Next Article in Journal
The Socioeconomic Impact of Diseases of Working Equids in Low and Middle-Income Countries: A Critical Review
Next Article in Special Issue
Evidence for Beneficial Physiological Responses of the Land Snail Cornu aspersum to Probiotics’ (Lactobacillus plantarum) Dietary Intervention
Previous Article in Journal
Fostering Animal Welfare and Advancing 3Rs Principles through the Establishment of a 3Rs Advisory Group
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 24
10.3390/ani13243864
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens

by
Shuangshuang Guo
1,†,
Wenfei Tong
1,†,
Ya Qi
1,
Meihan Jiang
1,
Peng Li
1,
Zhengfan Zhang
1,
Qunbing Hu
2,3,
Zhuan Song
1,* and
Binying Ding
1,*
1
Engineering Research Center of Feed Protein Resources on Agricultural by-Products, Ministry of Education, Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, China
2
Hubei Horwath Biotechnology Co., Ltd., Xianning 437099, China
3
Hunan International Joint Laboratory of Animal Intestinal Ecology and Health, Laboratory of Animal Nutrition and Human Health, Hunan Provincial Key Laboratory of Animal Intestinal Function and Regulation, College of Life Sciences, Hunan Normal University, Changsha 410081, China
*
Authors to whom correspondence should be addressed.
†
The authors have contributed equally to the work.
Animals 2023, 13(24), 3864; https://doi.org/10.3390/ani13243864
Submission received: 8 November 2023 / Revised: 11 December 2023 / Accepted: 14 December 2023 / Published: 15 December 2023
(This article belongs to the Special Issue Recent Advances in Probiotics Application on Animal Health)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Necrotic enteritis (NE) is an important enteric disease in poultry and causes great economic losses to the industry worldwide. Clostridium perfringens is a key etiological agent of NE and coccidiosis is a major predisposing factor to NE. With the reduction of antibiotic use in animal production, the outbreak of NE has been increasing in recent years. Probiotics, such as Lactobacilli, Bacillus, Bifidobacteria, and Enterococcus, are potentially alternative strategies to mitigate NE in poultry. The protective effects of Limosilactobacillus fermentum and Lacticaseibacillus paracasei on intestinal barrier function of broilers challenged by coccidia and C. perfringens have been reported in our previous publication. The current study concluded that both Lactobacilli alleviated the impairment of intestinal stem cell proliferation and immunity in coccidia- and C. perfringens-challenged birds via modulating JAK/STAT signaling and reshaping intestinal microflora. It evidenced that L. fermentum and L. paracasei could be used to prevent or alleviate NE in poultry.

Abstract

This study was conducted to investigate effects of dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei supplementation on the intestinal stem cell proliferation, immunity, and ileal microbiota of broiler chickens challenged by coccidia and Clostridium perfringens. A total of 336 one-day-old Ross 308 chickens were randomly assigned into four groups. Chickens in the control (CTR) group were fed basal diet, and chickens in the three challenged groups were fed basal diets supplemented with nothing (CCP group), 1.0 × 109 CFU/kg L. fermentum (LF_CCP group), and 1.0 × 109 CFU/kg L. paracasei (LP_CCP group), respectively. All challenged birds were infected with coccildia on day 9 and Clostridium perfringens during days 13–18. The serum and intestinal samples were collected on days 13 and 19. The results showed that L. fermentum significantly increased jejunal gene expression of cdxB (one of the intestinal stem cell marker genes) on day 13. Additionally, L. fermentum significantly up-regulated mRNA levels of JAK3 and TYK2 and tended to increase STAT6 mRNA expression in jejunum on day 19. In the cecal tonsil, both L. fermentum and L. paracasei decreased mRNA expression of JAK2 on day 13, and L. fermentum down-regulated JAK1-2, STAT1, and STAT5-6 gene expressions on day 19. Ileal microbiological analysis showed that coccidial infection increased the Escherichia–Shigella, Lactobacillus, and Romboutsia abundance and decreased Candidatus_Arthromitus richness on day 13, which were reversed by Lactobacillus intervention. Moreover, Lactobacilli increased ileal Lactobacillus richness on day 19. In conclusion, Lactobacilli alleviated the impairment of intestinal stem cell proliferation and immunity in coccidia- and C. perfringens-challenged birds via modulating JAK/STAT signaling and reshaping intestinal microflora.

1. Introduction

Necrotic enteritis (NE) is an enteric poultry disease that seriously affects profitability in the broiler industry, including clinical and subclinical forms [1,2]. The main characteristics of clinical NE are diarrhea and intestinal necrotic lesions, which lead to high morbidity and mortality in poultry. The subclinical form of NE is mainly characterized by poor growth performance without death or with low mortality [3]. It has been reported that the cost of output losses and control due to NE is approximately 6 billion USD per year [4]. The outbreak of NE is a complex process that includes multiple predisposing factors, among which the presence of pathogenic Clostridium perfringens is an important inducement [2,5]. C. perfringens is a spore-forming Gram-positive bacterium common in the environment [5]. Nevertheless, C. perfringens is a conditional pathogen, and applying it alone to challenge broiler chickens to induce NE is not ideal in some experimental cases due to differences in individual birds or dietary factors. In line with what previous studies reported, we verified that co-infection with coccidia and C. perfringens could effectively improve the stability of the necrotic enteritis model in broilers [6,7]. Furthermore, coccidiosis is one of the major predisposing factors contributing to the outbreak of NE under field conditions [4].
Previous findings have revealed that NE infection impairs immune function and causes intestinal damage in broilers [8,9]. Traditional treatments for broiler NE mainly rely on antibiotics. However, due to the ban on the use of antibiotics as feed additives nowadays, it seems to be a feasible alternative strategy to prevent or treat enteritis through nutritional intervention. Presently, plant extracts [10], organic acids [11], oligosaccharide [12], polysaccharides [13,14], and probiotics [15] have been demonstrated to be effective measures to promote animal growth. Probiotics have been reported to stimulate digestion, improve feed efficiency, and increase growth performance by modulating the intestinal microbiota and immune system, inhibiting pathogens, and improving intestinal integrity. Additionally, some strains increase the nutritional value of feed by production of vitamins, exopolysaccharides, and antioxidants [15,16]. A variety of probiotics have been found to exert essential functions for improving growth performance and intestinal health in broilers, mainly including Bacillus, Enterococcus, Lactobacillus, and Clostridium [16,17,18,19]. Among that, studies reported that Limosilactobacillus fermentum can alleviate intestinal villus damage and increase serum IgM level in broilers challenged with Salmonella [20], and relieve Campylobacter coli induced inflammatory response by suppressing the secretion of cytokines and modulating lymphocyte subpopulation levels [21]. In addition, Xu et al. demonstrated that Lacticaseibacillus paracasei has the ability to enhance growth performance by regulating intestinal microflora in chickens [22]. Moreover, our previous study also found that supplementation with L. fermentum and L. paracasei enhanced the intestinal health of broilers with NE [7]. However, the underlying mechanism by which L. fermentum and L. paracasei convey protective effects on broilers is still unclear.
The occurrence of enteritis is closely related to the impairment of intestinal barrier function, mainly involving the integrity of intestinal structural, inflammatory response, proliferation, and differentiation of intestinal stem cells, and the homeostasis of intestinal microorganisms [23]. Therefore, in the present study, co-infection with coccidia and C. perfringens was used to induce NE to further investigate the influence of L. fermentum and L. paracasei on jejunal stem cell proliferation, immunity, and ileal microbial composition in broilers, which may contribute to gaining a more comprehensive understanding of these probiotics.

