Tetracycline Resistance Genes in Wild Birds from a Wildlife Recovery Centre in Central Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Molecular Analysis
2.2.1. DNA Extraction
2.2.2. DNA Amplification and Sequencing
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Martin, M.F.; Liras, P. Organization and expression of genes involved in the biosynthesis of antibiotics and other secondary metabolites. Annu. Rev. Microbiol. 1989, 43, 173–206. [Google Scholar] [CrossRef] [PubMed]
- Allen, H.K.; Donato, J.; Huimi Wang, H.; Cloud-Hansen, K.A.; Davies, J.; Handelsman, J. Call of the wild: Antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 2010, 8, 251–259. [Google Scholar] [CrossRef] [PubMed]
- Ventola, C.L. The antibiotic resistance crisis: Part 1: Causes and threats. Pharm. Ther. 2015, 40, 277–283. [Google Scholar]
- Plaza-Rodríguez, C.; Alt, K.; Grobbel, M.; Hammerl, J.A.; Irrgang, A.; Szabo, I.; Stingl, K.; Schuh, E.; Wiehle, L.; Pfefferkorn, B.; et al. Wildlife as sentinels of antimicrobial resistance in Germany? Front. Vet. Sci. 2021, 7, 627821. [Google Scholar] [CrossRef]
- Baros Jorquera, C.; Moreno-Switt, A.I.; Sallaberry-Pincheira, N.; Munita, J.M.; Flores Navarro, C.; Tardone, R.; González-Rocha, G.; Singer, R.S.; Bueno, I. Antimicrobial resistance in wildlife and in the built environment in a wildlife rehabilitation center. One Health 2021, 13, 100298. [Google Scholar] [CrossRef]
- Guardabassi, L.; Agerso, Y. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities. FEMS Microbiol. Lett. 2006, 259, 221–225. [Google Scholar] [CrossRef] [Green Version]
- Seyfried, E.E.; Newton, R.J.; Rubert, K.F., IV; Pedersen, J.A.; McMahon, K.D. Occurrence of tetracycline resistance genes in aquaculture facilities with varying use of oxytetracycline. Microb. Ecol. 2010, 59, 799–807. [Google Scholar] [CrossRef] [Green Version]
- Blanco-Peña, K.; Esperón, F.; Torres-Mejía, A.M.; de la Torre, A.; de la Cruz, E.; Jiménez-Soto, M. Antimicrobial resistance genes in pigeons from public parks in Costa Rica. Zoonoses Public Health 2017, 64, e23–e30. [Google Scholar] [CrossRef] [Green Version]
- Di Francesco, A.; Renzi, M.; Borel, N.; Marti, H.; Salvatore, D. Detection of tetracycline resistance genes in European hedgehogs (Erinaceus europaeus) and crested porcupines (Hystrix cristata). J. Wildl. Dis. 2020, 56, 219–223. [Google Scholar] [CrossRef] [Green Version]
- Luo, Y.; Tan, L.; Zhang, H.; Bi, W.; Zhao, L.; Wang, X.; Lu, X.; Xu, X.; Sun, R.; Alvarez, P.J.J. Characteristics of wild bird resistomes and dissemination of antibiotic resistance genes in interconnected bird-habitat systems revealed by similarity of blaTEM polymorphic sequences. Environ. Sci. Technol. 2022, 56, 15084–15095. [Google Scholar] [CrossRef]
- Galhano, B.S.P.; Ferrari, R.G.; Panzenhagen, P.; de Jesus, A.C.S.; Conte-Junior, C.A. Antimicrobial resistance gene detection methods for bacteria in animal-based foods: A brief review of highlights and advantages. Microorganisms 2021, 9, 923. [Google Scholar] [CrossRef] [PubMed]
- Sundsfjord, A.; Simonsen, G.S.; Haldorsen, B.C.; Haaheim, H.; Hjelmevoll, S.-O.; Littauer, P.; Dahl, K.H. Genetic methods for detection of antimicrobial resistance. APMIS 2004, 112, 815–837. [Google Scholar] [CrossRef] [PubMed]
- Singer, R.S.; Ward, M.P.; Maldonado, G. Can landscape ecology untangle the complexity of antibiotic resistance? Nat. Rev. Microbiol. 2007, 4, 943–952. [Google Scholar] [CrossRef] [PubMed]
