Next Article in Journal
Global Long Noncoding RNA and mRNA Expression Changes between Prenatal and Neonatal Lung Tissue in Pigs
Previous Article in Journal
The drnf1 Gene from the Drought-Adapted Cyanobacterium Nostoc flagelliforme Improved Salt Tolerance in Transgenic Synechocystis and Arabidopsis Plant
Previous Article in Special Issue
Somatostatin Analogue Treatment Primarily Induce miRNA Expression Changes and Up-Regulates Growth Inhibitory miR-7 and miR-148a in Neuroendocrine Cells
Article Menu

Export Article

Open AccessArticle
Genes 2018, 9(9), 442;

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus

4,* and 4,5,*
Laboratory of Medical Molecular Virology, School of Medicine, Nankai University, Tianjin 300071, China
State Key Laboratory of Veterinary Etiological Biology and Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Science, Lanzhou 730046, China
Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China
College of Life Sciences, Nankai University, Tianjin 300071, China
Institute of Statistics, Nankai University, Tianjin 300071, China
School of Mathematical Sciences, Nankai University, Tianjin 300071, China
These authors contributed equally to this work.
Authors to whom correspondence should be addressed.
Received: 4 July 2018 / Revised: 21 August 2018 / Accepted: 22 August 2018 / Published: 5 September 2018
(This article belongs to the Special Issue microRNA in Health and Disease)
Full-Text   |   PDF [1571 KB, uploaded 5 September 2018]   |  


In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. View Full-Text
Keywords: palindromic small RNA; complemented palindromic small RNA; small RNA; DNA complemented palindrome; severe acute respiratory syndrome coronavirus palindromic small RNA; complemented palindromic small RNA; small RNA; DNA complemented palindrome; severe acute respiratory syndrome coronavirus

Figure 1

This is an open access article distributed under the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. (CC BY 4.0).

Supplementary material


Share & Cite This Article

MDPI and ACS Style

Liu, C.; Chen, Z.; Hu, Y.; Ji, H.; Yu, D.; Shen, W.; Li, S.; Ruan, J.; Bu, W.; Gao, S. Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus. Genes 2018, 9, 442.

Show more citation formats Show less citations formats

Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. See further details here.

Related Articles

Article Metrics

Article Access Statistics



[Return to top]
Genes EISSN 2073-4425 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
Back to Top