2. Materials and Methods

2.1. Experimental Animals, Diets, and Treatments

All animal procedures used in the present study were approved by the Institutional Animal Care and Use Committee of Wuhan Polytechnic University (Number: WPU202104002). A total of 336 one-day-old chicks (Ross 308) were randomly assigned to 4 groups. Each group contained 6 replicates, while each replicate included 7 males and 7 females. The 4 treatment groups were as follows: the control group (CTR, basal diet); (2) the coccidia and C. perfringens infected group (CCP, basal diet + coccidia and C. perfringens infection); (3) L. fermentum-treated and infected group (LF_CCP, basal diet plus 1.0 × 109 CFU/kg L. fermentum + coccidia and C. perfringens infection); and (4) L. paracasei-treated and infected group (LP_CCP, basal diet plus 1.0 × 109 CFU/kg L. paracasei + coccidia and C. perfringens infection). The L. fermentum (CGMCG No. 1.2029) was obtained from the China General Microbiological Culture Collection Center (CGMCG, Beijing, China). The L. paracasei was obtained from the State Key Laboratory of Agricultural Microbiology, Huzhong Agricultural University. Both Lactobacilli were cultured in Mann–Rogosa–Sharpe broth and then incorporated in the diets, which were formulated once a week. The corn–soybean meal basal diets were formulated according to the recommendation of the National Research Council (NRC, 1994). The feed ingredient composition and nutritional level of the basal diet are reported in Table 1. The trial period was 19 days.
On day 9 of the trial, birds in the CCP, LF_CCP, and LP_CCP groups were treated with attenuated coccidial vaccine, and each bird was inoculated with 33,000 ± 3300 spores (30-fold of recommended dose). Birds in the CTR group were mock-infected with an equal volume of saline. The coccidial vaccine used in the present study consisted of 1 × 105 oocysts of E. acervuline strain PAHY, and 5 × 104 oocysts of E. tenella strain PTMZ, E. maxima strain PMHY, as well as E. necatrix strain PNHZ, which were purchased from Foshan Zhengdian Biotechnology Co., Ltd. (Foshan, Guangdong, China). From days 13 to 18, broilers in the CCP, LF_CCP, and LP_CCP groups were infected with type A C. perfringens via feed. A total of 64 mL of C. perfringens broth, containing C. perfringens 1 × 108 CFU/mL, was well mixed with 1.2 kg feed in each group. An equal volume of sterile broth was incorporated into the diet in the CTR group. The basal diets were withdrawn for 3 h before infection and the contaminated feeds containing C. perfringens were consumed within 2 h. Type A C. perfringens (CVCC2030) was obtained from the China Veterinary Microbial Culture Collection and Management Center (Beijing, China). All birds were reared in wire cages and allowed to access feed and water freely. Room temperature was manually controlled. A 24 h light was provided throughout the trial.

2.2. Sample Collection

On days 13 and 19, two chickens per replicate were randomly selected to collect blood from wing veins and euthanized by cervical dislocation, and then slaughtered for sample collection. The serum was obtained by centrifugation at 4 °C, 3000× g for 15 min, and stored at −80 °C for further analysis. Jejunal mucosa was scraped from about 10 cm of the jejunal segment and stored at −80 °C for RNA isolation. Cecal tonsils were also rapidly separated for total RNA isolation. Digesta from the ileum was collected and stored at −80 °C for microbial composition analysis.

2.3. Serum IgA and Cytokine Levels

Levels of IgA, IL-1β, IL-8, IL-10, and IFN-γ in serum were determined using an enzyme-linked immunosorbent assay performed by Beijing Kangjia Hongyuan Biotechnology Co., Ltd. (Beijing, China).

2.4. Quantitative Real-Time PCR

The extraction of total RNA from jejunal mucosa and the cecal tonsil, preparation of cDNA (the reverse transcription of RNA), and RT-qPCR were performed as previously described [24]. Briefly, total RNA was obtained using the TRIzol reagent (Takara, Dalian, China) according to the manufacturer’s instructions. The concentration of RNA and its OD260/280 value was quantified using the NanoDrop® ND-2000 UV-VIS spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The cDNA was synthesized from 1 μg RNA using a PrimeScript® RT reagent Kit with gDNA Eraser (Takara, Dalian, China) as the manufacturer’s protocol. An ABI-Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) was used to perform RT-qPCR procedures. The relative mRNA level of each gene was calculated by the 2−ΔΔCt method and was normalized by β-actin. Primer sequences used in the present study are shown in Table 2. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).

2.5. Ileal Microbiota Analysis

The ileal microbial DNA extraction, amplification, and sequencing were performed by Novogene Technology Co., Ltd. (Beijing, China). Briefly, bacterial DNA was extracted from the ileal digesta using a QIAamp DNA Stool Mini Kit (Qiagen Inc., Valencia, CA, USA). The integrity of DNA was verified by agarose gel electrophoresis. The qualified DNA was used as a template for PCR amplification with 341F and 805R primers (5′-CCTACGGGNBGCASCAG-3′ and 5′-GACTACNVGGGTATCAATCC-3′) targeting the variable V3–V4 gene region. Purified PCR amplification products were used to construct sequencing libraries on a Hiseq PE250 (Illumina, CA, USA). Paired-end reads were demultiplexed and quality-filtered by Trimmomatic (version 0.36) and then merged by Flash (version 1.2.11). The sequences were clustered into operational taxonomic units (OTUs) with 97% similarity using UPARSE (version 7.1). The taxonomy of each OTU representative sequence was analyzed by SILVA database (v138). Alpha diversity analysis, including Shannon and relative abundance of bacteria, was performed with Quantitative Insights into Microbial Ecology (QIIME). The different biomarker bacteria between groups were determined using the linear discriminant analysis effect size (LEfSe) method based on the linear discriminant analysis (LDA) values.

2.6. Statistical Analysis

Data in figures are displayed as means ± SEM and data in tables are expressed as mean and pooled SEM. The data of serum parameters, gene expression, and microbial alpha diversity were analyzed by one-way ANOVA with SPSS 26.0 statistical software (SPSS, Inc., Chicago, IL, USA). The Tukey multiple comparison was performed when significant differences were noticed among groups. Graphs were created using GraphPad Prism 8.0 software (GraphPad Software, Inc., San Diego, CA, USA). p < 0.05 was considered significantly different between groups.

3. Results

3.1. Expression of Genes Involving Stem Cell Proliferation in Jejunum

As shown in Figure 1, compared with the CTR group, coccidia and C. perfringens infection significantly reduced mRNA levels of leucine-rich repeat containing G protein-coupled receptor 5 (Lgr5), zinc and ring finger 3 (Znrf3), caudal-type homeobox 1 (cdxA), and cdxB in jejunum on day 13, as well as cdxB gene expression in jejunum on day 19 (p < 0.05). In addition, the LF_CCP group alleviated the decreased expression of cdxB in challenged broilers on day 13 and tended to alleviate it on day 19 (p < 0.05), and two Lactobacilli had tendency to attenuate the down-regulation of Znrf3 mRNA level on day 13. Compared with the CCP group on day 19, the LF_CCP group showed a tendency to elevate Znrf3 gene expression, and the LP_CCP group significantly up-regulated Znrf3 gene expression (p < 0.05).

3.2. Serum IgA and Cytokine Level

As presented in Figure 2, compared with the CTR group, the LP_CCP group significantly decreased serum IgA level on day 13, (p < 0.05), while the CCP and LF_CCP groups did not significantly affect it (p > 0.05). There were no significant differences of serum IgA levels among the groups on day 19 (p > 0.05). The CCP and LF_CCP groups significantly decreased serum IL-1β and IL-10 concentrations in broilers when compared with the CTR group on day 13 (p < 0.05), and the LP_CCP group reduced serum IL-10 level (p < 0.05). Both L. fermentum and L. paracasei supplementation decreased serum IL-10 levels in coccidia- and C. perfringens-infected broilers compared with their control counterparts on day 19 (p < 0.05).

3.3. Immune-Related Gene Expression in Jejunum

As displayed in Figure 3, coccidia and C. perfringens challenge remarkably increased mRNA levels of IL-1β, iNOS, and IFN-γ in the jejunum of broilers both on days 13 and 19 (p < 0.05). Compared with the challenged group, L. fermentum or L. paracasei addition tended to down-regulate jejunal iNOS expression on day 19; moreover, L. fermentum significantly decreased TNF-α (p < 0.05) while alleviating the increase in TGF-β4 expression.

3.4. Immune-Related Gene Expression in Cecal Tonsil

On day 13, higher mRNA levels of IL-13 and IFN-γ in the cecal tonsil were detected in the CCP group (p < 0.05, Figure 4A). On day 19, coccidia and C. perfringens challenge also increased the IL-13 mRNA level when compared with the CTR group (p < 0.05, Figure 4B). Neither L. fermentum nor L. paracasei attenuated the up-regulation of these genes. On the contrary, LP_CCP group had the highest transcript level of iNOS and IFN-γ in the cecal tonsil among groups on day 19 (p < 0.05).

3.5. Expression of Key Genes in the JAK/STAT Signaling Pathway in the Jejunum

On day 13, as presented in Figure 5A, the CCP group had higher suppressors of cytokine-signaling 1 (SOCS1) mRNA levels and lower mRNA levels of STAT6, tyrosine kinase (TYK2), transforming growth factor kinase 1 (TAK1), Src homology-2 domain-containing protein tyrosine phosphatase 2 (SHP2), and NF-κB p65 than that in the CTR group (p < 0.05). The LP_CCP group alleviated the increase in STAT3 in challenged broilers. On day 19, compared with the CTR group, coccidia and C. perfringens challenge increased mRNA levels of STAT3, suppressors of cytokine-signaling 1 (SOCS1), and NF-κB p65, and decreased TAK1 expression in the jejunum (p < 0.05, Figure 5B). Meanwhile, compared with the CCP group, L. fermentum treatment reversed the gene expression of STAT3, SOCS1, NF-κB p65 and TAK1, and raised the gene expression of JAK3 and TYK2 on day 19 (p < 0.05).

3.6. Expression of Key Genes in the JAK/STAT Signaling Pathway in the Cecal Tonsil

On day 13, compared with the CTR group, the CCP group up-regulated mRNA expression of JAK1-3, STAT1, STAT3, TYK2, SOCS1, and NF-κB p65 in the cecal tonsil, while it down-regulated SHP2 expression (p < 0.05, Figure 6A). Importantly, dietary L. fermentum and L. paracasei reversed the gene expression of JAK2 and NF-κB p65 (p < 0.05). On day 19, coccidia and C. perfringens infection significantly up-regulated mRNA levels of TYK2 and TAK1 (p < 0.05, Figure 6B). Intriguingly, the LF_CCP group had the lowest transcriptional levels of JAK1, JAK2, STAT1, STAT5, and STAT6 in the cecal tonsil among groups, whereas it sharply up-regulated the mRNA level of SHP2 (p < 0.05).

3.7. Alpha Diversity of Microbiota in Ileum

As shown in Table 3, on day 13, the alpha diversity of ileal microbiota was not significantly affected by coccidia infection compared with the CCP group, and dietary L. fermentum significantly increased the Shannon and Simpson indices (p < 0.05), and L. paracasei tended to increase the Shannon and Simpson indices in challenged broilers. On day 19, the Chao1 and Ace indices in the CCP group were higher than that in the CTR group, although this did not achieve statistical significance. At this time point, compared with the CCP group, dietary L. paracasei significantly decreased the Chao1 and Ace indices (p < 0.05).

3.8. Bacterial Composition at Phylum Level in Ileum

On day 13, compared with the control group, the relative abundance of Firmicute was decreased by coccidia infection at the phylum level, whereas the abundance of Proteobacteria was increased (Figure 7A). Compared with the CCP group, dietary L. fermentum and L. paracasei reversed the abundance of Firmicute and Proteobacteria in ileum of challenged broilers, and both of them enhanced the Bacteroidota abundance. At 19 days of age, coccidia and C. perfringens infection reduced the Proteobacteria abundance and increased the Cyanobacteria abundance when compared with the CTR group, which was reversed by dietary supplementation with L. fermentum and L. paracasei (Figure 7B). Bacteroidota was most abundant in LF_CCP group. Specially, the results of cluster analysis showed that the microbial composition of LF_CCP group was more similar to the CTR group both on days 13 and 19 at the phylum level (Figure 7C,D).

3.9. Bacterial Composition at Genus Level in Ileum

As shown in Figure 8A, at 13 days of age, compared with the control group, Escherichia–Shigella, Enterococcus, and Lactobacillus were highly enriched in the CCP group, while the abundance of Romboutsia, unidentified_Chloroplast, and Candidatus_Arthromitus was decreased. Contrarily, dietary L. fermentum and L. paracasei diminished the richness of Escherichia–Shigella and Lactobacillus and enhanced the abundance of Candidatus_Arthromitus. Figure 8B depicts the ileal bacterial composition at the genus level on day 19. Compared with the control group, coccidia and C. perfringens challenge increased the abundance of Ligilactobacillus, unidentified_Chloroplast, and Bacillus, but decreased Lactobacillus, Escherichia–Shigella, and Candidatus_Arthromitus abundance. Compared with the CCP group, two lactobacillus strains increased the abundance of Lactobacillus and Escherichia–Shigella and reduced the abundance of unidentified_Chloroplast and Bacillus. Interesting, dietary L. fermentum increased the Ralstonia abundance and L. paracasei increased the Enterococcus abundance.

3.10. LEfSe Analysis for Biomarkers

LefSe analysis can be used to analyze the statistically different biomarker bacteria between groups. As Figure 9A shows, on day 13, the microbiota of birds in the CCP group were enriched with Romboutsia. The Candidatus_Arthromitus and Bacillus were more abundant in the LF_CCP group, and the Alkanindiges and Parabacteroides genus were more prevalent in the LP_CCP group. Interestingly, on day 19, the Candidatus_Arthromitus was a biomarker genus in the CCP group; meanwhile, the LP_CCP group had a greater abundance of Lacticaseibacillus (Figure 9B).