- Vittecoq, M.; Godreuil, S.; Prugnolle, F.; Durand, P.; Brazier, L.; Renaud, N.; Arnal, A.; Aberkane, S.; Jean-Pierre, H.; Gauthier-Clerc, M.; et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016, 53, 519–529. [Google Scholar] [CrossRef] [Green Version]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Wellington, E.M.H.; Boxall, A.B.A.; Cross, P.; Feil, E.J.; Gaze, W.H.; Hawkey, P.M.; Johnson-Rollings, A.S.; Jones, D.L.; Lee, N.M.; Otten, W.; et al. The role of the natural environment in the emergence of antibiotic resistance in Gram-negative bacteria. Lancet Infect. Dis. 2013, 13, 155–165. [Google Scholar] [CrossRef]
- Poeta, P.; Costa, D.; Igrejas, G.; Rojo-Bezares, B.; Sáenz, Y.; Zarazaga, M.; Ruiz-Larrea, F.; Rodrigues, J.; Torres, C. Characterization of vanA-containing Enterococcus faecium isolates carrying Tn5397-like and Tn916/Tn1545-like transposons in wild boars (Sus scrofa). Microb. Drug Resist. 2007, 13, 151–156. [Google Scholar] [CrossRef]
- Figueiredo, N.; Radhouani, H.; Gonçalves, A.; Rodrigues, J.; Carvalho, C.; Igrejas, G.; Poeta, P. Genetic characterization of vancomycin-resistant enterococci isolates from wild rabbits. J. Basic Microbiol. 2009, 49, 491–494. [Google Scholar] [CrossRef]
- Gonçalves, A.; Igrejas, G.; Radhouani, H.; Correia, S.; Pacheco, R.; Santos, T.; Monteiro, R.; Guerra, A.; Petrucci-Fonseca, F.; Brito, F.; et al. Antimicrobial resistance in faecal enterococci and Escherichia coli isolates recovered from Iberian wolf. Let. Appl. Microbiol. 2013, 56, 268–274. [Google Scholar] [CrossRef]
- Gonçalves, A.; Igrejas, G.; Radhouani, H.; Santos, T.; Monteiro, R.; Pacheco, R.; Alcaide, E.; Zorrilla, I.; Serra, R.; Torres, C.; et al. Detection of antibiotic resistant enterococci and Escherichia coli in free range Iberian Lynx (Lynx pardinus). Sci. Total Environ. 2013, 456–457, 115–119. [Google Scholar] [CrossRef]
- Radhouani, H.; Igrejas, G.; Gonçalves, A.; Pacheco, R.; Monteiro, R.; Sargo, R.; Brito, F.; Torres, C.; Poeta, P. Antimicrobial resistance and virulence genes in Escherichia coli and enterococci from red foxes (Vulpes vulpes). Anaerobe 2013, 23, 82–86. [Google Scholar] [CrossRef] [PubMed]
- Carroll, D.; Wang, J.; Fanning, S.; McMahon, B.J. Antimicrobial resistance in wildlife: Implications for public health. Zoonoses Public Health 2015, 62, 534–542. [Google Scholar] [CrossRef] [PubMed]
- Furness, L.E.; Campbell, A.; Zhang, L.; Gaze, W.H.; McDonald, R.A. Wild small mammals as sentinels for the environmental transmission of antimicrobial resistance. Environ. Res. 2017, 154, 28–34. [Google Scholar] [CrossRef] [PubMed]
- Sato, G.; Oka, C.; Asagi, M.; Ishiguro, N. Detection of conjugative R plasmids conferring chloramphenicol resistance in Escherichia coli isolated from domestic and feral pigeons and crows. Zentralbl. Bakteriol. Orig. A 1978, 241, 407–417. [Google Scholar] [PubMed]
- Bonnedahl, J.; Järhult, J.D. Antibiotic resistance in wild birds. Ups. J. Med. Sci. 2014, 119, 113–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahlstron, C.A.; Ramey, A.M.; Woksepp, H.; Bonnedahl, J. Repeated detection of carbapenemase-producing Escherichia coli in gulls inhabiting Alaska. Antimicrob. Agents Chemother. 2019, 63, e00758-19. [Google Scholar]
- Arnold, K.E.; Williams, N.J.; Bennett, M. ‘Disperse abroad in the land’: The role of wildlife in the dissemination of antimicrobial resistance. Biol. Lett. 2016, 12, 20160137. [Google Scholar] [CrossRef] [Green Version]
- Livermore, D.M.; Warner, M.; Hall, L.M.; Enne, V.I.; Projan, S.J.; Dunman, P.M.; Wooster, S.L.; Harrison, G. Antibiotic resistance in bacteria from magpies (Pica pica) and rabbits (Oryctolagus cuniculus) from west Wales. Environ. Microbiol. 2001, 3, 658–661. [Google Scholar] [CrossRef]
- Shobrak, M.Y.; Abo-Amer, A.E. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris. Braz. J. Microbiol. 2015, 4, 1199–1209. [Google Scholar] [CrossRef] [Green Version]
- Giacopello, C.; Foti, M.; Mascetti, A.; Grosso, F.; Ricciardi, D.; Fisichella, V.; Lo Piccolo, F. Antimicrobial resistance patterns of Enterobacteriaceae in European wild bird species admitted in a wildlife rescue centre. Vet. It. 2016, 52, 139–144. [Google Scholar]
- Guyomard-Rabenirina, S.; Reynaud, Y.; Pot, M.; Albina, E.; Couvin, D.; Ducat, C.; Gruel, G.; Ferdinand, S.; Legreneur, P.; Le Hello, S.; et al. Antimicrobial resistance in wildlife in Guadeloupe (French West Indies): Distribution of a single blaCTX–M–1/IncI1/ST3 plasmid among humans and wild animals. Front. Microbiol. 2020, 11, 1524. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.W.; Choe, J.C.; Jablonski, P.G.; Lee, S. Detection of antibiotic-resistant Escherichia coli from the feces of the Orientalmagpie nestlings. Kor. J. Orni. 2020, 27, 3–9. [Google Scholar] [CrossRef]
- Gambino, D.; Vicari, D.; Vitale, M.; Schirò, G.; Mira, F.; Giglia, M.; Riccardi, A.; Gentile, A.; Giardina, S.; Carrozzo, A.; et al. Study on Bacteria Isolates and Antimicrobial Resistance in Wildlife in Sicily, Southern Italy. Microorganisms 2021, 9, 203. [Google Scholar] [CrossRef] [PubMed]
- Martín-Maldonado, B.; Rodríguez-Alcázar, P.; Fernández-Novo, A.; González, F.; Pastor, N.; López, I.; Suárez, L.; Moraleda, V.; Aranaz, A. Urban birds as antimicrobial resistance sentinels: White storks showed higher multidrug-resistant Eschrichia coli levels than seagulls in central Spain. Animals 2022, 12, 2714. [Google Scholar] [CrossRef]
- Regulation (EC) No 1831/2003 of the European Parliament and of the Council of 22 September 2003 on Additives for Use in Animal Nutrition (Text with EEA Relevance). Available online: http://data.europa.eu/eli/reg/2003/1831/oj (accessed on 3 November 2022).
- Wang, S.; Gao, X.; Gao, Y.; Li, Y.; Cao, M.; Xi, Z.; Zhao, L.; Feng, Z. Tetracycline resistance genes identified from distinct soil environments in China by functional metagenomics. Front. Microbiol. 2017, 8, 1406. [Google Scholar] [CrossRef]
- Hiltunen, T.; Virta, M.; Laine, A.L. Antibiotic resistance in the wild: An eco-evolutionary perspective. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2017, 19, 372. [Google Scholar] [CrossRef] [Green Version]
- Roberts, M.C. Mechanism of Resistance for Characterized tet and otr Genes. 2020. Available online: http://faculty.washington.edu/marilynr/tetweb1.pdf (accessed on 29 October 2022).
- Roberts, M.C. Update on acquired tetracycline resistance genes. FEMS Microbiol. Lett. 2005, 245, 195–203. [Google Scholar] [CrossRef] [Green Version]
- Dönhöfer, A.; Franckenberg, S.; Wickles, S.; Berninghausen, O.; Beckmann, R.; Wilson, D.N. Structural basis for TetM-mediated tetracycline resistance. Proc. Natl. Acad. Sci. USA. 2012, 109, 16900–16905. [Google Scholar] [CrossRef] [Green Version]
- Roberts, M.C. Distribution of tet Resistance Genes among Gram-Positive Bacteria, Mycobacterium, Mycoplasma, Nocardia, Streptomyces and Ureaplasma. Available online: https://faculty.washington.edu/marilynr/tetweb3.pdf (accessed on 29 October 2022).
