Next Article in Journal
Molecular Diversity of Mycobacterium avium subsp. paratuberculosis in Four Dairy Goat Herds from Thuringia (Germany)
Next Article in Special Issue
Phytochemical Composition and Pharmacological Efficacy Evaluation of Calamintha nepeta, Calamintha sylvatica, Lavandula austroapennina and Mentha piperita Essential Oils for the Control of Honeybee (Apis mellifera) Varroosis
Previous Article in Journal
A Comparison of Haematological and Biochemical Profiles between Intrauterine Growth Restriction and Normal Piglets at 72 Hours Postpartum
Previous Article in Special Issue
Insights into the Role of Natural Products in the Control of the Honey Bee Gut Parasite (Nosema spp.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 22
10.3390/ani13223543
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Plant-Based Supplement on Oxidative Stress of Honey Bees (Apis mellifera) Infected with Nosema ceranae

by
Nemanja M. Jovanovic
1,
Uros Glavinic
2,
Marko Ristanic
2,
Branislav Vejnovic
3,
Tamara Ilic
1,
Jevrosima Stevanovic
2,* and
Zoran Stanimirovic
2
1
Department of Parasitology, Faculty of Veterinary Medicine, University of Belgrade, Bul. Oslobodjenja 18, 11000 Belgrade, Serbia
2
Department of Biology, Faculty of Veterinary Medicine, University of Belgrade, Bul. Oslobodjenja 18, 11000 Belgrade, Serbia
3
Department of Economics and Statistics, Faculty of Veterinary Medicine, University of Belgrade, Bul. Oslobodjenja 18, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Animals 2023, 13(22), 3543; https://doi.org/10.3390/ani13223543
Submission received: 11 October 2023 / Revised: 3 November 2023 / Accepted: 14 November 2023 / Published: 16 November 2023
(This article belongs to the Special Issue Apiculture and Challenges for Future—2nd Edition)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Microsporidia Nosema ceranae is an obligate intracellular parasite of the honey bee and causes nosemosis, a disease with negative effects on the health, reproductive and productive capabilities of bee colonies. The aim of this study was to investigate the effects of a plant-based supplement branded as “B+” on honeybees in a laboratory experiment. Food supplement branded as “B+” showed the potential to positively influence bee survival. Supplemental feeding reduced N. ceranae infection level. Treatment significantly decreased oxidative stress in Nosema-infected bees. Vitellogenin gene expression was the highest in the supplement-fed group.

Abstract

One of the most important approaches in the prevention and treatment of nosemosis is the use of herbal preparations as food supplements for bees. Therefore, the aim of this study was to investigate the effects of a plant-based supplement branded as “B+” on honeybees in a laboratory experiment. Four experimental groups were established: treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI). Survival, N. ceranae spore load and oxidative stress parameters together with expression levels of antioxidant enzyme genes and vitellogenin gene were monitored. The mortality in the T, IT and NI groups was significantly (p < 0.001) lower than in than in the I group. Within Nosema-infected groups, the IT group had a significantly lower (p < 0.001) number of N. ceranae spores than the I group. In addition, expression levels of genes for antioxidant enzymes were lower (p < 0.001) in the IT group compared to the I group. The concentration of malondialdehyde and the activities of antioxidant enzymes (superoxide dismutase, catalase and glutathione S-transferase) were significantly lower (p < 0.001) in the IT group compared to the I group. No negative effects of the tested supplement were observed. All these findings indicate that the tested supplement exerted beneficial effects manifested in better bee survival, reduced N. ceranae spore number and reduced oxidative stress of bees (lower expression of genes for antioxidant enzymes and oxidative stress parameters).

Graphical Abstract

1. Introduction

The Western honey bee (Apis mellifera) is the most significant pollinator worldwide [1]. Appropriate pollination increases the quality and quantity of fruit, nut, vegetable, seed, oil and fiber crops [1,2]. On the other hand, the nutrition of honey bees depends on the collected nectar and pollen, which are then transformed into honey and bee bread in the hive, providing carbohydrates, proteins, lipids, vitamins and minerals [3]. Food availability and nutritional balance play a central role in regulating physiological processes including resilience to oxidative stress, adequate immune response, interaction with pathogens, brood production and development and winter survival of colonies [4].
Various abiotic and biotic stressors can negatively affect bees, and several of them have synergistic effects on the health of bee colonies and can reduce their survival [4,5]. Numerous factors that have been contributing to bee colony losses are described, most notably the diseases of infectious and parasitic etiology, in-hive chemical substances, agrochemicals, beekeeping management, climate change, modified land use and changes in land cultivation [4,6,7,8,9]. The lack of natural plant diversity in agricultural systems can limit the availability of pollen and nectar, which has a significant impact on pollinators. Consequently, nutritional stress has a direct impact on the behavior and physiology of bees, affects honey bee lifespan, their immunocompetence and resistance to pathogens [4,10]. This type of stress typically affects honey bee colonies over the long term, which is detrimental to bee health and their productive and reproductive characteristics [5,11,12]. Poor nutrition can impair bees’ resistance to other stressors and even increase their mortality [13,14]. Infection with the parasitic microsporidium Nosema ceranae, recently redefined to Vairimorpha [15], is one of the most frequent biotic stressors of honey bees worldwide [16,17,18,19,20], including Serbia [21]. It has been shown that N. ceranae suppresses the honey bee immunity and causes oxidative stress [4,22,23,24,25], and energetic stress [26,27], and decreases honey bee colony strength [5] and their hygienic behavior [4]. Many studies indicate that virulence of N. ceranae increases in combination with other stressors, including chemical substances and other pathogens/parasites [28,29,30,31]. Such interaction between stressors could explain the widespread colony losses reported in different parts of the world.
Low-quality bee forage and/or a nutritional deficiency promote the multiplication of N. ceranae [4,27,32,33]. Good Beekeeping Practice, especially the hygienic aspect, is crucial for the prevention of endoparasite expansion in hives [34]. In addition, supplementing bee diet with natural-based preparations based on botanical essential oils, organic acids, mushroom polysaccharides, bacteria and their metabolites are also very important strategies in the prevention and treatment of nosemosis [4,5,22,23,24,25,35,36,37]. Taking everything into consideration, the aim of this research was to examine the effects of a plant-based supplement of the brand name “B+” added to the bee diet in a laboratory experiment by analyzing (i) bee survival, (ii) the dynamics of N. ceranae development, (iii) the expression levels of antioxidant enzyme-encoding genes and vitellogenin gene and (iv) oxidative stress parameters in bees infected with microsporidia N. ceranae.