4. Discussion

The NE can decrease the growth performance of poultry by impairing intestinal integrity. In the post-antibiotic era, probiotics are one of the effective strategies to protect poultry from NE for its potential growth-promoting property, enhancement of intestinal health, and modulation of immune function [26,27]. The previous and current results showed successful establishment of the coccidia and C. perfringens co-challenge model, as reflected by decreased average daily gain and average feed intake and increased intestinal lesion score in challenged birds [7]. Importantly, we previously found that L. fermentum and L. paracasei improved intestinal integrity and barrier function, although they did not alleviate the decrease in growth performance [7]. The homeostasis of intestinal stem cell proliferation, immune function, and microbial composition are all closely correlated to the integrity of the intestine. Herein, the regulatory effects of L. fermentum and L. paracasei on these intestinal-health-related factors were further explored in the present study.
Cellular losses due to either natural cellular attrition or injury within different tissues are persistently replenished by stem cells to meet the homeostatic need or regenerative demand [28,29]. Intestinal stem cells (ISCs), which are located in the proliferative intestinal crypt, are responsible for the replenishment of intestinal epithelial cells. The self-renewal ability of ISCs further determines the integrity of the epithelial barrier and the rapid repairment of the intestinal epithelium from injury [30,31]. At present, multiple biomarkers of ISCs in chickens have been identified by lineage tracing of candidate quiescent ISCs populations, such as Lgr5, Olfm4, Znrf3, Bmi1, Hopx, cdxA, and cdxB [30,32,33]. Lgr5 is the first discovered intestinal stem cell marker gene, and Lgr5+ stem cells have strong self-renewal ability and can differentiate into various types of intestinal cells [32]. The Wnt/β-catenin pathway is a key indicator for the proliferation and maintenance of ISCs and is tightly regulated by E3 ubiquitin ligases Rnf43 and Znrf3, which target Wnt receptors for degradation. Therefore, the normal expression of Znrf3 can control the excessive proliferation of stem cells [34]. CdxA and cdxB homeobox genes, characteristic of proliferating epithelial cells, belong to caudal family transcription factors, and are expressed both in chicken embryos and chicks. The role of these genes in the chicken is not fully understood, but they may be involved in the maturation of the intestine [33]. The decreased expression of Lgr5 and other related stem cell marker genes in the present study revealed that the coccidia and C. perfringens infection caused the intestinal injury of broilers and therefore adversely affected the development of ISCs. Importantly, the up-regulated Znrf3 and cdxB gene expression in the L. fermentum- and L. paracasei-supplemented group highlighted the beneficial effect of probiotics on intestinal stem cell proliferation. Similarly, several studies reported that probiotics (1.0 × 108 CFU/d) could stimulate the proliferation of ISCs in chickens [35,36,37]. In addition, an interesting study showed that Lactobacillus reuteri D8 (1.0 × 104 CFU/well) could stimulate ISC proliferation through the phosphorylation of STAT3 activated by IL-22 to protect the mucosal barrier in mice induced by dextran sodium sulfate [38]. The present study demonstrated that dietary L. fermentum also activated JAK/STAT signaling pathway on day 19, which might contribute to the promotion of ISC proliferation and thereby improve intestinal health of broilers.
Inflammation is a paramount part of the body’s first line of defense against pathogen invasion and plays a crucial role in tissue repairment and regeneration. Increased secretion of pro-inflammatory cytokines is usually accompanied with the occurrence of inflammatory response, such as IL-6, IL-8, IL-1β, and so on [39]. To our surprise, coccidia and C. perfringens infection did not evoke a sharp increase in IgA and cytokine production in serum. One possible explanation may be that the systemic inflammatory response of broilers was in the recovery phase on day 13 or the intestinal local inflammation was not strong enough to alter systemic inflammation on day 19. Nevertheless, we found that transcriptional levels of IL-1β, iNOS, and IFN-γ in the jejunum were up-regulated by coccidia and C. perfringens infection on both days 13 and 19, indicating strong inflammatory responses in the jejunum of birds. Moreover, consistent with previous studies [20,24], our results showed that L. fermentum treatment suppressed iNOS, TNF-α, and TGF-β4 expression, which suggested that L. fermentum alleviated intestinal inflammatory responses in challenged broilers.
In particular, the prominent rise of IFN-γ expression in the jejunum after infection drew our attention. It is well known that IFNs belong to the secreted cytokines that are important regulators of immunity for modulating host defense against pathogenic infection. Moreover, IFNs can regulate the expression of related genes by binding to specific cell-surface receptors and then activating the JAK/STAT signaling pathway [40,41]. A previous study has shown that necrotic enteritis in broilers induced by C. perfringens was accompanied by activation of the JAK/STAT pathway [42]. Therefore, we also examined the expression of key genes in the JAK/STAT pathway in the jejunum. Of note, several negative feedback regulators of the JAK/STAT pathway have been identified, mainly including SOCSs, protein inhibitors of activated STAT (PIASs), and protein tyrosine phosphatases (PTPs) [43]. Our results showed that coccidia infection inhibited jejunal JAK/STAT signaling on day 13, reflected by decreased gene expression of STAT6, TYK2, TAK1, and SHP2. Consistently, the mRNA level of SOCS1 was strongly elevated by coccidial infection. The strong inhibition of the JAK/STAT pathway by coccidial infection during the inflammation recovery stage might benefit the maintenance of intestinal homeostasis. As for day 19, C. perfringens infection significantly increased STAT3 expression, but the SOCS1 expression was also raised. Therefore, it was difficult to distinguish the state of JAK/STAT signaling pathway due to C. perfringens challenge. Unexpectedly, L. fermentum increased the mRNA abundance of JAK3, STAT6, and TYK2, and consistently decreased the SOCS1 expression, indicating that the JAK/STAT signaling was greatly activated. This is consistent with the slight attenuation of jejunal inflammation and ISC proliferation by L. fermentum supplementation.
The cecal tonsil is the largest intestinal lymphoid tissue in poultry and its indispensable immune function indirectly contributes to the integrity of the intestine [44]. Dietary L. fermentum and L. paracasei failed to alleviate the up-regulation of cytokines in cecal tonsil. However, both dietary L. fermentum and L. paracasei reduced the gene expression of NF-κB p65 on day 13, and L. fermentum generally inhibited expression of genes involving in JAK/STAT pathway in the cecal tonsil on day 19. Again, these results suggested that two Lactobacilli could alleviate intestinal inflammation via the JAK/STAT signaling pathway, which was concordant with previous findings that probiotics can promote gut health by providing a more stable immune homeostasis in the cecal tonsil [45]. It is worth noting that the different effects of Lactobacilli on the immunity of jejunum and cecal tonsil in our present study, especially on the regulation of JAK/STAT signaling, may indicate the tissue-specific immune-modulatory effects.
It has been accepted that intestinal microbiota could regulate intestinal barrier and immune maturation, which contributes to the homeostasis of the intestine and the resistance to pathogens [46]. Our results showed that dietary L. fermentum increased the Shannon and Simpson indices of ileal microbes in birds at the age of 13 days, but L. paracasei-impaired Chao1 and Ace indices on day 19 compared with the CCP group, which suggested that microbial diversity decreased in the LP_CCP group. Partly in accordance with our study, Li et al. [47] also found that the richness of the ileal bacterial community of chickens was reduced by Lactobacillus acidophilus. One possible assumption was that L. fermentum and L. paracasei reduced the richness of ileal microorganisms through promoting the proliferation of dominant flora. At the phylum level, consistent with previous reports [24,48], we found that Firmicutes, Cyanobacteria, Proteobacteria, and Bacteroidetes were the four predominant bacteria in the ileum of broilers. Compared with unchallenged chickens, the abundance of Firmicutes was decreased and Proteobacteria abundance was enhanced by coccidia infection, which was reversely changed by L. fermentum and L. paracasei on day 13. Moreover, the Cyanobacteria phylum, which can synthesize toxic secondary metabolites to impair health on animals [49,50], was rich in challenged broilers and was also inversely decreased by L. fermentum and L. paracasei administration on day 19. It was reported that a decrease in Firmicutes and an increase in Proteobacteria was correlated with the severity of NE in birds [24,51], and the ratio of Firmicutes/Bacteroides was associated with host health and growth performance [52]. The abundant Firmicutes and less abundant Cyanobacteria in lactobacillus-treated groups may be conducive to the homeostasis of ileal microbial composition. However, C. perfringens infection had no significant effect on the abundance of Firmicutes and even decreased the abundance of Proteobacteria on day 19. We speculated that the intervention of C. perfringens further destroyed the stability of the intestinal microbial composition, resulting in a large difference in bacterial species between days 19 and 13. Interestingly, the ileal microbial community in the L. fermentum-supplemented group was more similar to that of the CTR group at the phylum level both on days 13 and 19. This suggested that the remission of L. fermentum on gut health was related to the changes of microbial flora.
At the genus level, on day 13, coccidial infection increased the Escherichia–Shigella and Lactobacillus abundance in the ileum, and decreased the abundance of Romboutsia and Candidatus_Arthromitus, which were rescued by dietary lactobacillus intervention. Meanwhile, the Candidatus_Arthromitus was a biomarker genus in the L. fermentum addition group. According to studies, Escherichia–Shigella is a regular pathogen in Enterobacteriaceae that probiotic treatment is effective in decreasing [47,53]. Our current results show that two Lactobacilli reduced the abundance of Escherichia–Shigella in challenged broilers on day 13, which helped to reduce the intestinal inflammation. To the contrary, C. perfringens infection reduced Escherichia–Shigella richness on day 19. A possible explanation was that C. perfringens, also a harmful bacterium, competed with Escherichia–Shigella for nutrients, ultimately inhibiting its proliferation in the intestine. Lactobacillus is a well-known beneficial genus in the gut of animals and plays an important role in improving immunity, facilitating the absorption of nutrition, and maintaining gut integrity by promoting intestinal microbiota homeostasis [54]. Coccidial challenge increased ileal Lactobacillus abundance on day 13 and C. perfringens infection decreased it on day 19. As expected, L. fermentum and L. paracasei strikingly increased Lactobacillus abundance on day 19. Similarly, Song et al. also found that the increase in Lactobacillus was coupled to the relief of intestinal damage in broiler chickens with necrotic enteritis [13].
Romboutsia is a Gram-positive coccus that is reported to be predominant in healthy human mucosa and can produce acetic acid, formic acid, and lactic acid through breaking down monosaccharides and disaccharides [55]. Acetic acid is a short-chain fatty acid, which help maintain intestinal health. Therefore, the elevated Romboutsia by coccidial challenge on day 13 may be a feedback to fight against parasite infection, and this speculation could be strengthened by the association between increased Romboutsia and decreased inflammatory cytokine production in serum [56,57]. In addition, Candidatus_Arthromitus is a potentially beneficial bacteria for the development of mucosa and immune system in intestines and it can specifically induce T cell response [58,59]. Thus, at 13 days of age, the increased Candidatus_Arthromitus abundance in lactobacillus-supplemented groups, especially in the L. fermentum-supplemented group, might have enhanced the development of birds’ immune competence. Consistently, dietary L. fermentum also increased the population of Candidatus_Arthromitus on day 19. It is worthwhile to further explore the effect of Candidatus_Arthromitus on remitting intestinal damage in broilers with NE. These data illustrated that L. fermentum and L. paracasei exerted positive effects on intestinal microbiota, which may be used as an additive to promote intestinal health instead of antibiotics in broilers post-challenge. Moreover, our results may also provide an understanding for the use of Lactobacilli to alleviate chronic intestinal inflammation in patients.

5. Conclusions

Combined challenge with coccidia and C. perfringens impaired intestinal health in broilers by diminishing the proliferation of intestinal stem cells, inducing inflammatory responses, and disrupting intestinal microbiota structure. Dietary L. fermentum and L. paracasei supplementation attenuated intestinal damage through modulating JAK/STAT signaling and maintaining intestinal microbial homeostasis. Particularly, L. fermentum restored the proliferation of intestinal stem cells to some extent.

Author Contributions

S.G. and B.D.: conceptualization, study design, methodology, manuscript preparation, and supervision; S.G. and W.T.: formal analysis and writing—original draft; Y.Q. and M.J.: validation and formal analysis; Q.H., Z.Z. and P.L.: investigation and data curation; Z.S. and B.D.: statistical analysis and manuscript review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Natural Science Foundation of Hubei Province (2021CFB559), the Foundation for Innovative Research Groups of Hubei Provincial Natural Science Foundation (2023AFA018), and the Hubei Provincial Department of Education (T2022024).

Institutional Review Board Statement

The animal study was reviewed approved by the Institutional Animal Care and Use Committee of Wuhan Polytechnic University (Number: WPU202104002, approved on 20 March 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data of 16S amplicon sequencing has been uploaded to the NCBI database and the accession number is PRJNA1033806. Other data that support the findings of this study are available upon request from the corresponding author.

Conflicts of Interest

The co-author Q.H. is an employee of Hubei Horwath Biotechnology Co., Ltd., which did not finance the project and did not provide any product. All authors have no competing interests.

Abbreviations

cdx: caudal-type homeobox; Hopx, homeodomain-only protein X; IFN, interferon; IL, interleukin; iNOS, inducible nitric oxide synthase; ISC, intestinal stem cell; JAK, janus-activated kinase; Lgr5, leucine-rich repeat containing G protein-coupled receptor 5; NE, necrotic enteritis; NF-κB, nuclear factor-κB; Olfm4, olfactomedin 4; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; STAT, signal transducer and activator of transcription; TAK1, transforming growth factor kinase 1; TGF-β4, transforming growth factor-β4; TNF-α, tumor necrosis factor-α; TYK2, tyrosine kinase 2; Znrf3, zinc and ring finger 3.

References

  1. Abd El-Hack, M.E.; El-Saadony, M.T.; Elbestawy, A.R.; El-Shall, N.A.; Saad, A.M.; Salem, H.M.; El-Tahan, A.M.; Khafaga, A.F.; Taha, A.E.; AbuQamar, S.F.; et al. Necrotic enteritis in broiler chickens: Disease characteristics and prevention using organic antibiotic alternatives—A comprehensive review. Poult. Sci. 2022, 101, 101590. [Google Scholar] [CrossRef] [PubMed]
  2. Antonissen, G.; Eeckhaut, V.; Van Driessche, K.; Onrust, L.; Haesebrouck, F.; Ducatelle, R.; Moore, R.J.; Van Immerseel, F. Microbial shifts associated with necrotic enteritis. Avian Pathol. 2016, 45, 308–312. [Google Scholar] [CrossRef] [PubMed]
  3. Bansal, M.; Alenezi, T.; Fu, Y.; Almansour, A.; Wang, H.; Gupta, A.; Liyanage, R.; Graham, D.B.; Hargis, B.M.; Sun, X. Specific secondary bile acids control chicken necrotic enteritis. Pathogens 2021, 10, 1041. [Google Scholar] [CrossRef]
  4. Fathima, S.; Hakeem, W.G.A.; Shanmugasundaram, R.; Selvaraj, R.K. Necrotic enteritis in broiler chickens: A review on the pathogen, pathogenesis, and prevention. Microorganisms 2022, 10, 1958. [Google Scholar] [CrossRef] [PubMed]
  5. Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef] [PubMed]
  6. Belote, B.L.; Tujimoto-Silva, A.; Hümmelgen, P.H.; Sanches, A.W.D.; Wammes, J.C.S.; Hayashi, R.M.; Santin, E. Histological parameters to evaluate intestinal health on broilers challenged with Eimeria and Clostridium perfringens with or without enramycin as growth promoter. Poult. Sci. 2018, 97, 2287–2294. [Google Scholar] [CrossRef] [PubMed]
  7. Li, P.; Zheng, L.; Qi, Y.; Liu, Z.; Du, E.; Wei, J.; Zhang, Z.; Guo, S.; Ding, B. Dietary Lactobacillus fermentum and Lactobacillus paracasei improve the intestinal health of broilers challenged with coccidia and Clostridium perfringens. Front. Vet. Sci. 2022, 9, 1025677. [Google Scholar] [CrossRef] [PubMed]
  8. Shimizu, T.; Ohtani, K.; Hirakawa, H.; Ohshima, K.; Yamashita, A.; Shiba, T.; Ogasawara, N.; Hattori, M.; Kuhara, S.; Hayashi, H. Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. Proc. Natl. Acad. Sci. USA 2002, 99, 996–1001. [Google Scholar] [CrossRef]
  9. Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 141. [Google Scholar] [CrossRef]
  10. Righi, F.; Pitino, R.; Manuelian, C.L.; Simoni, M.; Quarantelli, A.; De Marchi, M.; Tsiplakou, E. Plant feed additives as natural alternatives to the use of synthetic antioxidant vitamins on poultry performances, health, and oxidative status: A review of the literature in the last 20 years. Antioxidants 2021, 10, 659. [Google Scholar] [CrossRef]
  11. Khan, R.U.; Naz, S.; Raziq, F.; Qudratullah, Q.; Khan, N.A.; Laudadio, V.; Tufarelli, V.; Ragni, M. Prospects of organic acids as safe alternative to antibiotics in broiler chickens diet. Environ. Sci. Pollut. Res. Int. 2022, 29, 32594–32604. [Google Scholar] [CrossRef] [PubMed]
  12. Jana, U.K.; Suryawanshi, R.K.; Prajapati, B.P.; Kango, N. Prebiotic mannooligosaccharides: Synthesis, characterization and bioactive properties. Food Chem. 2021, 342, 128328. [Google Scholar] [CrossRef] [PubMed]
  13. Song, B.; Li, P.; Yan, S.; Liu, Y.; Gao, M.; Lv, H.; Lv, Z.; Guo, Y. Effects of dietary astragalus polysaccharide supplementation on the Th17/Treg balance and the gut microbiota of broiler chickens challenged with necrotic enteritis. Front. Immunol. 2022, 13, 781934. [Google Scholar] [CrossRef] [PubMed]
  14. Cai, G.; Mao, N.; Gu, P.; Zhu, T.; He, J.; Peng, S.; Yang, Y.; Liu, Z.; Hu, Y.; Wang, D. Effects of alhagi honey polysaccharides as feed supplement on intestine function and microbiome, immune function, and growth performance in chicken. Int. J. Mol. Sci. 2022, 23, 14332. [Google Scholar] [CrossRef] [PubMed]
  15. Yaqoob, M.U.; El-Hack, M.E.A.; Hassan, F.; El-Saadony, M.T.; Khafaga, A.F.; Batiha, G.E.; Yehia, N.; Elnesr, S.S.; Alagawany, M.; El-Tarabily, K.A.; et al. The potential mechanistic insights and future implications for the effect of prebiotics on poultry performance, gut microbiome, and intestinal morphology. Poult. Sci. 2021, 100, 101143. [Google Scholar] [CrossRef]
  16. Ayalew, H.; Zhang, H.; Wang, J.; Wu, S.; Qiu, K.; Qi, G.; Tekeste, A.; Wassie, T.; Chanie, D. Potential feed additives as antibiotic alternatives in broiler production. Front. Vet. Sci. 2022, 9, 916473. [Google Scholar] [CrossRef] [PubMed]
  17. Eeckhaut, V.; Wang, J.; Van Parys, A.; Haesebrouck, F.; Joossens, M.; Falony, G.; Raes, J.; Ducatelle, R.; Van Immerseel, F. The probiotic Butyricicoccus pullicaecorum reduces feed conversion and protects from potentially harmful intestinal microorganisms and necrotic enteritis in broilers. Front. Microbiol. 2016, 7, 1416. [Google Scholar] [CrossRef] [PubMed]
  18. Kan, L.; Guo, F.; Liu, Y.; Pham, V.H.; Guo, Y.; Wang, Z. Probiotics Bacillus licheniformis improves intestinal health of subclinical necrotic enteritis-challenged broilers. Front. Microbiol. 2021, 12, 623739. [Google Scholar] [CrossRef]
  19. Ma, K.; Chen, W.; Lin, X.Q.; Liu, Z.Z.; Wang, T.; Zhang, J.B.; Zhang, J.G.; Zhou, C.K.; Gao, Y.; Du, C.T.; et al. Culturing the chicken intestinal microbiota and potential application as probiotics development. Int. J. Mol. Sci. 2023, 24, 3045. [Google Scholar] [CrossRef]
  20. Šefcová, M.A.; Ortega-Paredes, D.; Larrea-Álvarez, C.M.; Mina, I.; Guapás, V.; Ayala-Velasteguí, D.; Leoro-Garzón, P.; Molina-Cuasapaz, G.; Vinueza-Burgos, C.; Revajová, V.; et al. Effects of Lactobacillus fermentum administration on intestinal morphometry and antibody serum levels in Salmonella-infantis-challenged chickens. Microorganisms 2023, 11, 256. [Google Scholar] [CrossRef]
  21. Šefcová, M.; Larrea-Álvarez, M.; Larrea-Álvarez, C.; Karaffová, V.; Revajová, V.; Gancarčíková, S.; Ševčíková, Z.; Herich, R. Lactobacillus fermentum administration modulates cytokine expression and lymphocyte subpopulation levels in broiler chickens challenged with Campylobacter coli. Foodborne Pathog. Dis. 2020, 17, 485–493. [Google Scholar] [CrossRef] [PubMed]
  22. Xu, Y.; Tian, Y.; Cao, Y.; Li, J.; Guo, H.; Su, Y.; Tian, Y.; Wang, C.; Wang, T.; Zhang, L. Probiotic properties of Lactobacillus paracasei subsp. paracasei L1 and its growth performance-promotion in chicken by improving the intestinal microflora. Front. Physiol. 2019, 10, 937. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef] [PubMed]
  24. Guo, S.; Xi, Y.; Xia, Y.; Wu, T.; Zhao, D.; Zhang, Z.; Ding, B. Dietary Lactobacillus fermentum and Bacillus coagulans supplementation modulates intestinal immunity and microbiota of broiler chickens challenged by Clostridium perfringens. Front. Vet. Sci. 2021, 8, 680742. [Google Scholar] [CrossRef] [PubMed]
  25. Azarin, H.; Aramli, M.S.; Imanpour, M.R.; Rajabpour, M. Effect of a probiotic containing Bacillus licheniformis and Bacillus subtilis and ferroin solution on growth performance, body composition and haematological parameters in Kutum (Rutilus frisii kutum) fry. Probiotics Antimicrob. Proteins 2015, 7, 31–37. [Google Scholar] [CrossRef] [PubMed]
  26. Lutful Kabir, S.M. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 2009, 10, 3531–3546. [Google Scholar] [CrossRef] [PubMed]
  27. Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The gut microbiota of laying hens and its manipulation with prebiotics and probiotics to enhance gut health and food safety. Appl. Environ. Microbiol. 2020, 86, e00600–e00620. [Google Scholar] [CrossRef] [PubMed]
  28. Miyajima, A.; Tanaka, M.; Itoh, T. Stem/progenitor cells in liver development, homeostasis, regeneration, and reprogramming. Cell Stem Cell 2014, 14, 561–574. [Google Scholar] [CrossRef]
  29. Vitale, I.; Manic, G.; De Maria, R.; Kroemer, G.; Galluzzi, L. DNA damage in stem cells. Mol. Cell 2017, 66, 306–319. [Google Scholar] [CrossRef]
  30. Gehart, H.; Clevers, H. Tales from the crypt: New insights into intestinal stem cells. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 19–34. [Google Scholar] [CrossRef]
  31. Van der Flier, L.G.; Clevers, H. Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu. Rev. Physiol. 2009, 71, 241–260. [Google Scholar] [CrossRef]
  32. Mah, A.T.; Yan, K.S.; Kuo, C.J. Wnt pathway regulation of intestinal stem cells. J. Physiol. 2016, 594, 4837–4847. [Google Scholar] [CrossRef] [PubMed]
  33. Panek, M.; Grabacka, M.; Pierzchalska, M. The formation of intestinal organoids in a hanging drop culture. Cytotechnology 2018, 70, 1085–1095. [Google Scholar] [CrossRef] [PubMed]
  34. Koo, B.K.; Spit, M.; Jordens, I.; Low, T.Y.; Stange, D.E.; van de Wetering, M.; van Es, J.H.; Mohammed, S.; Heck, A.J.; Maurice, M.M.; et al. Tumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors. Nature 2012, 488, 665–669. [Google Scholar] [CrossRef] [PubMed]
  35. Hong, Y.; Zhou, Z.; Yu, L.; Jiang, K.; Xia, J.; Mi, Y.; Zhang, C.; Li, J. Lactobacillus salivarius and Lactobacillus agilis feeding regulates intestinal stem cells activity by modulating crypt niche in hens. Appl. Microbiol. Biotechnol. 2021, 105, 8823–8835. [Google Scholar] [CrossRef]
  36. Pierzchalska, M.; Panek, M.; Czyrnek, M.; Gielicz, A.; Mickowska, B.; Grabacka, M. Probiotic Lactobacillus acidophilus bacteria or synthetic TLR2 agonist boost the growth of chicken embryo intestinal organoids in cultures comprising epithelial cells and myofibroblasts. Comp. Immunol. Microbiol. Infect. Dis. 2017, 53, 7–18. [Google Scholar] [CrossRef] [PubMed]
  37. Xie, S.; Zhao, S.; Jiang, L.; Lu, L.; Yang, Q.; Yu, Q. Lactobacillus reuteri stimulates intestinal epithelial proliferation and induces differentiation into goblet cells in young chickens. J. Agric. Food Chem. 2019, 67, 13758–13766. [Google Scholar] [CrossRef] [PubMed]
  38. Hou, Q.; Ye, L.; Liu, H.; Huang, L.; Yang, Q.; Turner, J.R.; Yu, Q. Lactobacillus accelerates ISCs regeneration to protect the integrity of intestinal mucosa through activation of STAT3 signaling pathway induced by LPLs secretion of IL-22. Cell Death Differ. 2018, 25, 1657–1670. [Google Scholar] [CrossRef]
  39. Sanmarco, L.M.; Chao, C.C.; Wang, Y.C.; Kenison, J.E.; Li, Z.; Rone, J.M.; Rejano-Gordillo, C.M.; Polonio, C.M.; Gutierrez-Vazquez, C.; Piester, G.; et al. Identification of environmental factors that promote intestinal inflammation. Nature 2022, 611, 801–809. [Google Scholar] [CrossRef]
  40. Platanias, L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 2005, 5, 375–386. [Google Scholar] [CrossRef]
  41. Chen, K.; Liu, J.; Cao, X. Regulation of type I interferon signaling in immunity and inflammation: A comprehensive review. J. Autoimmun. 2017, 83, 1–11. [Google Scholar] [CrossRef] [PubMed]
  42. Zhang, B.; Gan, L.; Shahid, M.S.; Lv, Z.; Fan, H.; Liu, D.; Guo, Y. In vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens. J. Anim. Sci. Biotechnol. 2019, 10, 73. [Google Scholar] [CrossRef] [PubMed]
  43. Ott, N.; Faletti, L.; Heeg, M.; Andreani, V.; Grimbacher, B. JAKs and STATs from a clinical perspective: Loss-of-function mutations, gain-of-function mutations, and their multidimensional consequences. J. Clin. Immunol. 2023, 43, 1326–1359. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, Y.; Wang, Z.; Dong, Y.; Cao, J.; Chen, Y. Effects of different monochromatic light combinations on cecal microbiota composition and cecal tonsil T lymphocyte proliferation. Front. Immunol. 2022, 13, 849780. [Google Scholar] [CrossRef] [PubMed]
  45. Yitbarek, A.; Echeverry, H.; Munyaka, P.; Rodriguez-Lecompte, J.C. Innate immune response of pullets fed diets supplemented with prebiotics and synbiotics. Poult. Sci. 2015, 94, 1802–1811. [Google Scholar] [CrossRef]
  46. Sommer, F.; Anderson, J.M.; Bharti, R.; Raes, J.; Rosenstiel, P. The resilience of the intestinal microbiota influences health and disease. Nat. Rev. Microbiol. 2017, 15, 630–638. [Google Scholar] [CrossRef]
  47. Li, Z.; Wang, W.; Liu, D.; Guo, Y. Effects of Lactobacillus acidophilus on gut microbiota composition in broilers challenged with Clostridium perfringens. PLoS ONE 2017, 12, e0188634. [Google Scholar] [CrossRef]
  48. Zhang, B.; Lv, Z.; Li, Z.; Wang, W.; Li, G.; Guo, Y. Dietary l-arginine supplementation alleviates the intestinal injury and modulates the gut microbiota in broiler chickens challenged by Clostridium perfringens. Front. Microbiol. 2018, 9, 1716. [Google Scholar] [CrossRef]
  49. Zi, J.; Pan, X.; MacIsaac, H.J.; Yang, J.; Xu, R.; Chen, S.; Chang, X. Cyanobacteria blooms induce embryonic heart failure in an endangered fish species. Aquat. Toxicol. 2018, 194, 78–85. [Google Scholar] [CrossRef]
  50. Mohamed, T.M.; Sun, W.; Bumbie, G.Z.; Elokil, A.A.; Mohammed, K.A.F.; Zebin, R.; Hu, P.; Wu, L.; Tang, Z. Feeding Bacillus subtilis ATCC19659 to broiler chickens enhances growth performance and immune function by modulating intestinal morphology and cecum microbiota. Front. Microbiol. 2021, 12, 798350. [Google Scholar] [CrossRef]
  51. Xu, S.; Lin, Y.; Zeng, D.; Zhou, M.; Zeng, Y.; Wang, H.; Zhou, Y.; Zhu, H.; Pan, K.; Jing, B.; et al. Bacillus licheniformis normalize the ileum microbiota of chickens infected with necrotic enteritis. Sci. Rep. 2018, 8, 1744. [Google Scholar] [CrossRef]
  52. Singh, K.M.; Shah, T.; Deshpande, S.; Jakhesara, S.J.; Koringa, P.G.; Rank, D.N.; Joshi, C.G. High through put 16S rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol. Biol. Rep. 2012, 39, 10595–10602. [Google Scholar] [CrossRef]
  53. Fan, L.; Qi, Y.; Qu, S.; Chen, X.; Li, A.; Hendi, M.; Xu, C.; Wang, L.; Hou, T.; Si, J.; et al. B. adolescentis ameliorates chronic colitis by regulating Treg/Th2 response and gut microbiota remodeling. Gut Microbes 2021, 13, 1826746. [Google Scholar] [CrossRef] [PubMed]
  54. Van Zyl, W.F.; Deane, S.M.; Dicks, L.M.T. Molecular insights into probiotic mechanisms of action employed against intestinal pathogenic bacteria. Gut Microbes 2020, 12, 1831339. [Google Scholar] [CrossRef] [PubMed]
  55. Mangifesta, M.; Mancabelli, L.; Milani, C.; Gaiani, F.; de’Angelis, N.; de’Angelis, G.L.; van Sinderen, D.; Ventura, M.; Turroni, F. Mucosal microbiota of intestinal polyps reveals putative biomarkers of colorectal cancer. Sci. Rep. 2018, 8, 13974. [Google Scholar] [CrossRef] [PubMed]
  56. Gerritsen, J.; Fuentes, S.; Grievink, W.; van Niftrik, L.; Tindall, B.J.; Timmerman, H.M.; Rijkers, G.T.; Smidt, H. Characterization of Romboutsia ilealis gen. nov., sp. nov., isolated from the gastro-intestinal tract of a rat, and proposal for the reclassification of five closely related members of the genus Clostridium into the genera Romboutsia gen. nov., Intestinibacter gen. nov., Terrisporobacter gen. nov. and Asaccharospora gen. nov. Int. J. Syst. Evol. Microbiol. 2014, 64, 1600–1616. [Google Scholar] [PubMed]
  57. Liang, G.; Malmuthuge, N.; Bao, H.; Stothard, P.; Griebel, P.J.; Guan, L.L. Transcriptome analysis reveals regional and temporal differences in mucosal immune system development in the small intestine of neonatal calves. BMC Genom. 2016, 17, 602. [Google Scholar] [CrossRef]
  58. Umesaki, Y.; Okada, Y.; Matsumoto, S.; Imaoka, A.; Setoyama, H. Segmented filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and induce MHC class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial cells in the ex-germ-free mouse. Microbiol. Immunol. 1995, 39, 555–562. [Google Scholar] [CrossRef]
  59. Gaboriau-Routhiau, V.; Rakotobe, S.; Lécuyer, E.; Mulder, I.; Lan, A.; Bridonneau, C.; Rochet, V.; Pisi, A.; De Paepe, M.; Brandi, G.; et al. The key role of segmented filamentous bacteria in the coordinated maturation of gut helper T cell responses. Immunity 2009, 31, 677–689. [Google Scholar] [CrossRef]
Animals 13 03864 g001
Figure 1. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to the proliferation of intestinal stem cells in broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. Lgr5, leucine-rich repeat containing G protein-coupled receptor 5; Znrf3, zinc and ring finger 3; Olfm4, olfactomedin 4; Hopx, homeodomain-only protein X; cdx, caudal-type homeobox.
Figure 1. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to the proliferation of intestinal stem cells in broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. Lgr5, leucine-rich repeat containing G protein-coupled receptor 5; Znrf3, zinc and ring finger 3; Olfm4, olfactomedin 4; Hopx, homeodomain-only protein X; cdx, caudal-type homeobox.
Animals 13 03864 g001
Animals 13 03864 g002
Figure 2. Effects of dietary L. fermentum and L. paracasei supplementation on serum IgA (A) and cytokine (B,C) levels in broiler chickens challenged with coccidia and C. perfringens on days 13 and 19. Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; IFN-γ, interferon-γ.
Figure 2. Effects of dietary L. fermentum and L. paracasei supplementation on serum IgA (A) and cytokine (B,C) levels in broiler chickens challenged with coccidia and C. perfringens on days 13 and 19. Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; IFN-γ, interferon-γ.
Animals 13 03864 g002
Animals 13 03864 g003
Figure 3. Effects of dietary L. fermentum and L. paracasei supplementation on jejunal cytokine mRNA expression in broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; TGF-β4, transforming growth factor-β4.
Figure 3. Effects of dietary L. fermentum and L. paracasei supplementation on jejunal cytokine mRNA expression in broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; TGF-β4, transforming growth factor-β4.
Animals 13 03864 g003
Animals 13 03864 g004
Figure 4. Effects of dietary L. fermentum and L. paracasei supplementation on cytokine mRNA expression in the cecal tonsil of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; TGF-β4, transforming growth factor-β4.
Figure 4. Effects of dietary L. fermentum and L. paracasei supplementation on cytokine mRNA expression in the cecal tonsil of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. IL, interleukin; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; TGF-β4, transforming growth factor-β4.
Animals 13 03864 g004
Animals 13 03864 g005
Figure 5. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to JAK/STAT and NF-κB signaling in the jejunum of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. JAK, Janus-activated kinase; STAT, signal transducer and activator of transcription; TYK2, tyrosine kinase 2; TAK1, transforming growth factor kinase 1; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; NF-κB, nuclear factor-κB.
Figure 5. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to JAK/STAT and NF-κB signaling in the jejunum of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. JAK, Janus-activated kinase; STAT, signal transducer and activator of transcription; TYK2, tyrosine kinase 2; TAK1, transforming growth factor kinase 1; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; NF-κB, nuclear factor-κB.
Animals 13 03864 g005
Animals 13 03864 g006
Figure 6. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to JAK/STAT and NF-κB signaling in the cecal tonsil of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). Different letters indicate significant differences (p < 0.05) between groups. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. JAK, Janus-activated kinase; STAT, signal transducer and activator of transcription; TYK2, tyrosine kinase 2; TAK1, transforming growth factor kinase 1; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; NF-κB, nuclear factor-κB.
Figure 6. Effects of dietary L. fermentum and L. paracasei supplementation on mRNA expression of genes related to JAK/STAT and NF-κB signaling in the cecal tonsil of broiler chickens challenged with coccidia and C. perfringens on days 13 (A) and 19 (B). Data are presented as means ± SEM (n = 12). Bars with different letters differ significantly (p < 0.05), and bars with the same letters or without letters did not differ significantly (p > 0.05). Different letters indicate significant differences (p < 0.05) between groups. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei. JAK, Janus-activated kinase; STAT, signal transducer and activator of transcription; TYK2, tyrosine kinase 2; TAK1, transforming growth factor kinase 1; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; NF-κB, nuclear factor-κB.
Animals 13 03864 g006
Animals 13 03864 g007
Figure 7. Effects of dietary L. fermentum and L. paracasei supplementation on ileal microbial composition in broiler chickens challenged with coccidia and C. perfringens on days 13 and 19. Relative abundance of microbiota at the phylum level on days 13 (A) and 19 (B); Cluster analysis of microbial composition on days 13 (C) and 19 (D). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Figure 7. Effects of dietary L. fermentum and L. paracasei supplementation on ileal microbial composition in broiler chickens challenged with coccidia and C. perfringens on days 13 and 19. Relative abundance of microbiota at the phylum level on days 13 (A) and 19 (B); Cluster analysis of microbial composition on days 13 (C) and 19 (D). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Animals 13 03864 g007
Animals 13 03864 g008
Figure 8. Relative abundance of ileal microbiota at the genus level on days 13 (A) and 19 (B). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Figure 8. Relative abundance of ileal microbiota at the genus level on days 13 (A) and 19 (B). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Animals 13 03864 g008
Animals 13 03864 g009
Figure 9. LefSe analysis of different phylotypes between groups on days 13 (A) and 19 (B). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Figure 9. LefSe analysis of different phylotypes between groups on days 13 (A) and 19 (B). Data were derived from 8 chickens in each group. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Animals 13 03864 g009
Table 1. The feed ingredient composition and nutritional level (air-dried basis).
Table 1. The feed ingredient composition and nutritional level (air-dried basis).
Ingredient, %Days 0–19Nutrient and Energy Composition 3Days 0–19
Wheat68.69ME, kcal/kg2930
Soybean meal20.32Crude protein, %21.61
Fish meal5.00Lysine, %1.16
Soybean oil2.50Methionine, %0.60
CaHPO41.20Methionine + Cystine, %0.91
Stone powder1.10Calcium, %1.13
NaCl0.35Available phosphorus, %0.48
DL-Met0.26Threonine, %0.75
Choline chloride, 50%0.20Sodium, %0.14
Mineral premix 10.20
L-Lys HCl, 78%0.15
Vitamin premix 20.03
Total100.00
1 Trace element premix (provided per kilogram of feed) included the following substances: Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; selenium, 0.15 mg; iodine, 0.35 mg. 2 Vitamin premix (provided per kilogram of feed) included the following substances: vitamin A, 12,500 IU; vitamin D3, 2500 IU; vitamin E, 18.75 mg; vitamin K3, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; vitamin B12, 0.025 mg; biotin, 0.0325 mg; folic acid, 1.25 mg; nicotinic acid, 50 mg; pantothenic acid, 12 mg. 3 Calculated values.
Table 2. List of gene primer sequences.
Table 2. List of gene primer sequences.
Gene NameAccession NumberPrimer Sequence (5′–3′)Product Size [25]
Lgr5XM_205518.1CCTTTATCAGCCCAGAAGTGA136
TGGAACAAATGCTACGGATG
Znrf3M_015275473.1GCCTCTACCAAGCCCAATCT130
GGTCGTCGGAAGTTGTGAG
Olfm4NM_001040463.1GACTGGCTCTCTGGATGACC108
AGCGTTGTGGCTATCACTTG
HopxNM_204556.1GCAAGGTGAACAAGCATCC227
CCCAAGTAAACCCACTCTGAA
cdxANM_204676.2CAGTGAGTGTCCCCCATGTC92
GGGACAGATGTCTGCAGGTC
cdxBNM_204614.1ATCTGGTTCCAGAATCGCCG141
TGGTGGGAACAGGGAACTTG
IL-1βNM_204524ACTGGGCATCAAGGGCTA131
GGTAGAAGATGAAGCGGGTC
iNOSU46505CAGCTGATTGGGTGTGGAT158
TTTCTTTGGCCTACGGGTC
TNF-αNM_204267GAGCGTTGACTTGGCTGTC64
AAGCAACAACCAGCTATGCAC
IFN-γNM_205149.1AGCTGACGGTGGACCTATTATT259
GGCTTTGCGCTGGATTC
TGF-β4M31160CGGGACGGATGAGAAGAAC258
CGGCCCACGTAGTAAATGAT
IL-13AJ621735CCAGGGCATCCAGAAGC256
CAGTGCCGGCAAGAAGTT
JAK1XM_015290965.1TGCACCGTGACTTAGCAGCAAG168
TCTGAATCAAGCATTCTGGAGCATACC
JAK2XM_015280061.1TCGCTATGGCATTATTCG197
GTGGGGTTTGGTCCTTTT
JAK3NM_204996CAGCCCCAACCAGATGTC106
CCGCTTGATGCCTTTGTAG
STAT1XM_015289392.1TAAAGAGGGAGCAATCAC112
ATCAGGGAAAGTAACAGC
STAT3NM_001030931AGGGCCAGGTGTGAACTACT98
CCAGCCAGACCCAGAAAG
STAT5NM_204779CCCACCCCCATTACAACA114
GCAGCAGCTCCTCCACAT
STAT6XM_015274736.1GCAACCTCTACCCCAACA127
TCCCTTTCGCTTTCCACT
TYK2XM_427671GCCCCATGCAGGAGGAAT119
CTTTGCCACAGCCAGAATCAC
TAK1XM_015284677CCAGGAAACGGACAGCAGAG135
GGTTGGTCCCGAGGTAGTGA
SHP2NM_204968ATGTTGGTGGAGGGGAGAA108
GGGGCTGCTTGAGTTGC
SOCS1NM_001137648CTACTGGGGACCGCTGACC117
TTAACACTGATGGCAAAGAAACAA
NF-κB p65NM_205129GTGTGAAGAAACGGGAACTG203
GGCACGGTTGTCATAGATGG
TGGTGGGAACAGGGAACTTG
ActinNM_205518GAGAAATTGTGCGTGACATCA152
CCTGAACCTCTCATTGCCA
Lgr5, leucine-rich repeat containing G protein-coupled receptor 5; Znrf3, zinc and ring finger 3; Olfm4, olfactomedin 4; Hopx, homeodomain-only protein X; cdxA, caudal- type homeobox 1; cdxB, caudal-type homeobox 4B; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; IL, interleukin; TGF-β4, transforming growth factor β4; iNOS, inducible nitric oxide synthase; JAK, Janus-activated kinase; STAT, signal transducer and activator of transcription; TYK2, tyrosine kinase 2; TAK1, transforming growth factor kinase 1; SHP2, src homology-2 domain-containing protein tyrosine phosphatase 2; SOCS1, suppressors of cytokine-signaling 1; NF-κB, nuclear factor κB.
Table 3. The alpha diversity of ileal microbiota in broiler chickens 1.
Table 3. The alpha diversity of ileal microbiota in broiler chickens 1.
ItemsCTRCCPLF_CCPLP_CCPSEMp Values
Day 13
Shannon2.68 b2.88 b4.20 a3.17 ab0.200.028
Simpson0.67 b0.64 b0.83 a0.69 ab0.030.067
Chao1551.65605.25974.46709.7082.540.282
Ace578.86625.591015.19727.7284.090.260
Day 19
Shannon3.013.903.472.300.290.240
Simpson0.660.730.670.610.040.934
Chao1720.14 ab1001.97 a865.56 ab276.30 b108.350.004
Ace682.06 ab1030.91 a899.93 a295.84 b105.170.001
1 Data are expressed as mean and pooled SEM on days 13 and 19, respectively. Data were derived from 8 chickens in each group. a,b Values within a row with different superscripts differ significantly at p < 0.05. CTR, unchallenged group; CCP, coccidia- and Clostridium perfringens-challenged group; LF_CCP, challenged group with dietary supplementation of Limosilactobacillus fermentum; LP_CCP, challenged group with dietary supplementation of Lacticaseibacillus paracasei.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, S.; Tong, W.; Qi, Y.; Jiang, M.; Li, P.; Zhang, Z.; Hu, Q.; Song, Z.; Ding, B. Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens. Animals 2023, 13, 3864. https://doi.org/10.3390/ani13243864

AMA Style

Guo S, Tong W, Qi Y, Jiang M, Li P, Zhang Z, Hu Q, Song Z, Ding B. Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens. Animals. 2023; 13(24):3864. https://doi.org/10.3390/ani13243864

Chicago/Turabian Style

Guo, Shuangshuang, Wenfei Tong, Ya Qi, Meihan Jiang, Peng Li, Zhengfan Zhang, Qunbing Hu, Zhuan Song, and Binying Ding. 2023. "Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens" Animals 13, no. 24: 3864. https://doi.org/10.3390/ani13243864

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop