Next Article in Journal
Prevalence of Sex-Related Chromosomal Abnormalities in a Large Cohort of Spanish Purebred Horses
Next Article in Special Issue
Heterogeneity of Fish Taxonomic and Functional Diversity Evaluated by eDNA and Gillnet along a Mangrove–Seagrass–Coral Reef Continuum
Previous Article in Journal
Two Are Better Than One: Integrating Spatial Geometry with a Conspicuous Landmark in Zebrafish Reorientation Behavior
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 3
10.3390/ani13030538
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of the Endangered Siamese Bat Catfish (Oreoglanis siamensis Smith, 1933) in Doi Inthanon National Park Using Environmental DNA

by
Thanatrinan Rodpai
1,
Chatmongkon Suwannapoom
2,* and
Maslin Osathanunkul
1,3,*
1
Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand
2
School of Agriculture and Natural Resources, University of Phayao, Phayao 56000, Thailand
3
Research Center in Bioresources for Agriculture, Industry and Medicine, Chiang Mai University, Chiang Mai 50200, Thailand
*
Authors to whom correspondence should be addressed.
Animals 2023, 13(3), 538; https://doi.org/10.3390/ani13030538
Submission received: 13 September 2022 / Revised: 4 January 2023 / Accepted: 16 January 2023 / Published: 3 February 2023
(This article belongs to the Special Issue Environmental DNA for Biodiversity Assessment and Monitoring: Challenges and Perspectives)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Using traditional methods for surveying and monitoring Siamese bat catfish (Oreoglanis siamensis Smith, 1933), an endangered and endemic species in Thailand, is difficult. In this study, the eDNA-based method was used to confirm the O. siamensis habitat and its presence in the Doi Inthanon National Park, Chiang Mai, Thailand. Water samples were collected, and eDNA was analyzed by real-time PCR with species-specific primers. The eDNA of O. siamensis was detected in 12 samples out of 15 samples, inferring its distribution in the rivers of the Doi Inthanon National Park. The results showed that the eDNA-based approach can successfully detect O. siamensis in 300 mL turbid water samples. This information may be beneficial for the species management plan. The success of the eDNA-based method in O. siamensis detection indicates the usefulness of this method for rare species surveys in unfavorable environments.

Abstract

Siamese bat catfish (Oreoglanis siamensis Smith, 1993) has been listed as an endangered species, and its abundance has been severely declining due to habitat degradation and overfishing. To establish an appropriate management strategy, it is crucial to gain information about the distribution of this endangered species. As O. siamensis live under rocks in streams, detecting their presence is difficult. Recently, environmental DNA (eDNA)–based detection has been demonstrated to be a valid tool for monitoring rare species, such as O. siamensis. Therefore, this study developed an eDNA assay targeting a 160 bp fragment of the COI region to detect the presence of this species in its natural habitat. An amount of 300 mL of water samples (0.7 μm filtered) were collected from 15 sites in the Mae Klang sub-basin, where this fish species was visually detected at two locations. O. siamensis eDNA was detected at 12 of the 15 sites sampled with varying concentrations (0.71–20.27 copies/mL), including at the sites where this species was visually detected previously. The developed O. siamensis eDNA assay was shown to be effective for detecting the presence of this endangered species in the Klang Phat and Klang Rivers within the Doi Inthanon National Park.

1. Introduction

Siamese bat catfish (Oreoglanis siamensis Smith, 1993) is an endemic species that inhabits in streams in the Doi Inthanon National Park, Chiang Mai Province, Thailand. It has been listed as an endangered species (EN) on the IUCN Red List since 2013 [1]. Oreoglanis siamensis is one ecologically important species and can be used as an indicator of the integrity of the ecosystem as it lives in clear and swift-running water with high oxygen content, and it is very sensitive to chemicals [2,3,4]. Although it is registered as a protected species under the National Park Act in Thailand, over the past few years, O. siamensis abundance has been severely declining, with causes ranging from habitat loss to overfishing [5]. Therefore, an effective conservation plan is urgently required to preserve this species, once the risk of disappearance from these areas is high.
The study of population density and dispersion is an integral part of endangered species conservation [6,7,8]. It is essential to have information regarding species’ abundance and distribution to develop an appropriate management plan. Conventional fish survey approaches using capture-based sampling, such as electrofishing, seining, trapping, and netting, have traditionally provided accurate information for fisheries management and conservation [9]. However, these survey methods are time and labor-intensive and need the participation of several fisheries professionals, having limited sensitivity and detection biases [10,11,12]. In addition, conventional techniques can be destructive, interfering with the species and the environment. As a result, developing well-informed management decisions provided by these species’ distribution surveys is sometimes difficult [13,14]. As O. siamensis numbers are still in decline and there is difficulty in detecting specimens using conventional methods, a more powerful or sensitive detection approach could give a better chance to monitor this species and develop appropriate conservation plans.
Previous studies have demonstrated that fish environmental DNA (eDNA) can be detected in ponds [15,16], streams [17,18], rivers [19,20], and seas [21,22]. Recently, there has been growing circumstantial evidence that surveillance of endangered or difficult-to-detect species using eDNA-based detection can be advantageous (e.g., [23,24,25,26,27,28]). Environmental-DNA-based methods have been shown to be more sensitive and effective than traditional sampling techniques for detecting rare or elusive species [29,30]. Using eDNA-based detection approaches can overcome the limitations of traditional methods, particularly the detection bias, which can result in the absence of detection of target animals even if they are present [31]. Environmental DNA analysis also requires less sampling effort and can cost less than triple-pass electrofishing [12]. In addition, eDNA-based detection helps to minimize associated damage to endangered species and the environment [31,32].
Thus, in this study, an eDNA-based method was developed for monitoring O. siamensis in the Doi Inthanon National Park, Chiang Mai Province, Thailand, and the results were compared with historical visual detections of this species in the study area. This technique could be a reliable and cost-effective surveillance tool that can provide more robust and large-scale data to enable effective conservation and management devoted to O. siamensis.

2. Materials and Methods

2.1. Primers and Probe Development

Reference sequences from two mitochondrial loci, cytochrome oxidase subunit 1 gene (COI) and cytochrome b (Cytb), and two nuclear loci, 12S rRNA (12S) and 16S rRNA (16S), of related species were downloaded from GenBank (https://www.ncbi.nlm.nih.gov/genbank/ (accessed on 14 February 2020)), while sequences of the targeted species were generated as part of this study (Supplementary Table S1). Tissue samples of the three O. siamensis specimens were provided by the Department of Fisheries, Thailand (collected near the K7 site, Figure 1), and mucus samples collected from three specimens found at the KP1 site (Figure 1) were used for DNA extraction. Total DNA was extracted from the samples using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. COI and Cytb were then amplified and sequenced using LCO1490 and HCO2198 primers [33] and L1472 and H1514 primers [34], respectively. 12S and 16S were amplified and sequenced using 12Sa and 12Sb primers [35] and 16Sar and 16Sbr primers [35], respectively. All generated sequences were deposited in GenBank with the following accession numbers: MZ753673-78 for the COI region, MZ773400-05 for the Cytb region, and MZ766143 and MZ766142 for the 12S and 16S regions.
All sequences were aligned in MEGA X [36]. Primers were designed from the COI sequence as the Cytb, 12S, and 16S sequences did not have enough mismatches with the related species. Species-specific primers and a minor-groove binding (MGB) probe incorporating a 5′ FAM reporter dye and a 3′ nonfluorescent quencher were designed to amplify a 160 bp fragment (Table 1). Cross amplification of unrelated species was tested using Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 20 February 2020)) and BLASTn (Basic Local Alignment Search Tool) (Table 2). The designed primers and probe were also tested for amplification of targeted species and for cross amplification with closely related (O. colurus and O. vicinus) and nontarget species, including Barbonymus gonionotus, Channa aurolineatus, C. micropeltes, C. striata, Chitala ornata, Ceratogarra cambodgiensis, Hypsibarbus malcolmi, Labiobarbus spilopleura, Pangasianodon gigas, P. hypophthalmus, Pangasius bocourti, P. larnaudii, Probarbus jullieni, and Puntioplites proctozysron.

2.2. Study Sites

Oreoglanis siamensis are currently located in the Klang Phat River and Klang River in the Doi Inthanon National Park, Chiang Mai, Thailand (Figure 1), according to physical captures by local people and visual detection. The species live in shaded areas of highland streams, on the bottom of cool, clear, and fast-flowing streams with pebbles and stones. Based on the behavior and habitat preference of the target species and its visual detection and local accessibility, 15 sampling sites were selected for water samplings (Figure 1 and Supplementary Table S2). Surveys were performed once a year (2019–2021). Samples were collected in and beyond the currently known distribution boundaries of O. siamensis in the Doi Inthanon National Park. This research was conducted under the permission of the Department of National Parks, Wildlife, and Plant Conservation, Ministry of Natural Resources and Environment, Thailand, and the Department of Fisheries, Ministry of Agriculture and Cooperatives, Thailand.

2.3. Water Sampling and eDNA Extraction

Three surface water samples (300 mL) from each site were collected in previously decontaminated buckets (10% bleach rinse, followed by two distilled water rinses) while wearing gloves that were changed between sites to prevent cross contamination.
Water samples were immediately filtered in the field using a 50 mL sterile BD Luer-Lok™ Syringe (BD, Franklin Lakes, NJ, USA) with a 0.7 μm filter (Whatman International Ltd., Maidstone, UK). Negative controls were assessed on each sampling day by filtering 300 mL of deionized water. Each filter was then put in a 1.5 mL microcentrifuge tube and placed in a storage box containing dry ice. The storage box was transported to the laboratory and stored at −20 °C.
Environmental DNA contained in each filter was extracted using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) with a slight modification to the protocol from the manufacturer’s protocol following Osathanunkul and Minamoto (2020 and 2021) [37,38]. To remove any inhibitors, all DNA samples were cleaned up using the OneStep PCR Inhibitor Removal Kit (Zymo Research, Irvine, CA, USA) [37,38,39] following the manufacturer’s protocol and stored at −20 °C until further analyses.

2.4. qPCR Assay

The qPCR assay was performed following Osathanunkul and Minamoto (2020 and 2021) [37,38]. Briefly, each eDNA qPCR amplification was carried out in five replicates per site per sampling year at a final volume of 20 μL using 2.0 μL of DNA template, 10.0 μL of 2× TaqMan Environmental Master Mix 2.0 (Thermo Fisher Scientific, Waltham, MA, USA), 900 nM each of the F/R primers, and 125 nM of the probe. Samples were run using Rotor-Gene Q (Qiagen, Hilden, Germany) under the following conditions: a 10 min initial incubation at 95 °C, followed by 55 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. Positive (gDNA) and no template (Milli-Q water) controls were included on each qPCR assay plate. MIQE guidelines were consulted to ensure that all information relevant to presence/absence eDNA assays was reported. Positive detections were confirmed by sequencing of the amplicons (Celemics, Inc., Seoul, Korea). The copies/mL values for O. siamensis eDNA concentrations were reported. A standard dilution series of synthesized target gene fragments (Integrated DNA Technologies Pte. Ltd., Singapore) with known copy numbers was used to generate a standard curve and measure detection and quantification limits [26,28]. With 12 technical replicates used for each dilution step, the standard concentrations were adjusted to 12,500, 1250, 125, 12.50, 1.25, and 0.125 copies/mL. The efficiency for the qPCR assay was 99% (y = −3.318x + 42.784; R2 = 0.99). This regression equation was used to convert the quantification cycle data from the qPCR product (i.e., the PCR cycle at which the target is considered positively amplified in a given sample) into the DNA concentration in a particular sample, for example, [40,41]. Both DNA extract from the mucus of O. siamensis and the synthesized fragment were used as positive controls.

2.5. Fish Population

Sequences of four DNA regions, including COI (651 bp), Cytb (432 bp), 12S (331 bp), and 16S (525 bp), were generated from DNA extracted from tissue and mucus samples of O. siamensis collected from the Klang Phat River (KP1) and Klang River (K7). The sequences were aligned using MEGA X to compare the differences in fish population from those two rivers.

3. Results

3.1. Specificity of Designed Primers and Probe

Partial COI region sequences of O. siamensis were generated and deposited in GenBank. The specific primers and probe were designed based on sequences generated in this study and retrieved from GenBank. A 160 bp DNA fragment specific to O. siamensis with the designed primer pair was successfully amplified. To determine primer specificity, primer pairs were tested in silico (MEGA X) and in vitro (PCR and qPCR) [42,43]. The designed primers were found to be specific to O. siamensis, as no amplification was found with other tested species.

3.2. eDNA Detection at Sampling Sites

Positive eDNA detections for O. siamensis were observed at 12 sites with varying concentrations (Table 3). The positive detections were confirmed by sequencing of the amplicons (Supplementary Table S3). The highest average eDNA concentration was 20.27 copies/mL at the KP1 site, while the lowest was found at K4 (0.71 copies/mL). No O. siamensis eDNA was detected in three sites (K3, K6, and K11). No O. siamensis eDNA was detected in any of the negative control samples. In this study, the eDNA was detected at all sites where the target species was visually observed during this and a previous study [4].

3.3. qPCR Assay Sensitivity

The detection limit (LD) with a 95% confidence interval and the quantification limit (LQ) with a threshold of 35% were used to represent the sensitivity of the qPCR analysis. The qPCR assay of O. siamensis had an LD of 0.48 copies/mL and an LQ of 0.48 copies/mL.

3.4. Fish Population

As the eDNA of O. siamensis was detected in both the Klang Phat River and Klang River, we wanted to confirm whether the fish inhabiting both rivers belong to the same population. Performed analyses indicated no differences between samples collected from the Klang Phat and Klang Rivers for the COI, Cytb, and 16S regions and only 1 bp difference in the 12S region (Supplementary Figure S1).

4. Discussion

In the current study, a primer–probe set targeting an amplified product size of 160 bp for eDNA detection of O. siamensis was successfully developed, and the specificity of the primers for this species was confirmed both by in silico and in vitro analyses [44,45]. Although some studies suggest that short amplified fragments (≤150 bp) result in more successful amplification of degraded DNA, for example, [19,46,47,48,49], others found that the target amplicon size has no effect on eDNA detection, for example, [50,51,52]. Nonetheless, the amplicon size may affect the difference in eDNA detection between lotic and lentic systems, whose shorter target product might be better for samples collected from rivers or streams [51].
In this study, the COI assay can successfully amplify the COI region of the O. siamensis eDNA. Moreover, it is one of the commonly used markers for targeted species detection from eDNA, which shows high levels of conservation within species and decreased levels of genetic variation among different species. It is also typically used as a highly effective species barcode for fish identification [53]. In other studies, the COI region was successfully used for species detection, such as Galaxiella pusilla [16], Anoxypristis cuspidata [51], and Salmo salar [52]. However, the marker selection relied on the availability of sequences representing barcode regions [54].
The eDNA analysis in this study was in agreement with previously reported visual observations in that eDNA detection was positive at the sites where O. siamensis was previously reported (KP1, KP2, K7, and K9). A previous study by Ng and Rainboth (2001) reported that O. siamensis was also detected in Wachirathan Waterfall, Doi Inthanon National Park, Chiang Mai, Thailand, [4] at the K9 sampling site (Figure 1). A higher concentration of the O. siamensis eDNA was found at three sites, including KP1, KP2, and KP4. On the other hand, the eDNA concentration was lower at the other sites due to the lower species abundance, which might lead to the occurrence of false negatives [55,56,57]. Several factors play a role in eDNA detection error (false negative), such as insufficient assay sensitivity to detect a target eDNA, numerous freeze-thawing, and long-term storage of samples [12,58]. Some researchers suggest that false negatives could be overcome by increasing the filtering water volume or using multiple filters [59,60]. A previous study reported that eDNA detection rates in streams were increased by filtering 1–2 L of water [61,62]. Filtering a larger amount of water using a larger pore size may be the simplest technique to boost detection in systems with poor overall detection rates [63,64,65]. However, in several studies that collected turbid water samples, volumes of less than 300 mL were successfully used, for example, [12,51,66,67]. In this study, a 300 mL filtered water volume is potentially too low to have captured very low abundant eDNA of the target species in 3/15 sites (K3, K6, and K11). Therefore, the consistency of nondetection at these 3/15 sites across all 3 sampling years (2019–2021) suggests that target species abundance is either very low or actually absent from these sites (i.e., unable to conclusively determine whether these are actually false negatives due to low abundance or true negatives).
For turbid water samples, filtering a large volume of water using filters with a small pore size (e.g., <1 μM) is very difficult because of clogging (Figure 2). Thus, in this study, 300 mL was the maximum volume used for sample filtration due to the water turbidity. Another factor that should be considered when dealing with eDNA detection is eDNA transportation in lotic ecosystems, as it might have an effect not only on estimating the presence of species but also on the geographical dispersion of aquatic animals. Stream flow decreases DNA concentration by dilution and dispersion effects, making it more difficult to detect the eDNA especially of low abundance species. Nukazawa et al. (2018) suggested that in case of low abundance target species, the survey should predict the detectable distance and study the characteristics of the target sampling source [68]. To increase the concentration of the eDNA, riverbed sediment should be collected as described by Turner et al. (2015), suggesting that its eDNA concentration is higher when compared with surface water [65]. Moreover, DNA concentrations in streams and rivers are directly influenced by the equilibrium between DNA entering and leaving the system as well as downstream flow [69,70]. However, we suggest that future studies should be concerned about other factors that can affect the eDNA concentration, including transportation [71], DNA degradation [72], dynamics in rivers [73], and abundance of target species [18], to improve the sampling design. Variations in river size, flow, and structure also affect the eDNA transportation; therefore, estimating average transport distances at each sampling location could help improve sample quality [70].
An eDNA-based tool for O. siamensis detection was successfully developed in this study. To minimize further loss of the species, the effects of anthropogenic disturbance on its population is another question that needs to be addressed [74]. Environmental DNA has the ability to fill in the blanks and might give answers to this issue. Notably, O. siamensis have been declining markedly, with reasons ranging from habitat degradation to locals catching the fish for food. Thus, they are protected by law along with 25 other fish species in Thailand. Their habitats are in areas where the National Park Act has been in action, so that hunting animals or catching fish is strictly prohibited. A lack of knowledge or awareness that some species that inhabit the rivers within the Doi Inthanon National Park (e.g., fish) are rare and endemic and, thus, need to be conserved could lead to failure to protect them. Improving knowledge and local awareness of the decline of endangered fish populations can benefit the conservation management in key areas (e.g., national parks). The eDNA assay developed in this study can be utilized by government agencies and local communities to develop an effective species management plan and raise awareness about O. siamensis conservation.

5. Conclusions

Here, a COI-targeting eDNA-based assay was successfully used to confirm the presence of the endangered O. siamensis in both the Klang Phat and the Klang River of the Doi Inthanon National Park. This study demonstrates that eDNA surveys for O. siamensis provide an easy, fast, and sensitive way to monitor this endangered species.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13030538/s1, Figure S1: Sequence alignments of O. siamensis from the Klang and Klang Phat rivers; Table S1: GenBank accession numbers of species were used for primer design in this study; Table S2: Geographic coordinates of the sampling sites; Table S3: Overview of sequence alignments (160 bp) between positive qPCR amplicons from eDNA assays and O. siamensis gDNA sequence. One eDNA amplicon was randomly selected for sequencing from each sampling site for each sampling year (gray highlighted).

Author Contributions

M.O. conceived the project and designed the experiments. C.S., M.O. and T.R. collected samples. M.O. and T.R. performed the experiments and analyzed the data. M.O. and C.S. participated in data interpretation, discussed the experiment, and revised the manuscript. M.O. and T.R. wrote the draft manuscript. C.S., M.O. and T.R. prepared the figures. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Chiang Mai University.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Animal Care and Use (Laboratory Animal Center of Chiang Mai University) review (protocol code 2561/FA-0001 of 24 February 2018). Research was conducted under the Department of National Parks, Wildlife, and Plant Conservation, Ministry of Natural Resources and Environment, Thailand (DNP Permit No. 0907.4/18262 of 31 August 2020) and the Department of Fisheries, Ministry of Agriculture and Cooperatives, Thailand (DOF Permit No. 0510.5/3686 of 7 June 2021).

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated and/or analyzed during the current study are available in the GenBank repository (accession numbers were provided in Supplementary Tables S1 and S3).

Acknowledgments

This study was supported by the Faculty of Sciences, Chiang Mai University, Chiang Mai, Thailand. We thank Chavalit Vidthayanon and Amornchai Lothongkhamd for providing information of the fish. Special thanks go to the Department of Fisheries for providing the tissue samples. Our thanks also go to the Unit of Excellence 2023 on the integrative diversity assessment of aquatic animals and herpetology from Thailand (FF66-UoE003). We are truly thankful to Lauren R. Clark for the English editing.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Vidthayanon, C. Oreoglanis siamensis. The IUCN Red List of Threatened Species 2013: E.T15459A4587978. Available online: https://doi.org/10.2305/IUCN.UK.2011-1.RLTS.T15459A4587978.en (accessed on 23 November 2020).
  2. Smith, H.M. Contributions to the ichthyology of Siam. II–VI. Journal of the Siam Society. Nat. Hist. Suppl. 1993, 9, 53–87. [Google Scholar]
  3. Ng, H.H.; Kottelat, M. Oreoglanis hypsiurus, a new species of glyptosternine catfish (Teleostei: Sisoridae). Ichthyol. Explor. Freshw. 1999, 10, 375–380. [Google Scholar]
  4. Ng, H.H.; Rainboth, W.J. A review of the sisorid catfish genus Oreoglanis (Siluriformes: Sisoridae) with descriptions of four new species. Occas. Pap. Mus. Zoo. Univ. Mich. 2001, 732, 1–34. [Google Scholar]
  5. Vidthayanon, C. Thailand Red Data: Fishes; Office of Natural Resources and Environmental Policy and Planning: Bangkok, Thailand, 2005; p. 61. [Google Scholar]
  6. Cobos, M.; Bosch, R.A. Breeding sites of a narrowly distributed amphibian, a key element in its conservation in the face of global change. Aquat. Conserv. 2018, 28, 1089–1098. [Google Scholar] [CrossRef]
  7. Boon, P.; Cooksley, S.; Geist, J.; Killeen, I.; Moorkens, E.; Sime, I. Developing a standard approach for monitoring freshwater pearl mussel (Margaritifera margaritifera) populations in European rivers. Aquat. Conserv. 2019, 29, 1365–1379. [Google Scholar] [CrossRef]
  8. Akamatsu, Y.; Kume, G.; Goto, M.; Kono, T.; Fujii, T.; Inui, R.; Kurita, Y. Using environmental DNA analyses to assess the occurrence and abundance of the endangered amphidromous fish Plecoglossus altivelis ryukyuensis. Biodivers. Data J. 2020, 8, e39679. [Google Scholar] [CrossRef] [PubMed]
  9. Portt, C.B.; Coker, G.A.; Ming, D.L.; Randall, R.G. A review of fish sampling methods commonly used in Canadian freshwater habitats. Can. Tech. Rep. Fish. Aquat. Sci. 2006, 2604, 1–41. [Google Scholar]
  10. Bonar, S.A.; Hubert, W.A.; Willis, D.W. Standard Methods for Sampling North American Freshwater Fishes; American Fisheries Society: Bethesda, MD, USA, 2009; pp. 195–197. [Google Scholar]
  11. Bylemans, J.; Furlan, E.M.; Pearce, L.; Daly, T.; Gleeson, D.M. Improving the containment of a freshwater invader using environmental DNA (eDNA) based monitoring. Biol. Invasions. 2016, 8, 3081–3089. [Google Scholar] [CrossRef]
  12. Evans, N.T.; Shirey, P.D.; Wieringa, J.G.; Mahon, A.R.; Lamberti, G.A. Comparative cost and effort of fish distribution detection via environmental DNA analysis and electrofishing. Fisheries 2017, 42, 90–99. [Google Scholar] [CrossRef]
  13. Campbell, S.P.; Clark, J.A.; Crampton, L.H.; Guerry, A.D.; Hatch, L.T.; Hosseini, P.R.; Lawler, J.J.; O’Connor, R.J. An assessment of monitoring efforts in endangered species recovery plans. Ecol. Appl. 2009, 12, 674–681. [Google Scholar] [CrossRef]
  14. Britton, J.R.; Pegg, J.; Gozlan, R.E. Quantifying imperfect detection in an invasive pest fish and the implications for conservation management. Biol. Conserv. 2011, 144, 2177–2181. [Google Scholar] [CrossRef]
  15. Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Wiuf, C.; Rasmussen, M.; Gilbert, M.T.P.; Orlando, L.; Willerslev, E. Monitoring endangered freshwater biodiversity using environmental DNA. Mol. Ecol. 2012, 21, 2565–2573. [Google Scholar] [CrossRef]
  16. Davison, P.I.; Copp, G.H.; Créach, V.; Vilizzi, L.; Britton, J.R. Application of environmental DNA analysis to inform invasive fish eradication operations. Sci. Nat. 2017, 104, 35. [Google Scholar] [CrossRef]
  17. Carraro, L.; Mächler, E.; Wüthrich, R.; Altermatt, F. Environmental DNA allows upscaling spatial patterns of biodiversity in freshwater ecosystems. Nat. Commun. 2020, 11, 3585. [Google Scholar] [CrossRef]
  18. Doi, H.; Inui, R.; Akamatsu, Y.; Kanno, K.; Yamakana, H.; Takahara, T.; Minamoto, T. Environmental DNA analysis for estimating the abundance and biomass of stream fish. Freshw. Biol. 2016, 62, 30–39. [Google Scholar] [CrossRef]
  19. Robson, H.L.A.; Noble, T.H.; Saunders, R.J.; Robson, S.K.A.; Burrows, D.W.; Jerry, D.R. Fine-tuning for the tropics: Application of eDNA technology for invasive fish detection in tropical freshwater ecosystems. Mol. Ecol. Resour. 2016, 16, 922–932. [Google Scholar] [CrossRef]
  20. Hinlo, R.; Furlan, E.; Suitor, L.; Gleeson, D. Environmental DNA monitoring and management of invasive fish: Comparison of eDNA and fyke netting. Manag. Biol. Invasions. 2016, 8, 89–100. [Google Scholar] [CrossRef]
  21. Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J.Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; et al. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: Detection of more than 230 subtropical marine species. R. Soc. Opensci. 2015, 2, 150088. [Google Scholar] [CrossRef] [PubMed]
  22. Thomsen, P.F.; Møller, P.R.; Sigsgaard, E.E.; Knudsen, S.W.; Jørgensen, O.A.; Willerslev, E. Environmental DNA from seawater samples correlate with trawl catches of subarctic, Deepwater fishes. PLoS ONE 2016, 11, e0165252. [Google Scholar] [CrossRef]
  23. Qu, C.; Stewart, K.A. Evaluating monitoring options for conservation: Comparing traditional and environmental DNA tools for a critically endangered mammal. Sci. Nat. 2019, 106, 9. [Google Scholar] [CrossRef]
  24. Robinson, A.T.; Paroz, Y.M.; Clement, M.J.; Frankli, T.W.; Dysthe, J.C.; Young, M.K.; Mckevey, K.S.; Carim, K.J. Environmental DNA sampling of small-bodied minnows: Performance relative to location, species, and traditional sampling. N. Am. J. Fish. Manag. 2019, 39, 1073–1085. [Google Scholar] [CrossRef]
  25. Jeunen, G.J.; Urbam, L.; Lewis, R.; Knapp, M.; Lamare, M.; Rayment, W.; Dawson, S.; Gemmell, N. Marine environmental DNA (eDNA) for biodiversity assessments: A one-to-one comparison between eDNA and baited remote underwater video (BRUV) surveys. Authorea 2020, 1, 486941. [Google Scholar] [CrossRef]
  26. Osathanunkul, M. An eDNA detection of captive-bred Mekong giant catfish in the Chao Phraya River basin for further environmental impacts assessment. Aquaculture 2022, 546, 737328. [Google Scholar] [CrossRef]
  27. Piggott, M.P.; Banks, S.C.; Broadhurst, B.T.; Fulton, C.J.; Lintermans, M. Comparison of traditional and environmental DNA surveymethods for detecting rare and abundant freshwater fish. Aquat. Conserv. 2021, 31, 173–184. [Google Scholar] [CrossRef]
  28. Osathanunkul, M.; Minamoto, T. eDNA-based detection of a vulnerable crocodile newt (Tylototriton uyenoi) to influence government policy and raise public awareness. Divers. Distrib. 2021, 27, 1958–1965. [Google Scholar] [CrossRef]
  29. Janosik, A.M.; Johnston, C.E. Environmental DNA as an effective tool for detection of imperiled fishes. Environ. Biol. Fish. 2015, 98, 1889–1893. [Google Scholar] [CrossRef]
  30. Sigsgaard, E.E.; Carl, H.; Møller, P.R.; Thomsen, P.F. Monitoring the near-extinct European weather loach in Denmark based on environmental DNA from water samples. Biol. Conserv. 2015, 183, 46–52. [Google Scholar] [CrossRef]
  31. Simpfendorfer, C.A.; Kyne, P.M.; Noble, T.H.; Goldsbury, J.; Basiita, R.K.; Lindsay, R.; Shields, A.; Perry, C.; Jerry, D.R. Environmental DNA detects critically endangered largetooth sawfish in the wild. Endanger. Species Res. 2016, 30, 109–116. [Google Scholar] [CrossRef]
  32. Belle, C.C.; Stoeckle, B.C.; Geist, J. Taxonomic and geographical representation of freshwater environmental DNA research in aquatic conservation. Aquat. Conserv. 2019, 29, 1996–2009. [Google Scholar] [CrossRef]
  33. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  34. Linacre, A.; Lee, J. Species determination: The role and use of the cytochrome b gene. Methods. Mol. Biol. 2005, 297, 45–52. [Google Scholar]
  35. Finizio, A.D.; Guerriero, G.; Russo, G.L.; Ciarcia, G. Identification of gadoid species (Pisces, Gadidae) by sequencing and PCR-RFLP analysis of mitochondrial 12S and 16S rRNA gene fragments. Eur. Food Res. Technol. 2007, 225, 337–344. [Google Scholar] [CrossRef]
  36. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  37. Osathanunkul, M.; Minamoto, T. A molecular survey based on eDNA to assess the presence of a clown featherback (Chitala ornata) in a confined environment. PeerJ 2020, 8, e10338. [Google Scholar] [CrossRef] [PubMed]
  38. Osathanunkul, M.; Minamoto, T. Molecular detection of giant snakeheads, Channa micropeltes (Cuvier, 1831), one of the most troublesome fish species. Sci. Rep. 2021, 11, 9943. [Google Scholar] [CrossRef] [PubMed]
  39. Osathanunkul, M.; Madesis, P. Environmental DNA detection of giant snakehead in Thailand’s major rivers for wild stock assessment. PLoS ONE 2022, 17, e0267667. [Google Scholar] [CrossRef]
  40. Gysin, G.; Urbano, P.; Brandner-Garrod, L.; Begum, S.; Kristan, M.; Walker, T.; Hernández, C.; Ramírez, J.D.; Messenger, L.A. Towards environmental detection of Chagas disease vectors and pathogen. Sci. Rep. 2022, 12, 9849. [Google Scholar] [CrossRef] [PubMed]
  41. Jørgensen, L.V.G.; Nielsen, J.W.; Villadsen, M.K.; Vismann, B.; Dalvin, S.; Mathiessen, H.; Madsen, L.; Kania, P.W.; Buchmann, K. A non-lethal method for detection of Bonamia ostreae in flat oyster (Ostrea edulis) using environmental DNA. Sci. Rep. 2020, 10, 16143. [Google Scholar] [CrossRef] [PubMed]
  42. Goldberg, C.S.; Turner, C.R.; Deiner, K.; Klymus, K.E.; Thomsen, P.F.; Murphy, M.A.; Spear, S.F.; McKee, A.; Oyler-McCance, S.J.; Cornman, R.S.; et al. Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol. Evol. 2016, 7, 1299–1307. [Google Scholar] [CrossRef]
  43. Edmunds, R.C.; Burrows, D. Got Glycogen?: Development and multispecies validation of the novel preserve, precipitate, lyse, precipitate, purify (PPLPP) workflow for environmental DNA extraction from Longmire’s preserved water samples. J. Biomol. Tech. 2020, 31, 125–150. [Google Scholar] [CrossRef]
  44. Foote, A.D.; Thomsen, P.F.; Sveegaard, S.; Wahberg, M.; Kielglast, J.; Kyhn, L.A.; Salling, A.B.; Galatius, A.; Orlando, L.; Gilbert, M.T.P. Investigating the potential use of environmental DNA (eDNA) for genetic monitoring of marine mammals. PLoS ONE 2012, 7, e41781. [Google Scholar] [CrossRef] [PubMed]
  45. Egan, S.P.; Bernes, M.A.; Hwang, C.; Mahon, A.R.; Feder, J.L.; Ruggiero, S.T.; Tanner, C.E.; Lodge, D.M. Rapid invasive species detection by combining environmental DNA with light transmission spectroscopy. Conserv. Lett. 2013, 6, 402–409. [Google Scholar] [CrossRef]
  46. Takahara, T.; Minamoto, T.; Doi, H. Using environmental DNA to estimate the distribution of an invasive fish species in ponds. PLoS ONE 2013, 8, e56584. [Google Scholar] [CrossRef]
  47. Deiner, K.; Walser, J.; Mächler, E.; Altermatt, F. Choice of capture and extraction methods affect detection of freshwater biodiversity from environmental DNA. Biol. Conserv. 2015, 183, 53–63. [Google Scholar] [CrossRef]
  48. Gingera, T.D.; Steeves, T.B.; Boguski, D.A.; Whyard, S.; Li, W.; Docker, M.F. Detection and identification of lampreys in Great Lakes streams using environmental DNA. J. Great Lakes Res. 2016, 42, 649–659. [Google Scholar] [CrossRef]
  49. Piggott, M.P. Evaluating the effects of laboratory protocols on eDNA detection probability for an endangered freshwater fish. Ecol. Evol. 2016, 6, 2739–2750. [Google Scholar] [CrossRef]
  50. Tingley, R.; Coleman, R.; Gecse, N.; van Rooyen, A.R.; Weeks, A. Accounting for false positive detections in occupancy studies based on environmental DNA: A case study of a threatened freshwater fish (Galaxiella pusilla). Environ. DNA 2021, 3, 388–397. [Google Scholar] [CrossRef]
  51. Sani, L.M.I.; Husna, A.K.; Subhan, B.; Madduppa, H. Environmental DNA (eDNA) reveals endangered narrow sawfish across Indonesian Reefs. IOP Conf. Ser. Earth Environ. Sci. 2021, 944, 012020. [Google Scholar] [CrossRef]
  52. Bingpeng, X.; Heshan, L.; Zhilan, Z.; Chunguang, W.; Yanguo, W.; Jianjun, W. DNA barcoding for identification of fish species in the Taiwan Strait. PLoS ONE 2018, 13, e0198109. [Google Scholar] [CrossRef]
  53. Atkinson, S.; Carlsson, J.E.L.; Ball, B.; Egan, D.; Kelly-Quinn, M.; Whelan, K.; Carlsson, J. A quantitative PCR-based environmental DNA assay for detecting Atlantic salmon (Salmo salar L.). Aquat. Conserv. 2018, 28, 1238–1243. [Google Scholar] [CrossRef]
  54. Freeland, J.R. The importance of molecular markers and primer design when characterizing biodiversity from environmental DNA. Genome 2017, 60, 358–374. [Google Scholar] [CrossRef]
  55. Harper, L.R.; Handley, L.L.; Hahn, C.; Boonham, N.; Rees, H.C.; Gough, K.C.; Lewis, E.; Adams, I.; Brotherton, P.; Philips, S.; et al. Needle in a haystack? A comparison of eDNA metabarcoding and targeted qPCR for detection of the great crested newt (Triturus cristatus). Ecol. Evol. 2018, 8, 6330–6341. [Google Scholar] [CrossRef] [PubMed]
  56. Hunter, M.E.; Ferrante, J.A.; Meigs-Friend, G.; Ulmer, A. Improving eDNA yield and inhibitor reduction through increased water volumes and multi-filter isolation techniques. Sci. Rep. 2019, 9, 52–59. [Google Scholar] [CrossRef] [PubMed]
  57. Takahara, T.; Minamoto, T.; Doi, H. Effects of sample processing on the detection rate of environmental DNA from the Common Carp (Cyprinus carpio). Biol. Conserv. 2015, 183, 64–69. [Google Scholar] [CrossRef]
  58. Govindarajan, A.F.; McCartin, L.; Adams, A.; Allan, E.; Belani, A.; Francolini, R.; Fujii, J.; Gomez-Ibañez, D.; Kukulya, A.; Marin, F.; et al. Improved biodiversity detection using a large-volume environmental DNA sampler with in situ filtration and implications for marine eDNA sampling strategies. Deep Sea Res. I Oceanogr. Res. Pap. 2022, 189, 103871. [Google Scholar] [CrossRef]
  59. Mächler, E.; Deiner, K.; Steinmann, P.; Altermatt, F. Utility of environmental DNA for monitoring rare and indicator macroinvertebrate species. Freshw. Sci. 2014, 33, 1174–1183. [Google Scholar] [CrossRef]
  60. Bedwell, M.E.; Goldberg, C.S. Spatial and temporal patterns of environmental DNA detection to inform sampling protocols in lentic and lotic systems. Ecol. Evol. 2020, 10, 1602–1612. [Google Scholar] [CrossRef] [PubMed]
  61. Schultz, M.T.; Lance, R.F. Modeling the sensitivity of field surveys for detection of environmental DNA (eDNA). PLoS ONE 2015, 10, e0141503. [Google Scholar] [CrossRef] [PubMed]
  62. Mächler, E.; Deiner, K.; Spahn, F.; Altermatt, F. Fishing in the water: Effect of sampled water volume on environmental DNA-based detection of macroinvertebrates. Environ. Sci. Technol. 2016, 50, 305–312. [Google Scholar] [CrossRef]
  63. Renshaw, M.A.; Olds, B.P.; Jerde, C.L.; McVeigh, M.M.; Lodge, D.M. The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol-chloroform-isoamyl alcohol DNA extraction. Mol. Ecol. Resour. 2015, 15, 168–176. [Google Scholar] [CrossRef]
  64. Davison, P.I.; Créach, V.; Liang, W.J.; Andreou, D.; Britton, J.R.; Copp, G.H. Laboratory and field validation of a simple method for detecting four species of non-native freshwater fish using eDNA. J. Fish Biol. 2016, 89, 1782–1793. [Google Scholar] [CrossRef]
  65. Turner, C.R.; Uy, K.L.; Everhart, R.C. Environmental DNA Fish Environmental DNA Is More Concentrated in Aquatic Sediments than Surface Water. Biol. Conserv. 2015, 183, 93–102. [Google Scholar] [CrossRef]
  66. Kamoroff, C.; Goldberg, C.S. An issue of life or death: Using eDNA to detect viable individuals in wilderness restoration. Freshw. Sci. 2018, 37, 685–696. [Google Scholar] [CrossRef]
  67. Turner, C.R.; Barnes, M.A.; Xu, C.C.Y.; Jones, S.E.; Jerde, C.L.; Lodge, D.M. Particle size distribution and optimal capture of aqueousmacrobial eDNA. Methods Ecol. Evol. 2014, 5, 676–684. [Google Scholar] [CrossRef]
  68. Nukazawa, K.; Hamasuna, Y.; Suzuki, Y. Simulating the Advection and Degradation of the Environmental DNA of Common Carp along a River. Environ. Sci. Technol. 2018, 52, 10562–10570. [Google Scholar] [CrossRef] [PubMed]
  69. Curtis, A.N.; Tiemann, J.S.; Douglass, S.A.; Davis, M.A.; Larson, E.R. High stream flows dilute environmental DNA (eDNA) concentrations and reduce detectability. Divers. Distrib. 2020, 27, 1918–1931. [Google Scholar] [CrossRef]
  70. Harrison, J.B.; Sunday, J.M.; Rogers, S.M. Predicting the fate of eDNA in the environment and implications for studying biodiversity. Proc. R. Soc. B 2019, 286, 20191409. [Google Scholar] [CrossRef] [PubMed]
  71. Fremier, A.K.; Strickler, K.M.; Parzych, J.; Powers, S.; Goldberg, C.S. Stream Transport and Retention of Environmental DNA Pulse Releases in Relation to Hydrogeomorphic Scaling Factors. Environ. Sci. Technol. 2019, 53, 6640–6649. [Google Scholar] [CrossRef] [PubMed]
  72. Dejean, T.; Valentini, A.; Duparc, A.; Pellier-Cuit, S.; Pompanon, F.; Taberlet, P.; Miaud, C. Persistence of Environmental DNA in Freshwater Ecosystems. PLoS ONE 2011, 6, e23398. [Google Scholar] [CrossRef]
  73. Jane, S.F.; Wilcox, T.; McKelvey, K.; Young, M.K.; Schwartz, M.K.; Lowe, W.H.; Letcher, B.H.; Whiteley, A.R. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams. Mol. Ecol. Resour. 2015, 15, 216–227. [Google Scholar] [CrossRef] [PubMed]
  74. Barlow, J.; Lennox, G.; Ferreira, J.; Berenguer, E.; Lees, A.C.; Nally, R.M.; Thomson, J.R.; de Barros Ferraz, S.F.; Louzada, J.; Oliveira, V.H.F.; et al. Anthropogenic disturbance in tropical forests can double biodiversity loss from deforestation. Nature 2016, 535, 144–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Animals 13 00538 g001 550
Figure 1. Locations of the sampling sites with indication of previous visual observation. (A) Map of Thailand, (B) a general map of the Doi Inthanon National Park with details of the Klang Phat River and Klang River, (C) location of the sampling sites (N = 15) and visual detection of the target species in this study (N = 2) across the Klang Phat River and Klang River in the Doi Inthanon National Park, Chiang Mai, Thailand.
Figure 1. Locations of the sampling sites with indication of previous visual observation. (A) Map of Thailand, (B) a general map of the Doi Inthanon National Park with details of the Klang Phat River and Klang River, (C) location of the sampling sites (N = 15) and visual detection of the target species in this study (N = 2) across the Klang Phat River and Klang River in the Doi Inthanon National Park, Chiang Mai, Thailand.
Animals 13 00538 g001
Animals 13 00538 g002 550
Figure 2. Turbid water at sampling sites. (A) KP4 from the Klang Phat River and (B) K11 from the Klang River.
Figure 2. Turbid water at sampling sites. (A) KP4 from the Klang Phat River and (B) K11 from the Klang River.
Animals 13 00538 g002
Table
Table 1. Species-specific primers and probe designed to amplify a 160 bp fragment of the COI region of O. siamensis.
Table 1. Species-specific primers and probe designed to amplify a 160 bp fragment of the COI region of O. siamensis.
Primer NameTypeLength (bp)Primer Sequence 5′–3′Amplicon Size
Osi 434 COI-FForward23CCTTGCAGGTGTATCGTCTATTC160 bp
Osi 576 COI-RReverse19AGCTGCCAAGACTGGTAGT
Osi COI-PRProbe27CCTCCAGCAATTTCCCAATACCAAACC
Table
Table 2. Homology of the query to the primers and probe and percentage identity as a function of the number of matching base sites divided by 69 (total number of base sites across the primer pair and probe). The base site homology between the query and the primer is shown as a dot.
Table 2. Homology of the query to the primers and probe and percentage identity as a function of the number of matching base sites divided by 69 (total number of base sites across the primer pair and probe). The base site homology between the query and the primer is shown as a dot.
SpeciesForwardReverseProbeIdentity (%)Accession Number
Oreoglanis siamensis·····································································100MZ753672
Oreoglanis insignis·········G············T···G······C·A··T··C··C········C··A········G···84DQ508082
Oreoglanis sp.·········A·····A··C···················T··C··C········C···············90DQ846711
Oreoglanis immaculatus······G··G··G·········T···G··C···C····T··C··C··G·····C··A··G········T78JQ859840
Pareuchiloglanis anteanalisT········A·····A········T········C·A··T··C··C··T·····C··G············82DQ508085
Pareuchiloglanis sinensisT········A·····A········T········C·A··T··C··C··T·····C··G············82MF122630
Pseudexostoma yunnanenseT········G·C···A·············G···C·A··T··C··C········C··A········G··T79KU987335
Pseudexostoma longipterusT········G·C···A·······G·········C·A··T··C···········C··A···········T82KU987301
Table
Table 3. eDNA detection (2019–2021), average O. siamensis eDNA concentration (copies/mL), and visual observation record at each sampling site.
Table 3. eDNA detection (2019–2021), average O. siamensis eDNA concentration (copies/mL), and visual observation record at each sampling site.
SiteRivereDNA DetectioneDNA Detection (Average Concentration, Copies/mL)Visual Detection in This StudyVisual Detection from Other StudiesReferences
201920202021
KP1Klang Phat√√√20.27√√Local reports
KP2√√√17.58√√Local reports
KP3√√√2.60xx-
KP4√√√12.00xx-
K1Klang√√√1.00xx-
K2√√√1.03xx-
K3xxx-xx-
K4√√√0.71xx-
K5√√√1.86xx-
K6xxx-xx-
K7√√√1.23x√Local reports
K8√√√1.71xx-
K9√√√1.73x√[4]
K10√√√3.94xx-
K11xxx-xx-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rodpai, T.; Suwannapoom, C.; Osathanunkul, M. Detection of the Endangered Siamese Bat Catfish (Oreoglanis siamensis Smith, 1933) in Doi Inthanon National Park Using Environmental DNA. Animals 2023, 13, 538. https://doi.org/10.3390/ani13030538

AMA Style

Rodpai T, Suwannapoom C, Osathanunkul M. Detection of the Endangered Siamese Bat Catfish (Oreoglanis siamensis Smith, 1933) in Doi Inthanon National Park Using Environmental DNA. Animals. 2023; 13(3):538. https://doi.org/10.3390/ani13030538

Chicago/Turabian Style

Rodpai, Thanatrinan, Chatmongkon Suwannapoom, and Maslin Osathanunkul. 2023. "Detection of the Endangered Siamese Bat Catfish (Oreoglanis siamensis Smith, 1933) in Doi Inthanon National Park Using Environmental DNA" Animals 13, no. 3: 538. https://doi.org/10.3390/ani13030538

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop