Expression Profile of Hydroxysteroid Dehydrogenase-like 2 in Polychaete Perinereis aibuhitensis in Response to BPA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Polychaetes
2.2. Cloning of HSDL2 Full-Length cDNA
2.2.1. Extraction of Total RNA
2.2.2. Rapid Amplification of cDNA Ends of HSDL2 in P. aibuhitensis
2.2.3. Bioinformatic Analysis of HSDL2
2.3. Tissue Distribution of HSDL2 Gene
2.4. Expression, Purification of Recombinant Protein, and Antibody Preparation
2.5. The Expression Pattern of HSDL2 under BPA Exposure
2.5.1. BPA Exposure
2.5.2. Real-Time Fluorescence Quantitative PCR for Gene Expression
2.5.3. Indirect Enzyme-Linked Immunosorbent Assay
2.6. Statistical Analysis
3. Results
3.1. Gene Sequence Analysis of P. aibuhitensis HSDL2
3.2. Comparison of the Peptide Sequence of HSDL2
3.3. Tissue Distribution of HSDL2
3.4. Protein Purification of HSDL2 and Antibody Specificity
3.5. Gene Expression of HSDL2 under BPA Exposure
3.6. HSDL2 Protein Expression in P. aibuhitensis under BPA Exposure
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Michałowicz, J. Bisphenol A, sources, toxicity and biotransformation. Environ. Toxicol. Pharmacol. 2014, 37, 738–758. [Google Scholar] [CrossRef]
- Zhu, Z.; Zuo, Y. Bisphenol A and other alkylphenols in the environment occurrence, fate, health effects and analytical techniques. Adv. Environ. Res. 2013, 2, 179–202. [Google Scholar] [CrossRef] [Green Version]
- Jahromi, F.A.; Moore, F.; Keshavarzi, B.; Mohebbi-Nozar, S.L.; Mohammadi, Z.; Sorooshian, A.; Abbasi, S. Bisphenol A (BPA) and polycyclic aromatic hydrocarbons (PAHs) in the surface sediment and bivalves from Hormozgan Province coastline in the Northern Persian Gulf: A focus on source apportionment. Mar. Pollut. Bull. 2020, 152, 110941. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, L.; Lu, G.; Jiang, R.; Yan, Z.; Li, Y. Occurrence, toxicity and ecological risk of Bisphenol A analogues in aquatic environment—A review. Ecotoxicol. Environ. Saf. 2021, 208, 111481. [Google Scholar] [CrossRef]
- Zhang, Y.; Mi, K.; Xue, W.; Wei, W.; Yang, H. Acute BPA exposure-induced oxidative stress, depressed immune genes expression and damage of hepatopancreas in red swamp crayfish Procambarus clarkii. Fish Shellfish. Immunol. 2020, 103, 95–102. [Google Scholar] [CrossRef]
- Mortazavi, S.; Riyahi Bakhtiari, A.; Sari, A.E.; Bahramifar, N.; Rahbarizade, F. Phenolic endocrine disrupting chemicals (EDCs) in Anzali Wetland, Iran: Elevated concentrations of 4-nonylphenol, octhylphenol and bisphenol A. Mar. Pollut. Bull. 2012, 64, 1067–1073. [Google Scholar] [CrossRef]
- Mu, X.; Huang, Y.; Li, X.; Lei, Y.; Teng, M.; Li, X.; Wang, C.; Li, Y. Developmental effects and estrogenicity of Bisphenol A alternatives in a zebrafish embryo model. Environ. Sci. Technol. 2018, 52, 3222–3231. [Google Scholar] [CrossRef]
- Lee, S.; Kim, C.; Shin, H.; Kho, Y.; Choi, K. Comparison of thyroid hormone disruption potentials by bisphenols A, S, F, and Z in embryo-larval zebrafish. Chemosphere 2019, 221, 115–123. [Google Scholar] [CrossRef]
- Planelló, R.; Martínez-Guitarte, J.L.; Morcillo, G. The endocrine disruptor Bisphenol A increases the expression of HSP70 and ecdysone receptor genes in the aquatic larvae of Chironomus riparius. Chemosphere 2008, 71, 1870–1876. [Google Scholar] [CrossRef]
- Martínez-Paz, P.; Morales, M.; Martínez-Guitarte, J.L.; Morcillo, G. Genotoxic effects of environmental endocrine disruptors on the aquatic insect Chironomus riparius evaluated using the comet assay. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2013, 758, 41–47. [Google Scholar] [CrossRef]
- da Silva, A.Q.; de Souza Abessa, D.M. Toxicity of three emerging contaminants to non-target marine organisms. Environ. Sci. Pollut. Res. Int. 2019, 26, 18354–18364. [Google Scholar] [CrossRef] [PubMed]
- Kim, R.O.; Kim, H.; Lee, Y.M. Evaluation of 4-nonylphenol and bisphenol A toxicity using multiple molecular biomarkers in the water flea Daphnia magna. Ecotoxicology 2019, 28, 167–174. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Guo, J.; Ge, R.S. Environmental pollutants and hydroxysteroid dehydrogenases. Vitam. Horm. 2014, 94, 349–390. [Google Scholar] [PubMed]
- Belyaeva, O.V.; Kedishvili, N.Y. Comparative genomic and phylogenetic analysis of short-chain dehydrogenases/reductases with dual retinol/sterol substrate specificity. Genomics 2006, 88, 820–830. [Google Scholar] [CrossRef] [Green Version]
- Persson, B.; Kallberg, Y.; Oppermann, U.; Jörnvall, H. Coenzyme-based functional assignments of short-chain dehydrogenases/reductases (SDRs). Chem. Biol. Interact. 2003, 143–144, 271–278. [Google Scholar] [CrossRef]
- Tarrant, A.M.; Reitzel, A.M.; Blomquist, C.H.; Haller, F.; Tokarz, J.; Adamski, J. Steroid metabolism in cnidarians: Insights from Nematostella vectensis. Mol. Cell. Endocrinol. 2009, 301, 27–36. [Google Scholar] [CrossRef] [Green Version]
- Ye, L.; Su, Z.J.; Ge, R.S. Inhibitors of testosterone biosynthetic and metabolic activation enzymes. Molecules 2011, 16, 9983–10001. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, Z.; Ma, X.; Liang, S.; Yang, D. Characteristics of 17β-hydroxysteroid dehydrogenase 8 and its potential role in gonad of Zhikong scallop Chlamys farreri. J. Steroid Biochem. Mol. Biol. 2014, 141, 77–86. [Google Scholar] [CrossRef]
- Zhai, H.; Zhou, J.; Cai, Z. Cloning, characterization, and expression analysis of a putative 17 beta-hydroxysteroid dehydrogenase 11 in the abalone, Haliotis diversicolor supertexta. J. Steroid Biochem. Mol. Biol. 2012, 130, 57–63. [Google Scholar] [CrossRef]
- Rhee, J.S.; Won, E.J.; Kim, R.O.; Choi, B.S.; Choi, I.Y.; Park, G.S.; Shin, K.H.; Lee, Y.M.; Lee, J.S. The polychaete, Perinereis nuntia ESTs and its use to uncover potential biomarker genes for molecular ecotoxicological studies. Environ. Res. 2012, 112, 48–57. [Google Scholar] [CrossRef]
- Jørgensen, A.; Giessing, A.M.B.; Rasmussen, L.J.; Andersen, O. Biotransformation of polycyclic aromatic hydrocarbons in marine polychaetes. Mar. Environ. Res. 2008, 65, 171–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Won, E.J.; Rhee, J.S.; Kim, R.O.; Ra, K.; Kim, K.T.; Shin, K.H.; Lee, J.S. Susceptibility to oxidative stress and modulated expression of antioxidant genes in the copper-exposed polychaete Perinereis nuntia. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2012, 155, 344–351. [Google Scholar] [CrossRef] [PubMed]
- Lewis, C.; Watson, G.J. Expanding the ecotoxicological toolbox: The inclusion of polychaete reproductive endpoints. Mar. Environ. Res. 2012, 75, 10–22. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhou, Q.; Zhang, Q.; Zhang, Y. Single and joint effects of petroleum hydrocarbons and cadmium on the polychaete Perinereis aibuhitensis Grube. J. Environ. Sci. 2008, 20, 68–74. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhou, Y.; Yang, D.; Zhao, H.; Wang, L.; Yuan, X. CYP4 mRNA expression in marine polychaete Perinereis aibuhitensis in response to petroleum hydrocarbon and deltamethrin. Mar. Pollut. Bull. 2012, 64, 1782–1788. [Google Scholar] [CrossRef]
- Lv, L.; Dong, X.; Lv, F.; Zhao, W.; Yu, Y.; Yang, W. Molecular cloning and characterization of an estrogen receptor gene in the marine polychaete Perinereis aibuhitensis. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 207, 15–21. [Google Scholar] [CrossRef]
- Zhang, L.J.; Li, Y.; Chen, P.; Li, X.M.; Chen, Y.G.; Hang, Y.Y.; Gong, W.J. A study of genotoxicity and oxidative stress induced by mercuric chloride in the marine polychaete Perinereis aibuhitensis. Environ. Toxicol. Pharmacol. 2017, 56, 361–365. [Google Scholar] [CrossRef]
- Eom, H.J.; Haque, M.N.; Nam, S.E.; Lee, D.H.; Rhee, J.S. Effects of sublethal concentrations of the antifouling biocide Sea-Nine on biochemical parameters of the marine polychaete Perinereis aibuhitensis. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 222, 125–134. [Google Scholar] [CrossRef]
- Zhao, H.; Zhou, Y.; Li, Y.; Li, S.; Yang, D. Molecular cloning and expression of the gene for G protein alpha subunit induced by bisphenol A in marine polychaete Perinereis aibuhitensis. Environ. Toxicol. Pharmacol. 2014, 37, 521–528. [Google Scholar] [CrossRef]
- Li, X.; Song, Z.; Wang, F.; Qin, Y.; Yang, D.; Zhou, Y. Effects of estrogen on sex proportion, growth and oocyte development of sluge worm Perinereis aibuhitensis. J. Dalian Ocean Univ. 2011, 26, 97–101. (In Chinese) [Google Scholar]
- Yuan, X.; Yang, X.; Zhang, A.; Ma, X.; Hui, G.; Na, G.; Zong, H.; Liu, G.; Sun, Y. Distribution, potential sources and ecological risks of two persistent organic pollutants in the intertidal sediment at the Shuangtaizi estuary, Bohai Sea of China. Mar. Pollut. Bull. 2017, 114, 419–427. [Google Scholar] [CrossRef]
- Xue, S.L.; Huang, Y.; Sun, J.; Yang, D.Z.; Zhou, Y.B.; Zhao, H. Reference gene selection for quantitative real-time PCR in Perinereis aibuhitensis under BPA exposure. Asian J. Ecotoxicol. 2019, 14, 136–144. (In Chinese) [Google Scholar]
- Kowalik, D.; Haller, F.; Adamski, J.; Moeller, G. In search for function of two human orphan SDR enzymes: Hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). J. Steroid Biochem. Mol. Biol. 2009, 117, 117–124. [Google Scholar] [CrossRef]
- Kavanagh, K.L.; JÖrnvall, H.; Persson, B.; Oppermann, U. Medium-and short-chain dehydrogenase/reductase gene and protein families: The SDR superfamily: Functional and structural diversity within a family of metabolic and regulatory enzymes. Cell. Mol. Life Sci. 2008, 65, 3895–3906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Liu, K.; Zhao, C.; Gong, P.; Yu, Y. The characterization of a short chain dehydrogenase/reductase (SDRx) in Comamonas testosterone. Toxicol. Rep. 2020, 7, 460–467. [Google Scholar] [CrossRef] [PubMed]
- Oppermann, U.; Filling, C.; Hult, M.; Shafqat, N.; Wu, X.Q.; Lindh, M.; Shafqat, J.; Nordling, E.; Kallberg, Y.; Persson, B.; et al. Short-chain dehydrogenases/reductases (SDR): The 2002 update. Chem. Biol. Interact. 2003, 143–144, 247–253. [Google Scholar] [CrossRef] [PubMed]
- Burgardt, N.I.; Gianotti, A.R.; Ferreyra, R.G.; Ermacora, M.R. A structural appraisal of sterol carrier protein 2. BBA-Proteins Proteom. 2017, 1865, 565–577. [Google Scholar] [CrossRef]
- Cheng, Z.; Li, Y.; Sui, C.; Sun, X.; Xie, Y. Synthesis, purification and crystallographic studies of the C-terminal sterol carrier protein type 2 (SCP-2) domain of human hydroxysteroid dehydrogenase- like protein 2. Acta Crystallogr. Sect. F Struct. Biol. Commun. 2015, 71, 901–905. [Google Scholar] [CrossRef] [Green Version]
- Dai, J.; Li, P.; Ji, C.; Feng, C.; Gui, M.; Sun, Y.; Zhang, J.; Zhu, J.; Dou, C.; Gu, S.; et al. Cloning and characterization of a novel mouse short-chain dehydrogenase/reductases cDNA mHsdl2, encoding a protein with an SDR domain and an SCP2 domain. Mol. Biol. 2005, 39, 696–702. [Google Scholar]
- Corrales, J.; Kristofco, L.A.; Steele, W.B.; Yates, B.S.; Breed, C.S.; Williams, E.S.; Brooks, B.W. Global assessment of bisphenol A in the environment: Review and analysis of its occurrence and bioaccumulation. Dose-Response 2015, 13. [Google Scholar] [CrossRef] [Green Version]
- Morales, M.; Martínez-Paz, P.; Sánchez-Argüello, P.; Morcillo, G.; Martínez-Guitarte, J.L. Bisphenol A (BPA) modulates the expression of endocrine and stress response genes in the freshwater snail Physa acuta. Ecotoxicol. Environ. Saf. 2018, 152, 132–138. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Zhao, P.; Liu, J.; Qi, T.; Liu, Q.; Jiang, S.; Zhang, H.; Wang, Z.; Tang, B.; Ding, G. Transcriptome analysis reveals the tolerance mechanism of mantis shrimp (Oratosquilla oratoria) under a lipopolysaccharide challenge. ACS Omega 2020, 5, 2310–2317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Wang, Q.; Ji, Y.; Zhang, Q.; Wu, H.; Xie, J.; Zhao, J. Identification and mRNA expression of two 17β-hydroxysteroid dehydrogenase genes in the marine mussel Mytilus galloprovincialis following exposure to endocrine disrupting chemicals. Environ. Toxicol. Pharmacol. 2014, 37, 1243–1255. [Google Scholar] [CrossRef] [PubMed]
- Ruokun, C.; Yake, X.; Fengdong, Y.; Xinting, W.; Laijun, S.; Xianzhi, L. Lentivirus-mediated silencing of HSDL2 suppresses cell proliferation in human gliomas. Tumor Biol. 2016, 37, 15065–15077. [Google Scholar] [CrossRef]
- Sun, Q.; Zhang, Y.; Su, J.; Li, T.; Jiang, Y. Role of hydroxysteroid dehydrogenase- like 2 (HSDL2) in human ovarian cancer. Med. Sci. Monit. 2018, 24, 3997–4008. [Google Scholar] [CrossRef]
- Yang, Y.; Han, A.; Wang, X.; Yin, X.; Cui, M.; Lin, Z. Lipid metabolism regulator human hydroxysteroid dehydrogenase like 2 (HSDL2) modulates cervical cancer cell proliferation and metastasis. J. Cell. Mol. Med. 2021, 25, 4846–4859. [Google Scholar] [CrossRef]
- Gunnarsson, L.; Kristiansson, E.; FÖrlin, L.; Nerman, O.; Larsson, D.G.J. Sensitive and robust gene expression changes in fish exposed to estrogen—A microarray approach. BMC Genom. 2007, 8, 149. [Google Scholar] [CrossRef] [Green Version]
- Xiao, L.; Guo, Y.; Wang, D.; Zhao, M.; Hou, X.; Li, S.; Lin, H.; Zhang, Y. Beta-Hydroxysteroid Dehydrogenase Genes in Orange-Spotted Grouper (Epinephelus coioides): Genome-Wide Identification and Expression Analysis During Sex Reversal. Front. Genet. 2020, 11, 161. [Google Scholar] [CrossRef] [Green Version]
- Thongbuakaew, T.; Suwansard, S.; Chaiyamoon, A.; Cummins, S.F.; Sobhon, P. Sex steroids and steroidogenesis-related genes in the sea cucumber, Holothuria scabra and their potential role in gonad maturation. Sci. Rep. 2021, 11, 2194. [Google Scholar] [CrossRef]
- Lindholst, C.; Wynne, P.; Marriott, P.; Pedersen, S.; Bjerregaard, P. Metabolism of bisphenol A in zebrafish (Danio rerio) and rainbow trout (Oncorhynchus mykiss) in relation to estrogenic response. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2003, 135, 169–177. [Google Scholar] [CrossRef]
Primer Name | Sequence Information | Amplification Efficiency (%) | Sequence (5′–3′) |
---|---|---|---|
UPM (universal primer mix) long | RACE | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | |
UPM short | RACE | CTAATACGACTCACTATAGGGC | |
HSDL2-F1 | 3′-RACE | CTAAAGGGTCAGCTCAGGGGTCA | |
HSDL2-F2 | 3′-RACE | GTGTCAATGGGATCTACGCTTTT | |
HSDL2-R1 | 5′-RACE | TTTTTCCAAATCTGTAATGCCTT | |
HSDL2-R2 | 5′-RACE | AATGATTTGCTGTCTTTTGTGAG | |
β-actin-F | Real-time PCR | 99.96 | GGGCTACTCCTTCACCACCA |
β-actin-R | Real-time PCR | CGAAGTCCAGAGCAACATAG | |
HSDL2-F3 | Real-time PCR | 100.59 | GAACATCAGTCCGCCCTTG |
HSDL2-R3 | Real-time PCR | GCTATCCCATCAGGCTTCAGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Zhao, H.; Pang, M.; Huang, Y.; Zhang, B.; Yang, D.; Zhou, Y. Expression Profile of Hydroxysteroid Dehydrogenase-like 2 in Polychaete Perinereis aibuhitensis in Response to BPA. Life 2023, 13, 10. https://doi.org/10.3390/life13010010
Li Y, Zhao H, Pang M, Huang Y, Zhang B, Yang D, Zhou Y. Expression Profile of Hydroxysteroid Dehydrogenase-like 2 in Polychaete Perinereis aibuhitensis in Response to BPA. Life. 2023; 13(1):10. https://doi.org/10.3390/life13010010
Chicago/Turabian StyleLi, Yingpeng, Huan Zhao, Min Pang, Yi Huang, Boxu Zhang, Dazuo Yang, and Yibing Zhou. 2023. "Expression Profile of Hydroxysteroid Dehydrogenase-like 2 in Polychaete Perinereis aibuhitensis in Response to BPA" Life 13, no. 1: 10. https://doi.org/10.3390/life13010010