (pg/mL) | 12.66 ± 1.06 | 12.74 ± 1.43 | 12.41 ± 1.13 | 0.826 |
| IL-4 (pg/mL) | 9.21 ± 1.16 | 8.33 ± 0.40 | 9.47 ± 1.15 | 0.069 |
| TNF-α (pg/mL) | 28.71 ± 2.58 a | 25.93 ± 1.84 b | 30.05 ± 2.96 a | 0.021 |
| 28 d | ||||
| IgA (μg/mL) | 44.23 ± 3.30 b | 43.34 ± 2.58 b | 48.62 ± 2.62 a | 0.002 |
| IgG (mg/mL) | 12.85 ± 0.84 b | 12.56 ± 0.75 b | 14.66 ± 1.88 a | 0.006 |
| IgM (μg/mL) | 329.06 ± 38.01 | 323.43 ± 33.84 | 340.98 ± 22.26 | 0.770 |
| IL-1β (pg/mL) | 12.37 ± 2.06 | 12.51 ± 0.66 | 13.64 ± 1.25 | 0.207 |
| IL-4 (pg/mL) | 9.05 ± 0.75 ab | 8.62 ± 0.36 b | 9.65 ± 0.81 a | 0.016 |
| TNF-α (pg/mL) | 28.70 ± 2.13 a | 26.76 ± 1.80 b | 31.73 ± 2.49 a | 0.001 |
a, b Different superscripts within the same row indicate significant difference (p < 0.05), n = 10. House: house, Outdoor: outdoor, Polytunnel: polytunnel. IgA: immunoglobulin A; IgG: immunoglobulin G; IgM: immunoglobulin M; IL-1β: interleukin 1β; IL-4: interleukin 4; TNF-α: tumor necrosis factor α; d: day.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Xiao, J.; Guo, W.; Han, Z.; Xu, Y.; Xing, Y.; Phillips, C.J.C.; Shi, B. The Effects of Housing on Growth, Immune Function and Antioxidant Status of Young Female Lambs in Cold Conditions. Animals 2024, 14, 518. https://doi.org/10.3390/ani14030518
AMA Style
Xiao J, Guo W, Han Z, Xu Y, Xing Y, Phillips CJC, Shi B. The Effects of Housing on Growth, Immune Function and Antioxidant Status of Young Female Lambs in Cold Conditions. Animals. 2024; 14(3):518. https://doi.org/10.3390/ani14030518
Chicago/Turabian StyleXiao, Jin, Wenliang Guo, Zhipeng Han, Yuanqing Xu, Yuanyuan Xing, Clive J. C. Phillips, and Binlin Shi. 2024. "The Effects of Housing on Growth, Immune Function and Antioxidant Status of Young Female Lambs in Cold Conditions" Animals 14, no. 3: 518. https://doi.org/10.3390/ani14030518
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