2. Material and Methods

2.1. Supplement

In this experiment, the herbal supplement, with the brand name “B+” (Certificate No. RS 30242), containing wheat bran, essential oils, cinnamon, dextrose, brewer’s yeast, lecithin, saturated and unsaturated fatty acids, plant proteins, essential amino acids, lipids and B vitamin mineral complex was tested [5]. The feeding solution was made of 1 g of supplement per liter of sugar (saccharose) syrup 50% (w/v) as recommended by the manufacturer’s instructions.

2.2. Experimental Design

The bees used in this experiment originated from the experimental apiary of the Faculty of Veterinary Medicine, University of Belgrade. Bee colonies were clinically healthy, with no signs of disease of adult bees or brood.
Frames with sealed brood were taken from five randomly chosen hives, transported to the laboratory and placed into the incubator at 34 ± 1 °C and 66 ± 1% relative humidity as described in Glavinic et al. [22]. After twenty-four hours, newly emerged bees were placed into the specially designed cages described by Glavinic et al. [22]. Each cage contained 110 bees. Bees were fed ad libitum with sugar (saccharose) syrup 50% (w/v).
The following experimental groups were formed: treated group—bees fed with the addition of test supplement (T); treated and infected group—bees fed with the addition of test supplement and infected with N. ceranae spores (IT). In addition, two control groups were established: N. ceranae-infected group (I), and non-infected group, containing non-infected bees (NI). Each group included six cages and the experiment was repeated twice.
On the third day of the experiment, workers in groups IT and I were infected with N. ceranae spores, whose species affiliation had been previously confirmed using the PCR technique as described in Stevanovic et al. [21]. Inoculum preparation (concentration 106 spores/mL) and infection of bees were conducted as described in Glavinic et al. [22].
From each cage, on days 7 and 14, 10 bees were sampled for RNA extraction and measurements of transcript levels of genes for antioxidant enzymes and vitellogenin, 15 bees for measurement of oxidative stress parameters and 15 bees for N. ceranae spore count. The remaining 30 bees in each cage were used for survival monitoring until the end of the experiment. Each day, dead bees were removed and their quantity in each cage recorded in order to estimate the survival rate.

2.3. Nosema Spore Counting

The abdomens of the bees were individually macerated in 1.5 mL tubes with 3 mm tungsten carbide beads (Qiagen, Valencia, Germany) in a TissueLyser II (Qiagen, Valencia, Germany) for 1 min at 25 Hz [25]. Nosema ceranae spores were quantified using a haemocytometer according to Cantwell [38].

2.4. Gene Expression Analyses

The extraction of total RNA from the sampled bees was performed using the Quick-RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. For cDNA synthesis, 1000 ng of RNA per sample were reverse-transcribed using RevertAid™First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Vilnius, Lithuania).
Real-Time PCR analysis of gene expression levels was performed using the commercial kit KAPA SYBR® FAST Master Mix (2X) Universal” (KAPA Biosystems, Boston, MA, USA). Gene expression levels for antioxidant enzymes directly involved in the scavenging of superoxide radicals and H2O2 were investigated. These enzymes included cytoplasmic Cu-Zn superoxide dismutase (Cu/Zn SOD), mitochondrial Mn superoxide dismutase (MnSOD), catalase (CAT) and glutathione S-transferase (GST). In addition, transcript levels of vitellogenin gene were also monitored. The primers for target genes and an internal control gene are listed in Table 1. Quantification was performed via Rotor-Gene Q 5plex (Qiagen, Valencia, CA, USA) for 45 cycles at 95 °C (5 s), 60 °C (30 s) and 72 °C (5 s) after initial denaturion at 95 °C for 2 min. Fluorescence was measured at the end of the annealing stage of every cycle. The 2−ΔΔCt method as described in Glavinic et al. [22] was used. The median value of the NI group served as a calibrator, while β-actin was used as an internal control gene [22].

2.5. Analyses of Oxidative Stress Parameters

The spectrophotometric analyses described in Dubovskiy et al. [41] were used for measurements of the following oxidative stress parameters: activities of the antioxidative enzymes superoxide dismutase (SOD), catalase (CAT) and glutathione S-transferase (GST), and the concentrations of malondialdehyde (MDA). On each sampling day (7th and 14th), pools of 15 bees collected from each cage were used for analyses on a UV/VIS Spectrophotometer BK-36 S390 (Biobase Biodustry, Shanghai, China).

2.6. Statistic Analyses

The assessment of bee survival was conducted by monitoring the daily count of dead bees within each experimental group. The data of survival distribution were obtained via the Kaplan–Meier survival estimator and compared using the log-rank test.
The results of N. ceranae spore loads, expression levels of genes (for GST, MnSOD, CuZnSOD, CAT and vitellogenin) and values of oxidative stress parameters (GST, SOD and CAT activities and MDA concentration) were tested for normality via Shapiro–Wilk’s test.
The results of N. ceranae spore loads were compared between groups using the unpaired t-test, and within each group using paired t-test.
Given that some data for gene expression levels (MnSOD, CuZnSOD, CAT and vitellogenin) were not normally distributed (Shapiro–Wilk’s test, p < 0.05), adequate transformations were made: MnSOD and CuZnSOD were expressed as log10(y + 5), CAT was expressed as log10(y + 3) and for the vitellogenin, log10(y + 10) transformation was applied. Gene expression levels and values of oxidative stress parameters were compared via two-way ANOVA with repeated measures in one factor, followed by Sidak’s test within and Tukey’s test between groups over time. Statistical significance levels were calculated: p < 0.05, p < 0.01 and p < 0.001. Statistical analysis was carried out using statistical software GraphPad Prism version 7 (GraphPad, San Diego, CA, USA).

3. Results

3.1. Bee Survival

The number of dead bees at the end of the experiment was significantly higher (p < 0.001) in the infected group (I) compared to treated (T), treated and infected (IT) and non-infected (NI). A significantly higher (p < 0.001) number of dead bees was also recorded in the IT group compared to the T group (Figure 1, Supplementary Table S1).

3.2. Quantification of N. ceranae Spore Loads

On both sampling occasions, days 7 and 14, neither the group fed with the test supplement nor the non-infected group contained N. ceranae spores. Based on a paired t-test, the number of spores in groups IT and I on day 14 was significantly higher (p < 0.001) than on day 7 (Figure 2A). Using an unpaired t-test to compare the results between groups, a significantly lower (p < 0.001) number of spores was detected in the IT group compared to the I group on both days 7 and 14 (Figure 2B).

3.3. Gene Expression Analyses

In the infected group, according to Sidak’s test, the level of GST gene expression was significantly higher (p < 0.001) on day 14 compared to day 7 (Figure 3, Supplementary Figure S1A). On day 14, according to Tukey’s test, the value of GST gene expression was significantly higher (p < 0.001) in the I group than in the IT and T groups (Figure 3, Supplementary Figure S1B). Gene expression levels of MnSOD were not significant between sampling occasions (on days 7 and 14) within each group and between groups at each sampling occasion (Supplementary Figure S3A,B). On day 7, the highest level of Cu-Zn SOD gene expression was found in the I group, which was significantly higher (p < 0.01 and p < 0.05) compared to the T and IT groups, respectively (Figure 3, Supplementary Figure S2B). The level of CAT gene expression on both sampling days (7 and 14) was significantly higher (p < 0.01 and p < 0.001) in group I when compared to the IT and T groups, respectively (Figure 3, Supplementary Figure S4B). On days 7 and 14, the expression level of the vitellogenin gene was significantly higher in group T (p < 0.05, p < 0.01 and p < 0.001) than in groups IT and I, respectively (Figure 3, Supplementary Figure S5B).

3.4. Oxidative Stress Parameters

According to Sidak’s test, the activities of GST, SOD and CAT and the concentration of malondialdehyde (MDA) were significantly higher (p < 0.05 and p < 0.001) in the infected group on day 14 compared to day 7 (Figure 4A, Figure 5A, Figure 6A and Figure 7A). On day 7, Tukey’s test revealed that the activities of the examined enzymes GST, CAT and SOD were significantly higher (p < 0.05 and p < 0.001) in the I group compared to the T, IT and NI groups. On day 14, however, the most significant changes in enzyme activity were determined. GST, CAT and SOD enzyme activities were significantly higher (p < 0.001) in group I compared to groups T, IT and NI. Also, Tukey’s test revealed that GST activity was higher (p < 0.05) in the IT group than in the T group, whereas CAT activity was higher (p < 0.05 and p < 0.001) in the IT group than in the T and NI groups (Figure 4B, Figure 5B and Figure 6B). On days 7 and 14, the concentration of malondialdehyde was significantly higher (p < 0.001) in the I group than in the T, IT and NI groups. At the end of the experiment, the concentration of MDA in the IT group was significantly higher (p < 0.05 and p < 0.001) than in the T group (Figure 7B).

4. Discussion

Several investigations over the past ten years have shown positive effects of various supplements and organic extracts on the health and survival of N. ceranae-infected bees [22,24]. In a review paper by Marín-García et al. [37], numerous plant extracts with a positive impact on the survival of Nosema-infected bees were described. In our study, a higher rate of survival was detected in the group of bees that were simultaneously infected with N. ceranae and received the supplement (IT) compared to the infected group (I) where N. ceranae infection caused the highest bee mortality. The absence of significant differences in bee mortality between the non-infected group (NI) and bees fed with tested supplement (T) confirms that the supplement “B+” has a positive effect on bee survival.
The presence of N. ceranae spores in the infected groups (I and IT) and their absence in the non-infected groups (T and NI) show that there was no cross-contamination between the experimental groups. On days 7 and 14, the number of N. ceranae spores was significantly higher in the infected group (I) than in the infected and supplemented group (IT). This could be explained by the fact that certain substances in supplements (vitamins and minerals) tested by other authors [22,24], which have similar ingredients to the “B+” supplement, exerted an immunostimulatory effect which probably maintains a lower infection level compared to the infected group.
In the IT group of this study, an increase in N. ceranae spore number on day 14 compared to day 7 was found. In several studies [42,43,44], it has been shown that feeding bees with pollen/bread simultaneously increases the development of the endoparasite N. ceranae but also increases the survival rate of bees relative to those fed only with syrup without a protein source. This indicates that bees that are adequately fed, i.e., not under nutritional stress, can effectively combat bee pathogens which is in accordance with the results of this research because survival was better in the IT group compared to the I group. In accordance with that, our previous results [5] revealed that colonies fed with the supplement “B+” had a decreased level of N. ceranae infection. Additionally, in these colonies, there were more worker bees, greater areas of open and sealed brood, and more food reserves (honey and pollen/bread).
Analyzing the results of the expression levels of genes important for the synthesis of antioxidant enzymes at two sampling occasions (on day 7 and day 14) revealed significant differences between the experimental groups. Several studies have demonstrated that the production of reactive oxidative species (ROS) is one of the most important parts of immune response to the presence of pathogens, including microsporidum N. ceranae [22,24,45]. Reactive oxidative species, which are effective antimicrobial compounds, are generated in the oxidation-reduction processes. An increase in the oxidation-reduction process in the gastrointestinal epithelial cells of bees infected with N. ceranae indicates an increase in the production of ROS in response to infection [22,24,45]. In our experiment, a higher level of gene expression for CuZnSOD and CAT was detected on day 7 in the infected group (I) compared to the other two groups (T and IT), as a result of the bees’ response to N. ceranae infection. At the end of the experiment on day 14, an increase in the activity of genes for GST and CAT confirmed that this microsporidium causes overexpression of oxidation-related genes [45]. In our previous study [46], in which the effect of lithium citrate was tested, the expression levels of genes for antioxidant enzymes depended on pathogen load. In contrast to the infected group (I), bees that were infected and supplemented (group IT) had lower gene transcript levels. The reason for this is undoubtedly the lower number of N. ceranae spores due to supplementation, but we cannot overlook the fact that certain substances of the tested supplement “B+” act as antioxidants and neutralize ROS. Expression levels of genes for antioxidant enzymes in group T, which were not different compared to group IT, provide additional confirmation of the tested supplement’s positive effects.
By analyzing the activities of antioxidant enzymes (GST, SOD and CAT) and the MDA concentration, it was determined that their values were highest in the I group. Our findings which demonstrate that Nosema infection induces oxidative stress in honeybees are in accordance with earlier research [22,23,24,25]. Dussaubat et al. [45] stated that the generation of ROS with antimicrobial properties by bees is ineffective against N. ceranae infection, which was determined in our experiment by counting Nosema spores in group I. In contrast, the activities of the observed parameters were lower in the IT group compared to the I group. Consequently, it can be concluded that nutrition with the addition of our investigated supplement (“B+”) likely plays an important role in the antioxidant protection of bees, which is consistent with the findings of Glavinic [23] that bees infected with N. ceranae and fed with dietary amino acid and vitamin complex (which, among other things, also contains B vitamin complex) have a lower level of oxidative stress.
The tested supplement (“B+”) also had a positive effect on the expression of the gene for vitellogenin, which was highest in group T, indicating that the expression of this gene is related to the nutritional quality of the bees’ diet. Given that this gene is expressed in the fat body, which is the primary nutrient storage [47], it is reasonable to expect a rise in vitellogenin expression due to nutritive factors. Pollen feeding increases the transcription of genes involved in the expression of vitellogenin [33,48]. For example, the diet with lipid rich pollen (Erica sp. pollen) had the greatest influence on the expression of this gene [47]. In groups infected with N. ceranae microsporidium in our study (IT and I), although no difference was found between the groups, a higher level of vitellogenin gene expression was observed in the IT group, similar to how pollen feeding increased the transcription of genes associated with vitellogenin expression in the studies of Borba et al. [48] and Castelli et al. [33]. In contrast, supplemental feeding of queens with FeedBee® did not influence vitellogenin gene expression [49]. It was proved that Nosema infection suppressed vitellogenin gene expression [22,23,24,25]. In accordance with the findings of Dussaubat et al. [45] and Glavinic et al. [22,24,25], lower levels of vitellogenin gene expression observed in this study are attributable to the pathogenic effect of microsporidium N. ceranae, reflected in increased oxidative stress and decreased vitellogenin gene expression levels.

5. Conclusions

Our findings indicate that the tested supplement investigated in a laboratory (cage) experiment showed the potential to (i) positively influence bee survival; (ii) reduce N. ceranae infection level; (iii) reduce oxidative stress of infected bees by decreasing the activity of antioxidative enzymes; and (iv) simultaneously reduce the expression of the genes that encode them.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13223543/s1, Table S1: Survival of bees in treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI). Figure S1: Mean values for the relative gene expression of glutathione S-transferase; Figure S2: Mean values for the relative gene expression of cytoplasmatic Cu-Zn superoxide dismutase. Figure S3: Mean values for the relative gene expression of mitochondrial Mn superoxide dismutase; Figure S4: Mean values for the relative gene expression of catalase; Figure S5: Mean values for the relative gene expression of vitellogenin.

Author Contributions

Conceptualization: N.M.J., U.G. and Z.S.; design of experiment and methodology: N.M.J., U.G. and Z.S.; laboratory analysis: N.M.J., U.G., B.V. and M.R.; data curation: N.M.J., M.R., J.S., T.I. and B.V.; writing, review and editing: N.M.J., T.I., M.R., B.V., U.G., J.S. and Z.S. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by the Ministry of Science, Technological Development and Innovation of the Republic of Serbia (Contract No. 451-03-47/2023-01/200143) for the project led by Zoran Stanimirovic.

Institutional Review Board Statement

Ethical review and approval were waived for this study due to the study of invertebrates only (honey bees are exempted from ethical review).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Khalifa, S.A.; Elshafiey, E.H.; Shetaia, A.A.; El-Wahed, A.A.A.; Algethami, A.F.; Musharraf, S.G.; AlAjmi, M.F.; Zhao, C.; Masry, S.H.; Abdel-Daim, M.M.; et al. Overview of bee pollination and its economic value for crop production. Insects 2021, 12, 688. [Google Scholar] [CrossRef]
  2. Giannini, T.C.; Cordeiro, G.D.; Freitas, B.M.; Saraiva, A.M.; Imperatriz-Fonseca, V.L. The dependence of crops for pollinators and the economic value of pollination in Brazil. J. Econ. Entomol. 2015, 108, 849–857. [Google Scholar] [CrossRef] [PubMed]
  3. Lipiński, Z. Honey Bee Nutrition and Feeding In Temperate/Continental Climate of the Northern Hemisphere. Published by author, Olsztyn, Poland, 2018, pp 15–137. Available online: https://www.evacranetrust.org/page/honeybee-nutrition-and-feeding (accessed on 10 October 2023).
  4. Stanimirovic, Z.; Glavinic, U.; Ristanić, M.; Aleksic, N.; Jovanovic, N.M.; Vejnovic, B.; Stevanovic, J. Looking for the causes of and solutions to the issue of honey bee colony losses. Acta Vet.—Beograd 2019, 69, 1–31. [Google Scholar] [CrossRef]
  5. Jovanovic, N.M.; Glavinic, U.; Delic, B.; Vejnovic, B.; Aleksic, N.; Mladjan, V.; Stanimirovic, Z. Plant-based supplement containing B-complex vitamins can improve bee health and increase colony performance. Prev. Vet. Med. 2021, 190, 105322. [Google Scholar] [CrossRef] [PubMed]
  6. Jacques, A.; Laurent, M.; Epilobee Consortium; Ribière-Chabert, M.; Saussac, M.; Bougeard, S.; Budge, G.E.; Hendrikx, P.; Chauzat, M.P. A pan-European epidemiological study reveals honey bee colony survival depends on beekeeper education and disease control. PLoS ONE 2017, 12, e0172591. [Google Scholar] [CrossRef] [PubMed]
  7. Al Naggar, Y.; Baer, B. Consequences of a short time exposure to a sublethal dose of Flupyradifurone (Sivanto) pesticide early in life on survival and immunity in the honeybee (Apis mellifera). Sci. Rep. 2019, 9, 19753. [Google Scholar] [CrossRef] [PubMed]
  8. Al Naggar, Y.; Paxton, R.J. Mode of transmission determines the virulence of black queen cell virus in adult honey bees, posing a future threat to bees and apiculture. Viruses 2020, 12, 535. [Google Scholar] [CrossRef]
  9. Al Naggar, Y.; Paxton, R.J. The novel insecticides flupyradifurone and sulfoxaflor do not act synergistically with viral pathogens in reducing honey bee (Apis mellifera) survival but sulfoxaflor modulates host immunocompetence. Microb. Biotechnol. 2021, 14, 227–240. [Google Scholar] [CrossRef]
  10. Di Pasquale, G.; Alaux, C.; Le Conte, Y.; Odoux, J.F.; Pioz, M.; Vaissière, B.E.; Belzunces, L.P.; Decourtye, A. Variations in the availability of pollen resources affect honey bee health. PLoS ONE 2016, 11, e0162818. [Google Scholar] [CrossRef]
  11. Branchiccela, B.; Castelli, L.; Corona, M.; Díaz-Cetti, S.; Invernizzi, C.; Martínez de la Escalera, G.; Mendoza, Y.; Santos, E.; Silva, C.; Zunino, P.; et al. Impact of nutritional stress on the honeybee colony health. Sci. Rep. 2019, 9, 10156. [Google Scholar] [CrossRef]
  12. Ricigliano, V.A.; Mott, B.M.; Maes, P.W.; Floyd, A.S.; Fitz, W.; Copeland, D.C.; Meikle, W.G.; Anderson, K.E. Honey bee colony performance and health are enhanced by apiary proximity to US Conservation Reserve Program (CRP) lands. Sci. Rep. 2019, 9, 4894. [Google Scholar] [CrossRef] [PubMed]
  13. Dolezal, A.G.; Toth, A.L. Feedbacks between nutrition and disease in honey bee health. Curr. Opin. Insect. Sci. 2018, 26, 114–119. [Google Scholar] [CrossRef] [PubMed]
  14. Dolezal, A.G.; Carrillo-Tripp, J.; Judd, T.M.; Allen Miller, W.; Bonning, B.C.; Toth, A.L. Interacting stressors matter: Diet quality and virus infection in honeybee health. R. Soc. Open Sci. 2019, 6, 181803. [Google Scholar] [CrossRef] [PubMed]
  15. Tokarev, Y.S.; Huang, W.F.; Solter, L.F.; Malysh, J.M.; Becnel, J.J.; Vossbrinck, C.R. A formal redefinition of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) and reassignment of species based on molecular phylogenetics. J. Invertebr. Pathol. 2020, 169, 107279. [Google Scholar] [CrossRef] [PubMed]
  16. Martín-Hernández, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20, 1302–1329. [Google Scholar] [CrossRef] [PubMed]
  17. Pacini, A.; Molineri, A.; Antúnez, K.; Cagnolo, N.B.; Merke, J.; Orellano, E.; Bertozzi, E.; Zago, L.; Aignasse, A.; Pietronave, H.; et al. Environmental conditions and beekeeping practices associated with Nosema ceranae presence in Argentina. Apidologie 2021, 52, 400–417. [Google Scholar] [CrossRef]
  18. Lage, V.M.G.B.; Santana, C.D.; Patrocínio, E.; Noronha, R.P.; Melo, R.L.D.; Barbosa, C.D.J.; Lima, S.T.D.C. Prevalence of Nosema ceranae in apiculture regions of Bahia State, Brazil. Cienc. Rural 2022, 52, e20210473. [Google Scholar] [CrossRef]
  19. Blot, N.; Clémencet, J.; Jourda, C.; Lefeuvre, P.; Warrit, N.; Esnault, O.; Delatte, H. Geographic population structure of the honeybee microsporidian parasite Vairimorpha (Nosema) ceranae in the South West Indian Ocean. Sci. Rep. 2023, 13, 12122. [Google Scholar] [CrossRef]
  20. Kipkoech, A.; Okwaro, L.A.; Muli, E.; Lattorff, H.M.G. Occurrence and distribution of Nosema ceranae in honey bee colonies in the Comoros Islands. J. Apic. Res. 2023, 62, 1197–1206. [Google Scholar] [CrossRef]
  21. Stevanovic, J.; Stanimirovic, Z.; Genersch, E.; Kovacevic, S.R.; Ljubenkovic, J.; Radakovic, M.; Aleksic, N. Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of colony collapse disorder. Apidologie 2011, 42, 49–58. [Google Scholar] [CrossRef]
  22. Glavinic, U.; Stankovic, B.; Draskovic, V.; Stevanovic, J.; Petrovic, T.; Lakic, N.; Stanimirovic, Z. Dietary amino acid and vitamin complex protects honey bee from immunosuppression caused by Nosema ceranae. PLoS ONE 2017, 12, e0187726. [Google Scholar] [CrossRef] [PubMed]
  23. Glavinic, U. The Effects of Various Antimicrobials and Supplements on the Expression of Immune-Related Genes, Oxidative Stress and Survival of Honey Bee Apis mellifera Infected with Microsporidium Nosema ceranae. Ph.D. Thesis, Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia, 2019. [Google Scholar]
  24. Glavinic, U.; Rajkovic, M.; Vunduk, J.; Vejnovic, B.; Stevanovic, J.; Milenkovic, I.; Stanimirovic, Z. Effects of Agaricus bisporus mushroom extract on honey bees infected with Nosema ceranae. Insects 2021, 12, 915. [Google Scholar] [CrossRef] [PubMed]
  25. Glavinic, U.; Blagojevic, J.; Ristanic, M.; Stevanovic, J.; Lakic, N.; Mirilovic, M.; Stanimirovic, Z. Use of thymol in Nosema ceranae control and health improvement of infected honey bees. Insects 2022, 13, 574. [Google Scholar] [CrossRef] [PubMed]
  26. Martín-Hernández, R.; Botías, C.; Barrios, L.; Martínez-Salvador, A.; Meana, A.; Mayack, C.; Higes, M. Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol. Res. 2011, 109, 605–612. [Google Scholar] [CrossRef] [PubMed]
  27. Papežíková, I.; Palíková, M.; Syrová, E.; Zachová, A.; Somerlíková, K.; Kováčová, V.; Pecková, L. Effect of feeding honey bee (Apis mellifera Hymenoptera: Apidae) colonies with honey, sugar solution, inverted sugar, and wheat starch syrup on nosematosis prevalence and intensity. J. Econ. Entomol. 2020, 113, 26–33. [Google Scholar] [CrossRef] [PubMed]
  28. Alaux, C.; Brunet, J.L.; Dussaubat, C.; Mondet, F.; Tchamitchan, S.; Cousin, M.; Brillard, J.; Baldy, A.; Belzunces, L.P.; Le Conte, Y. Interactions between Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera). Environ. Microbiol. 2010, 12, 774–782. [Google Scholar] [CrossRef] [PubMed]
  29. Vidau, C.; Diogon, M.; Aufauvre, J.; Fontbonne, R.; Viguès, B.; Brunet, J.L.; Texier, C.; Biron, D.G.; Blot, N.; El Alaoui, H.; et al. Exposure to sublethal doses of fipronil and thiacloprid highly increases mortality of honeybees previously infected by Nosema ceranae. PLoS ONE 2011, 6, e21550. [Google Scholar] [CrossRef]
  30. Aufauvre, J.; Biron, D.G.; Vidau, C.; Fontbonne, R.; Roudel, M.; Diogon, M.; Viguès, B.; Belzunces, L.P.; Delbac, F.; Blot, N. Parasite-insecticide interactions: A case study of Nosema ceranae and fipronil synergy on honeybee. Sci. Rep. 2012, 2, 326. [Google Scholar] [CrossRef]
  31. Pettis, J.S.; Lichtenberg, E.M.; Andree, M.; Stitzinger, J.; Rose, R. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS ONE 2013, 8, e70182. [Google Scholar] [CrossRef]
  32. Invernizzi, C.; Santos, L.E.; García, E.; Daners, G.; Di Landro, R.; Saadoun, A.; Vique, C.C. Sanitary and nutritional characterization of honeybee colonies in Eucalyptus grandis plantations. Arch. Zootec. 2011, 60, 1303–1314. [Google Scholar] [CrossRef]
  33. Castelli, L.; Branchiccela, B.; Garrido, M.; Invernizzi, C.; Porrini, M.; Romero, H.; Santos, E.; Zunino, P.; Antúnez, K. Impact of nutritional stress on honeybee gut microbiota, immunity, and Nosema ceranae infection. Microb. Ecol. 2020, 80, 908–919. [Google Scholar] [CrossRef] [PubMed]
  34. Formato, G.; Rivera-Gomis, J.; Bubnic, J.; Martín-Hernández, R.; Milito, M.; Croppi, S.; Higes, M. Nosemosis prevention and control. Appl. Sci. 2022, 12, 783. [Google Scholar] [CrossRef]
  35. Braglia, C.; Alberoni, D.; Porrini, M.P.; Garrido, P.M.; Baffoni, L.; Di Gioia, D. Screening of dietary ingredients against the honey bee parasite Nosema ceranae. Pathogens 2021, 10, 1117. [Google Scholar] [CrossRef] [PubMed]
  36. Chaimanee, V.; Kasem, A.; Nuanjohn, T.; Boonmee, T.; Siangsuepchart, A.; Malaithong, W.; Sinpoo, C.; Disayathanoowat, T.; Pettis, J.S. Natural extracts as potential control agents for Nosema ceranae infection in honeybees, Apis mellifera. J. Invertebr. Pathol. 2021, 186, 107688. [Google Scholar] [CrossRef] [PubMed]
  37. Marín-García, P.J.; Peyre, Y.; Ahuir-Baraja, A.E.; Garijo, M.M.; Llobat, L. The role of Nosema ceranae (Microsporidia: Nosematidae) in honey bee colony losses and current insights on treatment. Vet. Sci. 2022, 9, 130. [Google Scholar] [CrossRef] [PubMed]
  38. Cantwell, G.E. Standard methods for counting Nosema spores. Am. Bee J. 1970, 110, 222–223. [Google Scholar]
  39. Li, C.; Xu, B.; Wang, Y.; Yang, Z.; Yang, W. Protein content in larval diet affects adult longevity and antioxidant gene expression in honey bee workers. Entomol. Exp. Appl. 2014, 151, 19–26. [Google Scholar] [CrossRef]
  40. Simone, M.; Evans, J.D.; Spivak, M. Resin collection and social immunity in honey bees. Evolution 2009, 63, 3016–3022. Available online: https://www.jstor.org/stable/27743456 (accessed on 13 November 2023). [CrossRef]
  41. Dubovskiy, I.M.; Martemyanov, V.V.; Vorontsova, Y.L.; Rantala, M.J.; Gryzanova, E.V.; Glupov, V.V. Effect of bacterial infection on antioxidant activity and lipid peroxidation in the midgut of Galleria mellonella L. larvae (Lepidoptera, Pyralidae). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2008, 148, 1–5. [Google Scholar] [CrossRef]
  42. Basualdo, M.; Barragán, S.; Antúnez, K. Bee bread increases honeybee haemolymph protein and promote better survival despite of causing higher Nosema ceranae abundance in honeybees. Environ. Microbiol. Rep. 2014, 6, 396–400. [Google Scholar] [CrossRef]
  43. Porrini, M.P.; Fernández, N.J.; Garrido, P.M.; Gende, L.B.; Medici, S.K.; Eguaras, M.J. In vivo evaluation of antiparasitic activity of plant extracts on Nosema cerana (Microsporidia). Apidologie 2011, 42, 700–707. [Google Scholar] [CrossRef]
  44. Jack, C.J.; Uppala, S.S.; Lucas, H.M.; Sagili, R.R. Effects of pollen dilution on infection of Nosema ceranae in honey bees. J. Insect Physiol. 2016, 87, 12–19. [Google Scholar] [CrossRef]
  45. Dussaubat, C.; Brunet, J.L.; Higes, M.; Colbourne, J.K.; Lopez, J.; Choi, J.H.; Martin-Hernandez, R.; Botias, C.; Cousin, M.; McDonnell, C.; et al. Gut pathology and responses to the microsporidium Nosema ceranae in the honey bee Apis mellifera. PLoS ONE 2012, 7, e37017. [Google Scholar] [CrossRef]
  46. Jovanovic, N.M.; Glavinic, U.; Ristanic, M.; Vejnovic, B.; Stevanovic, J.; Cosic, M.; Stanimirovic, Z. Contact varroacidal efficacy of lithium citrate and its influence on viral loads, immune parameters and oxidative stress of honey bees in a field experiment. Front. Physiol. 2022, 13, 1000944. [Google Scholar] [CrossRef]
  47. Di Pasquale, G.; Salignon, M.; Le Conte, Y.; Belzunces, L.P.; Decourtye, A.; Kretzschmar, A.; Suchail, S.; Brunet, J.L.; Alaux, C. Influence of pollen nutrition on honey bee health: Do pollen quality and diversity matter? PLoS ONE 2013, 8, e72016. [Google Scholar] [CrossRef]
  48. Borba, R.S.; Klyczek, K.K.; Mogen, K.L.; Spivak, M. Seasonal benefits of a natural propolis envelope to honey bee immunity and colony health. J. Exp. Biol. 2015, 218, 3689–3699. [Google Scholar] [CrossRef] [PubMed]
  49. Dolasevic, S. The Influence of Diet on the Quality of Naturally and Artificially Obtained Queen Bees, and Vitellogenin Gene Expression during Their Development. Ph.D. Thesis, Faculty of Agriculture, University of Belgrade, Belgrade, Serbia, 2020. [Google Scholar]
Animals 13 03543 g001
Figure 1. Survival of bees in treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 1. Survival of bees in treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g001
Animals 13 03543 g002
Figure 2. Number of N. ceranae spores in infected group (I) and infected and treated group (IT). (A) Comparison of N. ceranae spore loads within groups between samples collected on days 7 and 14. (B) Comparison of N. ceranae spore loads between groups on samples collected on days 7 and 14. *** p < 0.001.
Figure 2. Number of N. ceranae spores in infected group (I) and infected and treated group (IT). (A) Comparison of N. ceranae spore loads within groups between samples collected on days 7 and 14. (B) Comparison of N. ceranae spore loads between groups on samples collected on days 7 and 14. *** p < 0.001.
Animals 13 03543 g002
Animals 13 03543 g003
Figure 3. Heat map of median values of relative genes’ expression levels, cytoplasmic Cu-Zn superoxide dismutase (Cu/ZnSOD), mitochondrial Mn superoxide dismutase (MnSOD), catalase (CAT), glutathione S-transferase (GST) and vitellogenin at different time points (at days 7 and 14) in the experimental groups. Treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 3. Heat map of median values of relative genes’ expression levels, cytoplasmic Cu-Zn superoxide dismutase (Cu/ZnSOD), mitochondrial Mn superoxide dismutase (MnSOD), catalase (CAT), glutathione S-transferase (GST) and vitellogenin at different time points (at days 7 and 14) in the experimental groups. Treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g003
Animals 13 03543 g004
Figure 4. Superoxide dismutase (SOD) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 4. Superoxide dismutase (SOD) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g004
Animals 13 03543 g005
Figure 5. Catalase (CAT) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 5. Catalase (CAT) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g005
Animals 13 03543 g006
Figure 6. Glutathione-S transferase (GST) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 6. Glutathione-S transferase (GST) activity: (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; ** p < 0.01; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g006
Animals 13 03543 g007
Figure 7. Concentration of malondialdehyde (MDA): (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Figure 7. Concentration of malondialdehyde (MDA): (A) comparisons between sampling occasions (on days 7 and 14) within each group and (B) comparisons between groups at each sampling occasion. * p < 0.05; *** p < 0.001; treated group (T), N. ceranae-infected and treated group (IT), N. ceranae-infected group (I) and non-infected group (NI).
Animals 13 03543 g007
Table 1. Primers used for real-time polymerase chain reaction.
Table 1. Primers used for real-time polymerase chain reaction.
PrimerSequence 5′–3′Reference
Cu/ZnSOD-FTCAACTTCAAGGACCACATAGTG[39]
Cu/ZnSOD-RATAACACCACAAGCAAGACGAG
MnSOD-FGTCGCCAAAGGTGATGTCAATAC[39]
MnSOD-RCGTCTGGTTTACCGCCATTTG
GST-FAGGAGAGGTGTGGAGAGATAGTG[39]
GST-RCGCAAATGGTCGTGTGGATG
CAT-FTTCTACTGTGGGTGGCGAAAG[39]
CAT-RGTGTGTTGTTACCGACCAAATCC
VgMC-FAGTTCCGACCGACGACGA[40]
VgMC-RTTCCCTCCCACGGAGTCC
β-actin-FTTGTATGCCAACACTGTCCTTT[40]
β-actin-RTGGCGCGATGATCTTAATTT
F, forward; R, reverse; GST, glutathione S-transferase; Cu/ZnSOD, cytoplasmic Cu-Zn superoxide dismutase; MnSOD, mitochondrial Mn superoxide dismutase; CAT, catalase; VgMC, vitellogenin; β-actin, beta actin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jovanovic, N.M.; Glavinic, U.; Ristanic, M.; Vejnovic, B.; Ilic, T.; Stevanovic, J.; Stanimirovic, Z. Effects of Plant-Based Supplement on Oxidative Stress of Honey Bees (Apis mellifera) Infected with Nosema ceranae. Animals 2023, 13, 3543. https://doi.org/10.3390/ani13223543

AMA Style

Jovanovic NM, Glavinic U, Ristanic M, Vejnovic B, Ilic T, Stevanovic J, Stanimirovic Z. Effects of Plant-Based Supplement on Oxidative Stress of Honey Bees (Apis mellifera) Infected with Nosema ceranae. Animals. 2023; 13(22):3543. https://doi.org/10.3390/ani13223543

Chicago/Turabian Style

Jovanovic, Nemanja M., Uros Glavinic, Marko Ristanic, Branislav Vejnovic, Tamara Ilic, Jevrosima Stevanovic, and Zoran Stanimirovic. 2023. "Effects of Plant-Based Supplement on Oxidative Stress of Honey Bees (Apis mellifera) Infected with Nosema ceranae" Animals 13, no. 22: 3543. https://doi.org/10.3390/ani13223543

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop