Hcp Proteins of the Type VI Secretion System Promote Avian Pathogenic E. coli DE205B (O2:K1) to Induce Meningitis in Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacteria, Plasmids and Cell Line
2.2. Phylogenetic Analysis
2.3. Construction of Gene Deletion and Complementation Mutants
2.4. Animal Infections
2.5. Isolation and Identification of Bacteria
2.6. Histopathological Examination and Immunohistochemistry
2.7. RNA Isolation of Brain Tissue and RT-PCR
2.8. Determining the Concentration of Inflammatory Factors
2.9. Growth Curve
2.10. HBMECs Invasion Assays
2.11. Immunofluorescence Assays
2.12. Statistical Analysis
2.13. Ethics Statement
3. Results
3.1. APEC Strain DE205B Genetic Relationship with NMEC Strain RS218
3.2. DE205B Crossed the BBB and Entered the CSF of Rats
3.3. DE205B Caused Meningitis in Rats
3.4. The Effect of DE205B on the Nervous System
3.5. Hcp1 and Hcp2 Jointly Promoted the Invasion of HBMECs
3.6. Protein Hcp2 Was Conducive to DE205B Invading Brain Tissue and Aggravated Inflammatory Response
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Giridharan, V.V.; Simões, L.R.; Dagostin, V.S.; Generoso, J.S.; Rezin, G.T.; Florentino, D.; Muniz, J.P.; Collodel, A.; Petronilho, F.; Quevedo, J.; et al. Temporal changes of oxidative stress markers in Escherichia coli K1-induced experimental meningitis in a neonatal rat model. Neurosci. Lett. 2017, 653, 288–295. [Google Scholar] [CrossRef] [PubMed]
- Hamed, S.A.; Hamed, E.A.; Zakary, M.M. Oxidative stress and S-100B protein in children with bacterial meningitis. BMC Neurol. 2009, 9, 51. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.S. Acute bacterial meningitis in infants and children. Lancet Infect. Dis. 2010, 10, 32–42. [Google Scholar] [CrossRef]
- Kim, K.S. Human Meningitis-Associated Escherichia coli. EcoSal Plus 2016, 7. [Google Scholar] [CrossRef]
- Kim, K.S. Mechanisms of microbial traversal of the blood—brain barrier. Nat. Rev. Microbiol. 2008, 6, 625–634. [Google Scholar] [CrossRef]
- Silver, R.P.; Aaronson, W.; Sutton, A.; Schneerson, R. Comparative analysis of plasmids and some metabolic characteristics of Escherichia coli K1 from diseased and healthy individuals. Infect. Immun. 1980, 29, 200–206. [Google Scholar] [CrossRef]
- Zheng, Y.; Wang, H.; Huang, L.; Zhang, T.; Zong, B.; Ren, X.; Zhu, Y.; Song, F.; Wang, X.; Chen, H.; et al. Effect of O antigen ligase gene mutation on oxidative stress resistance and pathogenicity of NMEC strain RS218. Microb. Pathog. 2019, 136, 103656. [Google Scholar] [CrossRef]
- Xie, Y.; Kolisnychenko, V.; Paul-Satyaseela, M.; Elliott, S.; Parthasarathy, G.; Yao, Y.; Iii, G.P.; Blattner, F.R.; Kim, K.S. Identification and Characterization of Escherichia coli RS218–Derived Islands in the Pathogenesis of E. coli Meningitis. J. Infect. Dis. 2006, 194, 358–364. [Google Scholar] [CrossRef]
- Maruvada, R.; Kim, K.S. IbeA and OmpA of Escherichia coli K1 Exploit Rac1 Activation for Invasion of Human Brain Microvascular Endothelial Cells. Infect. Immun. 2012, 80, 2035–2041. [Google Scholar] [CrossRef]
- Teng, C.-H.; Cai, M.; Shin, S.; Xie, Y.; Kim, K.-J.; Khan, N.A.; Di Cello, F.; Kim, K.S. Escherichia coli K1 RS218 Interacts with Human Brain Microvascular Endothelial Cells via Type 1 Fimbria Bacteria in the Fimbriated State. Infect. Immun. 2005, 73, 2923–2931. [Google Scholar] [CrossRef] [Green Version]
- Kim, K.J.; Elliott, S.J.; Di Cello, F.; Stins, M.F.; Kim, K.S. The K1 capsule modulates trafficking of E. coli-containing vacuoles and enhances intracellular bacterial survival in human brain microvascular endothelial cells. Cell. Microbiol. 2003, 5, 245–252. [Google Scholar] [CrossRef]
- Kim, K.S.; Itabashi, H.; Gemski, P.; Sadoff, J.; Warren, R.L.; Cross, A.S. The K1 capsule is the critical determinant in the development of Escherichia coli meningitis in the rat. J. Clin. Investig. 1992, 90, 897–905. [Google Scholar] [CrossRef] [PubMed]
- Sukumaran, S.K.; Shimada, H.; Prasadarao, N.V. Entry and Intracellular Replication of Escherichia coli K1 in Macrophages Require Expression of Outer Membrane Protein A. Infect. Immun. 2003, 71, 5951–5961. [Google Scholar] [CrossRef] [PubMed]
- Teng, C.-H.; Xie, Y.; Shin, S.; Di Cello, F.; Paul-Satyaseela, M.; Cai, M.; Kim, K.S. Effects of ompA Deletion on Expression of Type 1 Fimbriae in Escherichia coli K1 Strain RS218 and on the Association of E. coli with Human Brain Microvascular Endothelial Cells. Infect. Immun. 2006, 74, 5609–5616. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Xie, Y.; Perace, D.; Zhong, Y.; Lu, J.; Tao, J.; Guo, X.; Kim, K.S. The type III secretion system is involved in the invasion and intracellular survival of Escherichia coli K1 in human brain microvascular endothelial cells. FEMS Microbiol. Lett. 2009, 300, 18–24. [Google Scholar] [CrossRef]
- Mittal, R.; Prasadarao, N.V. gp96 expression in neutrophils is critical for the onset of Escherichia coli K1 (RS218) meningitis. Nat. Commun. 2011, 2, 552. [Google Scholar] [CrossRef]
- Mittal, R.; Sukumaran, S.K.; Selvaraj, S.K.; Wooster, D.G.; Babu, M.M.; Schreiber, A.D.; Verbeek, J.S.; Prasadarao, N.V. Fcgamma Receptor I Alpha Chain (CD64) Expression in Macrophages Is Critical for the Onset of Meningitis by Escherichia coli K1. PLoS Pathog. 2010, 6, e1001203. [Google Scholar] [CrossRef]
- Krishnan, S.; Fernandez, G.E.; Sacks, D.B.; Prasadarao, N.V. IQGAP1 mediates the disruption of adherens junctions to promote Escherichia coli K1 invasion of brain endothelial cells. Cell. Microbiol. 2012, 14, 1415–1433. [Google Scholar] [CrossRef]
- Wang, X.; Maruvada, R.; Morris, A.J.; Liu, J.O.; Wolfgang, M.J.; Baek, D.J.; Bittman, R.; Kim, K.S. Sphingosine 1-Phosphate Activation of EGFR As a Novel Target for Meningitic Escherichia coli Penetration of the Blood-Brain Barrier. PLoS Pathog. 2016, 12, e1005926. [Google Scholar] [CrossRef]
- Chang, A.; Krishnan, S.; Prasadarao, N.V. The effects of cytotoxic necrotizing factor 1 expression in the uptake of Escherichia coli K1 by macrophages and the onset of meningitis in newborn mice. Virulence 2016, 7, 806–818. [Google Scholar] [CrossRef] [Green Version]
- Zhao, W.-D.; Liu, D.-X.; Wei, J.-Y.; Miao, Z.-W.; Zhang, K.; Su, Z.-K.; Zhang, X.-W.; Li, Q.; Fang, W.-G.; Qin, X.-X.; et al. Caspr1 is a host receptor for meningitis-causing Escherichia coli. Nat. Commun. 2018, 9, 2216–2296. [Google Scholar] [CrossRef] [PubMed]
- Pukatzki, S.; Ma, A.T.; Sturtevant, D.; Krastins, B.; Sarracino, D.; Nelson, W.C.; Heidelberg, J.F.; Mekalanos, J.J. Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc. Natl. Acad. Sci. USA 2006, 103, 1528–1533. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Tao, J.; Yu, H.; Ni, J.; Zeng, L.; Teng, Q.; Kim, K.S.; Zhao, G.-P.; Guo, X.-K.; Yao, Y. Hcp Family Proteins Secreted via the Type VI Secretion System Coordinately Regulate Escherichia coli K1 Interaction with Human Brain Microvascular Endothelial Cells. Infect. Immun. 2012, 80, 1243–1251. [Google Scholar] [CrossRef] [PubMed]
- Meena, P.R.; Yadav, P.; Hemlata, H.; Tejavath, K.K.; Singh, A.P. Poultry-origin extraintestinal Escherichia coli strains carrying the traits associated with urinary tract infection, sepsis, meningitis and avian colibacillosis in India. J. Appl. Microbiol. 2021, 130, 2087–2101. [Google Scholar] [CrossRef] [PubMed]
- Tivendale, K.A.; Logue, C.M.; Kariyawasam, S.; Jordan, D.; Hussein, A.; Li, G.; Wannemuehler, Y.; Nolan, L.K. Avian-Pathogenic Escherichia coli Strains Are Similar to Neonatal Meningitis E. coli Strains and Are Able To Cause Meningitis in the Rat Model of Human Disease. Infect. Immun. 2010, 78, 3412–3419. [Google Scholar] [CrossRef] [PubMed]
- Najafi, S.; Rahimi, M.; Nikousefat, Z. Extra-intestinal pathogenic Escherichia coli from human and avian origin: Detection of the most common virulence-encoding genes. Vet. Res. Forum 2019, 10, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, N.M.; Johnson, J.R.; Johnston, B.; Curtiss, R.; Mellata, M. Zoonotic potential of Escherichia coli isolates from retail chicken meat products and eggs. Appl. Environ. Microbiol. 2015, 81, 1177–1187. [Google Scholar] [CrossRef] [PubMed]
- Hejair, H.M.; Ma, J.; Zhu, Y.; Sun, M.; Dong, W.; Zhang, Y.; Pan, Z.; Zhang, W.; Yao, H. Role of outer membrane protein T in pathogenicity of avian pathogenic Escherichia coli. Res. Vet. Sci. 2017, 115, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, S.; Chang, A.C.; Hodges, J.; Couraud, P.O.; Romero, I.A.; Weksler, B.; Nicholson, B.A.; Nolan, L.K.; Prasadarao, N.V. Serotype O18 avian pathogenic and neonatal meningitis Escherichia coli strains employ similar pathogenic strategies for the onset of meningitis. Virulence 2015, 6, 777–786. [Google Scholar] [CrossRef]
- Ma, J.; Bao, Y.; Sun, M.; Dong, W.; Pan, Z.; Zhang, W.; Lu, C.; Yao, H. Two Functional Type VI Secretion Systems in Avian Pathogenic Escherichia coli Are Involved in Different Pathogenic Pathways. Infect. Immun. 2014, 82, 3867–3879. [Google Scholar] [CrossRef] [Green Version]
- Ma, J.; Sun, M.; Pan, Z.; Song, W.; Lu, C.; Yao, H. Three Hcp homologs with divergent extended loop regions exhibit different functions in avian pathogenic Escherichia coli. Emerg. Microbes Infect. 2018, 7, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Sun, M.; Bao, Y.; Pan, Z.; Zhang, W.; Lu, C.; Yao, H. Genetic diversity and features analysis of type VI secretion systems loci in avian pathogenic Escherichia coli by wide genomic scanning. Infect. Genet. Evol. 2013, 20, 454–464. [Google Scholar] [CrossRef]
- Nielsen, D.W.; Ricker, N.; Barbieri, N.L.; Allen, H.K.; Nolan, L.K.; Logue, C.M. Outer membrane protein A (OmpA) of extraintestinal pathogenic Escherichia coli. BMC Res. Notes 2020, 13, 51. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Meng, X.; Li, J.; Chen, Y.; Zhang, D.; Zhong, H.; Xia, P.; Cui, L.; Zhu, G.; Wang, H. Transcriptome profiling of avian pathogenic Escherichia coli and the mouse microvascular endothelial cell line bEnd.3 during interaction. PeerJ 2020, 8, e9172. [Google Scholar] [CrossRef] [PubMed]
- de Pace, F.; de Paiva, J.B.; Nakazato, G.; Lancellotti, M.; Sircili, M.P.; Stehling, E.G.; da Silveira, W.D.; Sperandio, V. Characterization of IcmF of the type VI secretion system in an avian pathogenic Escherichia coli (APEC) strain. Microbiology 2011, 157 Pt 10, 2954–2962. [Google Scholar] [CrossRef]
- Ding, X.; Zhang, Q.; Wang, H.; Quan, G.; Zhang, D.; Ren, W.; Liao, Y.; Xia, P.; Zhu, G. The different roles of hcp1 and hcp2 of the type VI secretion system in Escherichia coli strain CE129. J. Basic Microbiol. 2018, 58, 938–946. [Google Scholar] [CrossRef]
- Wang, S.; Dai, J.; Meng, Q.; Han, X.; Han, Y.; Zhao, Y.; Yang, D.; Ding, C.; Yu, S. DotU expression is highly induced during in vivo infection and responsible for virulence and Hcp1 secretion in avian pathogenic Escherichia coli. Front. Microbiol. 2014, 5, 588. [Google Scholar] [CrossRef]
- Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef]
- Zhang, Z.; Jiang, S.; Liu, Y.; Sun, Y.; Yu, P.; Gong, Q.; Zeng, H.; Li, Y.; Xue, F.; Zhuge, X.; et al. Identification of ireA, 0007, 0008, and 2235 as TonB-dependent receptors in the avian pathogenic Escherichia coli strain DE205B. Vet. Res. 2020, 51, 5. [Google Scholar] [CrossRef]
- Wang, S.; Niu, C.; Shi, Z.; Xia, Y.; Yaqoob, M.; Dai, J.; Lu, C. Effects of ibeA Deletion on Virulence and Biofilm Formation of Avian Pathogenic Escherichia coli. Infect. Immun. 2011, 79, 279–287. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Shi, Z.; Xia, Y.; Li, H.; Kou, Y.; Bao, Y.; Dai, J.; Lu, C. IbeB is involved in the invasion and pathogenicity of avian pathogenic Escherichia coli. Vet. Microbiol. 2012, 159, 411–419. [Google Scholar] [CrossRef] [PubMed]
- ZhuGe, X.; Wang, S.; Fan, H.; Pan, Z.; Ren, J.; Yi, L.; Meng, Q.; Yang, X.; Lu, C.; Dai, J. Characterization and Functional Analysis of AatB, a Novel Autotransporter Adhesin and Virulence Factor of Avian Pathogenic Escherichia coli. Infect. Immun. 2013, 81, 2437–2447. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, A.J.; Birchenough, G.M.H.; Taylor, P.W. Loss of Trefoil Factor 2 Sensitizes Rat Pups to Systemic Infection with the Neonatal Pathogen Escherichia coli K1. Infect. Immun. 2019, 87, e00878-18. [Google Scholar] [CrossRef] [PubMed]
- Zhuge, X.; Sun, Y.; Jiang, M.; Wang, J.; Tang, F.; Xue, F.; Ren, J.; Zhu, W.; Dai, J. Acetate metabolic requirement of avian pathogenic Escherichia coli promotes its intracellular proliferation within macrophage. Vet. Res. 2019, 50, 31. [Google Scholar] [CrossRef]
- Gong, Q.; Wang, X.; Huang, H.; Sun, Y.; Qian, X.; Xue, F.; Ren, J.; Dai, J.; Tang, F. Novel Host Recognition Mechanism of the K1 Capsule-Specific Phage of Escherichia coli: Capsular Polysaccharide as the First Receptor and Lipopolysaccharide as the Secondary Receptor. J. Virol. 2021, 95, e0092021. [Google Scholar] [CrossRef]
- Amjad, N.; Yang, R.; Li, L.; Fu, J.; Xu, B.; Tan, C.; Chen, H.; Wang, X. Decrease of miR-19b-3p in brain microvascular endothelial cells attenuates meningitic Escherichia coli-Induced neuroinflammation via TNFAIP3-Mediated NF-kappaB inhibition. Pathogens 2019, 8, 268. [Google Scholar] [CrossRef]
- Yang, R.-C.; Qu, X.-Y.; Xiao, S.-Y.; Li, L.; Xu, B.-J.; Fu, J.-Y.; Lv, Y.-J.; Amjad, N.; Tan, C.; Kim, K.S.; et al. Meningitic Escherichia coli-induced upregulation of PDGF-B and ICAM-1 aggravates blood-brain barrier disruption and neuroinflammatory response. J. Neuroinflamm. 2019, 16, 101. [Google Scholar] [CrossRef]
- Aoki, H.; Yamashita, M.; Hashita, T.; Iwao, T.; Matsunaga, T. Laminin 221 fragment is suitable for the differentiation of human induced pluripotent stem cells into brain microvascular endothelial-like cells with robust barrier integrity. Fluids Barriers CNS 2020, 17, 25. [Google Scholar] [CrossRef]
- Brenner, M. Role of GFAP in CNS injuries. Neurosci. Lett. 2014, 565, 7–13. [Google Scholar] [CrossRef]
- Russo, A.T.; Johnson, J.R. Medical and economic impact of extraintestinal infections due to Escherichia coli: Focus on an increasingly important endemic problem. Microbes Infect. 2003, 5, 449–456. [Google Scholar] [CrossRef]
- Duan, Y.; Gao, H.; Zheng, L.; Liu, S.; Cao, Y.; Zhu, S.; Wu, Z.; Ren, H.; Mao, D.; Luo, Y. Antibiotic Resistance and Virulence of Extraintestinal Pathogenic Escherichia coli (ExPEC) Vary According to Molecular Types. Front. Microbiol. 2020, 11, 598305. [Google Scholar] [CrossRef] [PubMed]
- Pitout, J.D.D. Extraintestinal Pathogenic Escherichia coli: A Combination of Virulence with Antibiotic Resistance. Front. Microbiol. 2012, 3, 9. [Google Scholar] [CrossRef] [PubMed]
- Jørgensen, S.L.; Stegger, M.; Kudirkiene, E.; Lilje, B.; Poulsen, L.L.; Ronco, T.; dos Santos, T.P.; Kiil, K.; Bisgaard, M.; Pedersen, K.; et al. Diversity and Population Overlap between Avian and Human Escherichia coli Belonging to Sequence Type 95. mSphere 2019, 4, e00333-18. [Google Scholar] [CrossRef] [PubMed]
- Grandgirard, D.; Leib, S.L. Strategies to prevent neuronal damage in paediatric bacterial meningitis. Curr. Opin. Pediatr. 2006, 18, 112–118. [Google Scholar] [CrossRef]
- Le, N.D.; Muri, L.; Grandgirard, D.; Kuhle, J.; Leppert, D.; Leib, S.L. Evaluation of neurofilament light chain in the cerebrospinal fluid and blood as a biomarker for neuronal damage in experimental pneumococcal meningitis. J. Neuroinflamm. 2020, 17, 12. [Google Scholar] [CrossRef]
- Mohanty, T.; Fisher, J.; Bakochi, A.; Neumann, A.; Cardoso, J.F.P.; Karlsson, C.A.Q.; Pavan, C.; Lundgaard, I.; Nilson, B.; Reinstrup, P.; et al. Neutrophil extracellular traps in the central nervous system hinder bacterial clearance during pneumococcal meningitis. Nat. Commun. 2019, 10, 1667. [Google Scholar] [CrossRef]
- Lakhan, S.E.; Kirchgessner, A.; Tepper, D.; Leonard, A. Matrix Metalloproteinases and Blood-Brain Barrier Disruption in Acute Ischemic Stroke. Front. Neurol. 2013, 4, 32. [Google Scholar] [CrossRef]
- Leib, S.L.; Leppert, D.; Clements, J.; Täuber, M.G. Matrix metalloproteinases contribute to brain damage in experimental pneumococcal meningitis. Infect. Immun. 2000, 68, 615–620. [Google Scholar] [CrossRef]
- Leppert, D.; Leib, S.L.; Grygar, C.; Miller, K.M.; Schaad, U.B.; Holländer, G.A. Matrix Metalloproteinase (MMP)-8 and MMP-9 in Cerebrospinal Fluid during Bacterial Meningitis: Association with Blood-Brain Barrier Damage and Neurological Sequelae. Clin. Infect. Dis. 2000, 31, 80–84. [Google Scholar] [CrossRef]
- Burtnick, M.N.; Brett, P.J.; Harding, S.V.; Ngugi, S.A.; Ribot, W.J.; Chantratita, N.; Scorpio, A.; Milne, T.S.; Dean, R.E.; Fritz, D.L.; et al. The Cluster 1 Type VI Secretion System Is a Major Virulence Determinant in Burkholderia pseudomallei. Infect. Immun. 2011, 79, 1512–1525. [Google Scholar] [CrossRef] [Green Version]
- Mougous, J.D.; Cuff, M.E.; Raunser, S.; Shen, A.; Zhou, M.; Gifford, C.A.; Goodman, A.L.; Joachimiak, G.; Ordoñez, C.L.; Lory, S.; et al. A virulence locus of pseudomonas aeruginosa encodes a protein secretion apparatus. Sci. Am. Assoc. Adv. Sci. 2000, 312, 1526–1530. [Google Scholar] [CrossRef]
- Suarez, G.; Sierra, J.C.; Kirtley, M.L.; Chopra, A.K. Role of Hcp, a type 6 secretion system effector, of Aeromonas hydrophila in modulating activation of host immune cells. Microbiology 2010, 156, 3678–3688. [Google Scholar] [CrossRef] [PubMed]
- Zink, S.D.; Pedersen, L.; Cianciotto, N.P.; Abu Kwaik, Y. The Dot/Icm Type IV Secretion System of Legionella pneumophila Is Essential for the Induction of Apoptosis in Human Macrophages. Infect. Immun. 2002, 70, 1657–1663. [Google Scholar] [CrossRef]
- Ruiz, F.M.; Santillana, E.; Spínola-Amilibia, M.; Torreira, E.; Culebras, E.; Romero, A. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System. PLoS ONE 2015, 10, e0129691. [Google Scholar] [CrossRef]
- Whitney, J.C.; Beck, C.M.; Goo, Y.A.; Russell, A.; Harding, B.N.; De Leon, J.A.; Cunningham, D.; Tran, B.Q.; Low, D.A.; Goodlett, D.R.; et al. Genetically distinct pathways guide effector export through the type VI secretion system. Mol. Microbiol. 2014, 92, 529–542. [Google Scholar] [CrossRef] [PubMed]
- Chieng, S.; Mohamed, R.; Nathan, S. Transcriptome analysis of Burkholderia pseudomallei T6SS identifies Hcp1 as a potential serodiagnostic marker. Microb. Pathog. 2015, 79, 47–56. [Google Scholar] [CrossRef]
- Navarro-Garcia, F.; Ruiz-Perez, F.; Cataldi, A.; Larzabal, M. Type VI Secretion System in Pathogenic Escherichia coli: Structure, Role in Virulence, and Acquisition. Front. Microbiol. 2019, 10, 1965. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Bacterial Strains and Plasmids | Genotype or Relevant Characteristics |
---|---|
Bacterial strains | |
RS218 | O18:K1:H7 stains from human |
DE205B | O2:K1 stains from duck |
DE205B Δhcp1 | hcp1 gene deletion in DE205B |
DE205B Δhcp2 | hcp2 gene deletion in DE205B |
DE205B C-Δhcp1 | DE205B Δhcp1 with plasmid pSTV28-hcp1 |
DE205B C-Δhcp2 | DE205B Δhcp2 with plasmid pSTV28-hcp2 |
Plasmids | |
pKD4 | template for λ-Red Kanr cassette |
pKD46 | λ-Red recombinase expression |
pCP20 | encodes FLP recombinase for removal of resistance cassette |
pSTV28 | A medium-copy plasmid |
E. coli Strains | Pathotype | Serotype | Host | Year | Geographic Location | GenBank |
---|---|---|---|---|---|---|
E. coli JE86-ST02 | EAEC | O86:H27 | Homo sapiens | 1999 | Japan | AP022811.1 |
E. coli JE86-ST05 | EAEC | O86:H27 | Homo sapiens | 2014 | Japan | AP022815.1 |
E. coli 2011C-3493 | EAEC | O104:H4 | Homo sapiens | 2011 | USA | CP003289.1 |
E. coli 155 | EHEC | O157:H7 | Homo sapiens | 2012 | United Kingdom | CP018237.1 |
E. coli 272 | EHEC | O157:H7 | Homo sapiens | 2013 | United Kingdom | CP018239.1 |
E. coli 319 | EHEC | O157:H7 | Homo sapiens | 2012 | United Kingdom | CP018241.1 |
E. coli 472 | EHEC | O157:H7 | Homo sapiens | 2012 | United Kingdom | CP018245.1 |
E. coli 10671 | EHEC | O157:H7 | Homo sapiens | 2012 | United Kingdom | CP018250.1 |
E. coli CFSAN029787 | EIEC | O96:H19 | Homo sapiens | 2012 | Italy | CP011416.1 |
E. coli 152661 | EIEC | O96:H19 | Homo sapiens | 2014 | United Kingdom | CP046676.1 |
E. coli E2348/69 | EPEC | O127:H6 | Homo sapiens | 2012 | United Kingdom | NZ_LT827011.1 |
E. coli NRG 857C | AIEC | O83:H1 | Homo sapiens | 2008 | USA | CP001855.1 |
E. coli C4435 | AIEC | O25:H4 | Homo sapiens | 2010 | Mexico | CP027851.1 |
E. coli C7230 | AIEC | O25:H4 | Homo sapiens | 2012 | Mexico | NZ_PXXQ01000001.1 |
E. coli UT189 | UPEC | Missing | Homo sapiens | 2018 | India | CP062228.1 |
E. coli V7 | UPEC | Missing | Homo sapiens | 1981 | USA | CP048855.1 |
E. coli 26-1 | UPEC | Missing | Homo sapiens | 2012 | South Korea | CP016497.1 |
E. coli U013 | UPEC | Missing | Homo sapiens | 2014 | China | CP058596.1 |
E. coli ERP001 | UPEC | Missing | Red panda | 2017 | China | CP063214.1 |
E.coli 536 | UPEC | O6:K15:H31 | Homo sapiens | Missing | Missing | NC_008253.1 |
E.coli CFT073 | UPEC | O6:H1 | Homo sapiens | 1990 | USA | NC_004431.1 |
E. coli O18 | NMEC | O18:K1 | Avian/Homo sapiens | 1989 | Netherlands | CP007275.1 |
E. coli MCJCHV-1 | NMEC | O75:H5:K1 | Homo sapiens | 2015 | USA | NZ-CP030111.1 |
E. coli CE10 | NMEC | O7:K1 | Homo sapiens | Missing | USA | CP003034.1 |
E. coli M16807 | NMEC | Missing | Homo sapiens | Missing | USA | CP031256.1 |
E. coli RS218 | NMEC | O18:H7:K1 | Homo sapiens | 1974 | Missing | CP007149.1 |
E.coli DE205B | APEC | O2:K1 | Duck | 2011 | China | This study |
E. coli O2-211 | APEC | O2 | Gallus gallus | 1982 | USA | NZ-CP006834.2 |
E. coli O1 | APEC | O1:K1:H7 | Turkey | 2006 | USA | NC-008563.1 |
E. coli O78 | APEC | O78 | Duck | 2017 | China | NC-020163.1 |
E. coli RCAD0514 | APEC | Missing | Duck | 2017 | China | NZ-CP034106.1 |
E. coli CT30 | APEC | Missing | Avian | 2014 | China | NZ-CP032078.1 |
E. coli E166 | APEC | Missing | Avian | 2014 | China | NZ-CP032066.1 |
E. coli CT29 | APEC | Missing | Avian | 2014 | China | NZ-CP032073.1 |
E. coli ACN002 | APEC | Missing | Avian | 2016 | China | NZ-CP007491.1 |
E. coli 789 | APEC | O78:H19 | Turkey | 1990 | Missing | NZ-CP010315.1 |
Gene | Sequence (5′–3′) |
---|---|
For RT-PCR | |
GFAP-F | CGTGGAGATGGATGTGGC |
GFAP-R | TCTGCAAACTTGGACCGA |
CXCL-1-F | GGCAGGGATTCACTTCAAGA |
CXCL-1-R | ACTTGGGGACACCCTTTAGC |
IL-6-F | CCAGCCAGTTGCCTTCTT |
IL-6-R | TCTGTTGTGGGTGGTATCCT |
IL-10-F | GCCCAGAAATCAAGGAGCAT |
IL-10-R | CGTAGGCTTCTATGCAGTTG |
GAPDH-F | ATGGGAAGCTGGTCATCAAC |
GAPDH-R | GGATGCAGGGATGATGTTCT |
General PCR for cloning | |
OmpA-F | TTGGATGATAACGAGGCG |
OmpA-R | CAGGCATTGCTGGGTAAG |
IcmF-F | GGGTGGCGAAGATTGG |
IcmF-R | GCGTAGGGCCGTATGT |
FimH-F | GTTATTACCCTGTTTGCTG |
FimH-R | GGCTTATCCGTTCTCG |
IbeA-F | GAAGTGTTAGTTGTTGGTGGTG |
IbeA-R | TCCTGCCGACTTTCCTTT |
CUS-3-F | CTTCCCTTCGGCGGTTGT |
CUS-3-R | TCCGCTTATGAAAGGTGTCG |
For Deletion a | |
Hcp1-P1 | CGGGAGCAATTTCTTCCTTTACTGACATACTGAATATCCTTCTGTGAAAAgtgtaggctggagctgcttcga |
Hcp1-P2 | TGTATGCAGTACGAAAATGCTGTGCTCATGGCCTGAACGGGAACATTTTTcatatgaatatcctccttag |
Hcp2-P1 | GACGGGTTGTTCGTAAAACAGCAGTTGATAATTTCACAAGGAGTTCATAA gtgtaggctggagctgcttcga |
Hcp2-P2 | ACGTACAAAAACAACATCCTGCACGGAGGCAGGATGTTGTTGACTCAGATcatatgaatatcctccttag |
For Complemented a | |
Hcp1-F | tatgaccatgattacgaattcTTATTTCTGAACGGCGATACCC |
Hcp1-R | cttgcatgcctgcaggtcgacATGAGCAAAATGAACAACAATGGC |
Hcp2-F | tatgaccatgattacgaattcATGCCAACCCCATGTTACATTT |
Hcp2-R | cttgcatgcctgcaggtcgacTTATGCTTCCAGCGGTGCA |
For deletion identification b | |
K1 | CAGTCATAGCCGAATAGCCT |
K2 | CGGTGCCCTGAATGAACTGC |
Kt | CGGCCACAGTCGATGAATCC |
Hcp1-up | TTCTGATTTAGGCTGGACGC |
Hcp1-down | CTGCCACTGAAACGGTATTG |
Hcp2-up | ACTCTAACCTGTCGGGGATT |
Hcp2-down | GTCAGCGTTGCGTTCTTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Sun, Y.; Subedi, D.; Gong, Q.; Huang, H.; Li, J.; Wang, Y.; Ren, J. Hcp Proteins of the Type VI Secretion System Promote Avian Pathogenic E. coli DE205B (O2:K1) to Induce Meningitis in Rats. Life 2022, 12, 1353. https://doi.org/10.3390/life12091353
Wang X, Sun Y, Subedi D, Gong Q, Huang H, Li J, Wang Y, Ren J. Hcp Proteins of the Type VI Secretion System Promote Avian Pathogenic E. coli DE205B (O2:K1) to Induce Meningitis in Rats. Life. 2022; 12(9):1353. https://doi.org/10.3390/life12091353
Chicago/Turabian StyleWang, Xuhang, Yu Sun, Dinesh Subedi, Qianwen Gong, Haosheng Huang, Jin Li, Yuxin Wang, and Jianluan Ren. 2022. "Hcp Proteins of the Type VI Secretion System Promote Avian Pathogenic E. coli DE205B (O2:K1) to Induce Meningitis in Rats" Life 12, no. 9: 1353. https://doi.org/10.3390/life12091353