- Roberts, M.C. Distribution of tet Resistance Genes among Gram-Negative Bacteria. Available online: https://faculty.washington.edu/marilynr/tetweb2.pdf (accessed on 29 October 2022).
- Yang, W.; Moore, I.F.; Koteva, K.P.; Bareich, D.C.; Hughes, D.W.; Wright, G.D. TetX is a flavin-dependent monooxygenase conferring resistance to tetracycline antibiotics. J. Biol. Chem. 2004, 279, 52346–52352. [Google Scholar] [CrossRef] [Green Version]
- Moore, I.F.; Hughes, D.W.; Wright, G.D. Tigecycline is modified by the flavin-dependent monooxygenase TetX. Biochemistry 2005, 44, 11829–11835. [Google Scholar] [CrossRef] [PubMed]
- Fang, L.-X.; Chen, C.; Cui, C.-Y.; Li, X.-P.; Zhang, Y.; Liao, X.-P.; Sun, J.; Liu, Y.-H. Emerging high-level tigecycline resistance: Novel tetracycline destructases spread via the mobile Tet(X). BioEssays 2020, 42, 2000014. [Google Scholar] [CrossRef] [PubMed]
- Roberts, M.C.; Schwarz, S. Tetracycline and phenicol resistance genes and mechanisms: Importance for agriculture, the environment, and humans. J. Environ. Qual. 2016, 45, 576–592. [Google Scholar] [CrossRef] [PubMed]
- Cole, D.; Drum, D.J.; Stalknecht, D.E.; White, D.G.; Lee, M.D.; Ayers, S.; Sobsey, M.; Maurer, J.J. Free-living Canada geese and antimicrobial resistance. Emerg. Infect. Dis. 2005, 11, 935–938. [Google Scholar] [CrossRef] [PubMed]
- Dolejska, M.; Cizek, A.; Literak, I. High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from black-headed gulls in the Czech Republic. J. Appl. Microbiol. 2007, 103, 11–19. [Google Scholar] [CrossRef]
- Marrow, J.; Whittington, J.K.; Mitchell, M.; Hoyer, L.L.; Maddox, C. Prevalence and antibiotic-resistance characteristics of Enterococcus spp. Isolated from free-living and captive raptors in central Illinois. J. Wildl. Dis. 2009, 45, 302–313. [Google Scholar] [CrossRef] [Green Version]
- Guenther, S.; Grobbel, M.; Lübke-Becker, A.; Goedecke, A.; Friedrich, N.D.; Wieler, L.H.; Ewers, C. Antimicrobial resistance profiles of Escherichia coli from common European wild bird species. Vet. Microbiol. 2010, 29, 219–225. [Google Scholar] [CrossRef]
- Kozak, G.K.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [Green Version]
- Hernando-Amado, S.; Coque, T.M.; Baquero, F.; Martínez, J.L. Defining and combating antibiotic resistance from One Health and Global Health perspectives. Nat. Microbiol. 2019, 4, 1432–1442. [Google Scholar] [CrossRef]
- Fuentes-Castillo, D.; Farfán-López, M.; Esposito, F.; Moura, Q.; Fernandes, M.R.; Lopes, R.; Cardoso, B.; Muñoz, M.E.; Cerdeira, L.; Najle, I.; et al. Wild owls colonized by international clones of extended-spectrum β-lactamase (CTX-M)-producing Escherichia coli and Salmonella infantis in the Southern Cone of America. Sci. Total Environ. 2019, 674, 554–562. [Google Scholar] [CrossRef]
- Darwich, L.; Vidal, A.; Seminati, C.; Albamonte, A.; Casado, A.; López, F.; Molina-López, R.A.; Migura-Garcia, L. High prevalence and diversity of extended-spectrum β-lactamase and emergence of OXA-48 producing Enterobacterales in wildlife in Catalonia. PLoS ONE 2019, 14, e0210686. [Google Scholar] [CrossRef] [Green Version]
- Casalino, G.; D’Amico, F.; Dinardo, F.R.; Bozzo, G.; Napoletano, V.; Camarda, A.; Bove, A.; Lombardi, R.; D’Onghia, F.P.; Circella, E. Prevalence and antimicrobial resistance of Campylobacter jejuni and Campylobacter coli in wild birds from a wildlife rescue centre. Animals 2022, 12, 2889. [Google Scholar] [CrossRef] [PubMed]
Family | Bird Species | Spleen n. | Intestine n. |
---|---|---|---|
Corvidae | Pica pica (Eurasian magpie) | 45 | 0 |
Corvus cornix (hooded crow) | 24 | 0 | |
Subtotal | 69 | 0 | |
Ardeidae | Ardea cinerea (heron) | 2 | 2 |
Subtotal | 2 | 2 | |
Scolopacidae | Gallinago gallinago (snipe) | 5 | 0 |
Subtotal | 5 | 0 | |
Anatidae | Mareca strepera (gadwall) | 2 | 0 |
Anas acuta (pintail duck) | 4 | 1 | |
Mareca penelope (Eurasian wigeon) | 23 | 11 | |
Anas platyrhynchos (mallard) | 26 | 12 | |
Spatula querquedula (garganey) | 1 | 0 | |
Spatula clypeata (shoveler duck) | 10 | 2 | |
Aythya fuligula (tufted duck) | 1 | 0 | |
Aythya ferina (pochard) | 1 | 0 | |
Anser anser (goose) | 1 | 0 | |
Tadorna tadorna (shelduck) | 4 | 3 | |
Anas crecca (Eurasian teal) | 79 | 22 | |
Subtotal | 152 | 51 | |
Strigidae | Athene noctua (owl) | 1 | 1 |
Subtotal | 1 | 1 | |
Accipitridae | Accipiter nisus (Eurasian sparrowhawk) | 4 | 1 |
Subtotal | 4 | 1 | |
Falconidae | Falco peregrinus (falcon) | 1 | 1 |
Falco tinnunculus (kestrel) | 3 | 3 | |
Subtotal | 4 | 4 | |
Rallidae | Fulica (coot) | 2 | 1 |
Subtotal | 2 | 1 | |
Columbidae | Columba palumbus (wood pigeon) | 3 | 1 |
Columba livia (pigeon) | 2 | 2 | |
Subtotal | 5 | 3 | |
Laridae | Larus marinus (gull) | 10 | 10 |
Subtotal | 10 | 10 | |
TOTAL | 254 | 73 |
Primers | Sequence (5′-3′) | Target Gene | PCR Product (bp) |
---|---|---|---|
tetL-F | TCGTTAGCGTGCTGTCATTC | tet(L) | 267 |
tetL-R | GTATCCCACCAATGTAGCCG | tet(L) | 267 |
tetM-F | GTGGACAAAGGTACAACGAG | tet(M) | 406 |
tetM-R | CGGTAAAGTTCGTCACACAC | tet(M) | 406 |
tetX-F | CAATAATTGGTGGTGGACC | tet(X) | 468 |
tetX-R | TTCTTACCTTGG CATCC G | tet(X) | 468 |
Spleen | ||||||
---|---|---|---|---|---|---|
Family | Bird Species | Sample n. | tet(L) | tet(M) | tet(L+M) | tet(X) |
Corvidae | magpie | 45 | 0 | 22 (49%) | 10 (22%) | 0 |
hooded crow | 24 | 0 | 13 (54%) | 3 (12.5%) | 0 | |
Subtotal | 69 | 0 | 35 (51%) | 13 (19%) | 0 | |
Ardeidae | heron | 2 | 0 | 0 | 2 (100%) | 0 |
Subtotal | 2 | 0 | 0 | 2 (100%) | 0 | |
Scolopacidae | snipe | 5 | 0 | 0 | 0 | 0 |
Subtotal | 5 | 0 | 0 | 0 | 0 | |
Anatidae | gadwall | 2 | 0 | 1 (50%) | 0 | 0 |
pintail duck | 4 | 0 | 2 (50%) | 0 | 0 | |
Eurasian wigeon | 23 | 0 | 4 (17%) | 0 | 0 | |
mallard | 26 | 1 (4%) | 5 (19%) | 1 (4%) | 0 | |
garganey | 1 | 0 | 0 | 0 | 0 | |
shoveler duck | 10 | 0 | 1 (10%) | 0 | 0 | |
tufted duck | 1 | 0 | 0 | 0 | 0 | |
pochard | 1 | 0 | 1 (100%) | 0 | 0 | |
goose | 1 | 0 | 0 | 0 | 0 | |
shelduck | 4 | 0 | 1(25%) | 0 | 0 | |
Eurasian teal | 79 | 0 | 21 (26.5%) | 2 (2.5%) | 4 (5%) | |
Subtotal | 152 | 1 (0.6%) | 36 (24%) | 3 (2%) | 4 (3%) | |
Strigidae | owl | 1 | 0 | 0 | 1 (100%) | 0 |
Subtotal | 1 | 0 | 0 | 1 (100%) | 0 | |
Accipitridae | Eurasian sparrow hawk | 4 | 1 (25%) | 2 (50%) | 0 | 0 |
Subtotal | 4 | 1 (25%) | 2 (50%) | 0 | 0 | |
Falconidae | falcon | 1 | 1 (100%) | 0 | 0 | 0 |
kestrel | 3 | 0 | 1 (33%) | 2 (67%) | 0 | |
Subtotal | 4 | 1 (25%) | 1 (25%) | 2 (50%) | 0 | |
Rallidae | coot | 2 | 0 | 0 | 0 | 0 |
Subtotal | 2 | 0 | 0 | 0 | 0 | |
Columbidae | wood pigeon | 3 | 0 | 2 (67%) | 0 | 0 |
pigeon | 2 | 0 | 0 | 0 | 0 | |
Subtotal | 5 | 0 | 2 (40%) | 0 | 0 | |
Laridae | gull | 10 | 4 (40%) | 6 (60%) | 0 | 0 |
Subtotal | 10 | 4 (40%) | 6 (60%) | 0 | 0 | |
TOTAL | 254 | 7 (3%) | 82 (32%) | 21 (8%) | 4 (1.5%) |
Intestine | ||||||
---|---|---|---|---|---|---|
Family | Bird Species | Sample n. | tet(L) | tet(M) | tet(L+M) | tet(X) |
Ardeidae | heron | 2 | 0 | 1 (50%) | 0 | 0 |
Subtotal | 2 | 0 | 1 (50%) | 0 | 0 | |
Anatidae | pintail duck | 1 | 0 | 0 | 0 | 0 |
Eurasian wigeon | 11 | 0 | 0 | 0 | 0 | |
mallard | 12 | 0 | 3 (25%) | 0 | 0 | |
shoveler duck | 2 | 0 | 0 | 0 | 0 | |
shelduck | 3 | 0 | 0 | 0 | 0 | |
Eurasian teal | 22 | 1 (4.5%) | 6 (27%) | 0 | 0 | |
Subtotal | 51 | 1 (2%) | 9 (18%) | 0 | 0 | |
Strigidae | owl | 1 | 0 | 0 | 0 | 0 |
Subtotal | 1 | 0 | 0 | 0 | 0 | |
Accipitridae | Eurasian sparrow hawk | 1 | 0 | 0 | 0 | 0 |
Subtotal | 1 | 0 | 0 | 0 | 0 | |
Falconidae | falcon | 1 | 0 | 0 | 0 | 0 |
kestrel | 3 | 0 | 0 | 2 (67%) | 0 | |
Subtotal | 4 | 0 | 0 | 2 (50%) | 0 | |
Rallidae | coot | 1 | 0 | 0 | 0 | 0 |
Subtotal | 1 | 0 | 0 | 0 | 0 | |
Columbidae | wood pigeon | 1 | 0 | 0 | 0 | 0 |
pigeon | 2 | 0 | 0 | 0 | 0 | |
Subtotal | 3 | 0 | 0 | 0 | 0 | |
Laridae | gull | 10 | 1 (10%) | 4 (40%) | 0 | 0 |
Subtotal | 10 | 1 (10%) | 4 (40%) | 0 | 0 | |
TOTAL | 73 | 2 (3%) | 14 (19%) | 2 (3%) | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Francesco, A.; Salvatore, D.; Bertelloni, F.; Ebani, V.V. Tetracycline Resistance Genes in Wild Birds from a Wildlife Recovery Centre in Central Italy. Animals 2023, 13, 76. https://doi.org/10.3390/ani13010076
Di Francesco A, Salvatore D, Bertelloni F, Ebani VV. Tetracycline Resistance Genes in Wild Birds from a Wildlife Recovery Centre in Central Italy. Animals. 2023; 13(1):76. https://doi.org/10.3390/ani13010076
Chicago/Turabian StyleDi Francesco, Antonietta, Daniela Salvatore, Fabrizio Bertelloni, and Valentina Virginia Ebani. 2023. "Tetracycline Resistance Genes in Wild Birds from a Wildlife Recovery Centre in Central Italy" Animals 13, no. 1: 76. https://doi.org/10.3390/ani13010076