Identification and Expression Patterns of Critical Genes Related to Coat Color in Cashmere Goats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Skin Sample Preparation for RNA Sequencing and Validation Experiments
2.2. RNA Extraction, Library Construction, and RNA Sequencing
2.3. Quality Control and Alignment of Reads to the Reference Genome
2.4. Identification and Functional Enrichment Analysis of Differentially Expressed Genes
2.5. Construction of DEG Interaction Network
2.6. Validation of Coat Color-Related Key Genes Through qRT-PCR
2.7. Identification of Coat Color-Related Key Genes via Skin Tissue Immunofluorescence
3. Results
3.1. Summary of the RNA-Seq Data
3.2. Screening of DEGs Between Cashmere Goats with Different Coat Colors
3.3. Functional Classification of DEGs
3.4. Identification of Critical Genes Associated with Different Coat Colors
3.5. Validation of mRNA Expression Levels of Critical Genes
3.6. Immunohistochemical Analysis of Critical Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhao, R.; Zhao, Y.; Li, B.; Bou, G.; Zhang, X.Z.; Mongke, T.; Bao, T.; Gereliin, S.; Gereltuuin, T.; Li, C.; et al. Overview of the genetic control of horse coat color patterns. Hereditas 2018, 40, 357–368. [Google Scholar] [PubMed]
- Caro, T. The adaptive significance of coloration in mammals. BioScience 2005, 55, 125–156. [Google Scholar] [CrossRef]
- Chandramohan, B.; Renieri, C.; La Manna, V.; La Terza, A. The alpaca agouti gene: Genomic locus, transcript and causative mutations of eumelanic and pheomelanic coat color. Gene 2013, 521, 303–310. [Google Scholar] [CrossRef]
- Deng, W.D.; Shu, W.; Yang, S.L.; Shi, X.W.; Mao, H.M. Pigmentation in Black-bond sheep (Ovis aries): Association with polymorphism of the MC1R gene. Mol. Biol. Rep. 2009, 36, 431–436. [Google Scholar] [CrossRef] [PubMed]
- Bonaventure, J.; Domingues, M.J.; Larue, L. Cellular and molecular mechanisms controlling the migration of melanocytes and melanoma cells. Pigment Cell Melanoma Res. 2013, 26, 316–325. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.B.L.; Wu, T.C.; Li, Y.R.; Li, C.; Wu, J.H.; Hu, S.L.; Liu, B.; Gao, S.X. Research progress on molecular basis and applicability of coat color formation in livestock. Chin. Anim. Hus. B Vet. Med. 2019, 46, 2665–2675. [Google Scholar]
- Yang, G.L. Study on the regulation mechanism of fur color formation in animals. Heilongjiang Anim. Sci. Veter. Med. 2014, 5, 45–48. [Google Scholar]
- Aoki, H.; Motohashi, T.; Yoshimura, N.; Yamazaki, H.; Yamane, T.; Panthier, J.J.; Kunisada, T. Cooperative and indispensable roles of endothelin 3 and KIT signalings in melanocyte development. Dev. Dyn. 2005, 233, 407–417. [Google Scholar] [CrossRef] [PubMed]
- Shibahara, S.; Takeda, K.; Yasumoto, K.; Udono, T.; Watanabe, K.; Saito, H.; Takahashi, K. Microphthalmiaassociated transcription factor (MITF): Multiplicity in structure, function, and regulation. J. Investig. Dermatol. Symp. Proc. 2001, 6, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Yu, X.J.; Dong, C.S. MiR-137 affects melanin synthesis in mouse melanocyte by repressing the expression of c-Kit and Tyrp2 in SCF/c-Kit signaling pathway. Biosci. Biotechnol. Biochem. 2016, 80, 2115–2121. [Google Scholar] [CrossRef] [PubMed]
- Tsang, T.F.; Chan, B.; Tai, W.C.S.; Huang, G.X.; Wang, J.R.; Li, A.; Jiang, Z.H.; Hsiao, W.L.W. Gynostemma pentaphyllum saponins induce melanogenesis and activate cAMP/PKA and Wnt/β-catenin signaling pathways. Phytomedicine 2019, 60, 153008. [Google Scholar] [CrossRef] [PubMed]
- Hellström, A.R.; Watt, B.; Fard, S.S.; Tenza, D.; Mannström, P.; Narfström, K.; Ekesten, B.; Ito, S.; Wakamatsu, K.; Larsson, J.; et al. Inactivation of Pmel alters melanosome shape but has only a subtle effect on visible pigmentation. PLoS Genet. 2011, 7, e1002285. [Google Scholar] [CrossRef] [PubMed]
- Lamoreux, M.L.; Wakamatsu, K.; Ito, S. Interaction of major coat color gene functions in mice as studied by chemical analysis of eumelanin and pheomelanin. Pigment Cell Res. 2001, 14, 23–31. [Google Scholar] [CrossRef]
- Wang, L.; Liu, J. Research progress on molecular mechanism in the formation of melanin. J. Xinjiang Univ. (Nat. Sci. Ed.) 2019, 36, 468–474. [Google Scholar]
- Pillaiyar, T.; Manickam, M.; Jung, S.H. Recent development of signaling pathways inhibitors of melanogenesis. Cell Signal 2017, 40, 99–115. [Google Scholar] [CrossRef] [PubMed]
- Seiberg, M. Keratinocyte-melanocyte interactions during melanosome transfer. Pigment Cell Res. 2001, 14, 236–242. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wu, H.; Yu, L. Progress on coat color regulation mechanism and its association with the adaptive evolution in mammals. Hereditas 2021, 43, 118–133. [Google Scholar]
- Li, J. MiRNA-200a Regulated Pigmentation by Targeting WNT5A and FZD4 in Cashmere Goat. Master’s Thesis, Jilin University, Changchun, China, 2021. [Google Scholar]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-Seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, 480–484. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Vandamme, N.; Berx, G. From neural crest cells to melanocytes: Cellular plasticity during development and beyond. Cell Mol. Life Sci. 2019, 76, 1919–1934. [Google Scholar] [CrossRef] [PubMed]
- Panzella, L.; Ebato, A.; Napolitano, A.; Koike, K. The Late Stages of Melanogenesis: Exploring the Chemical Facets and the Application Opportunities. Int. J. Mol. Sci. 2018, 19, 1753. [Google Scholar] [CrossRef] [PubMed]
- Lai, X.; Wichers, H.J.; Soler-Lopez, M.; Dijkstra, B.W. Structure and Function of Human Tyrosinase and Tyrosinase-Related Proteins. Chemistry 2018, 24, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Yao, L.; Bao, A.; Hong, W.J.; Hou, C.X.; Zhang, Z.L.; Liang, X.P.; Aniwashi, J. Transcriptome profiling analysis reveals key genes of different coat color in sheep skin. Peer J. 2019, 7, e8077. [Google Scholar] [CrossRef] [PubMed]
- Botchkareva, N.V.; Botchkarev, V.A.; Gilchrest, B.A. Fate of Melanocytes During Development of the Hair Follicle Pigmentary Unit. J. Investig. Dermatol. Symp. Proc. 2003, 8, 76–79. [Google Scholar] [CrossRef] [PubMed]
- Slominski, A.; Wortsman, J.; Plonka, P.M.; Schallreuter, K.U.; Paus, R.; Tobin, D.J. Hair follicle pigmentation. J. Investig. Dermatol. 2005, 124, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Watt, B.; van Niel, G.; Raposo, G.; Marks, M.S. PMEL: A pigment cell-specific model for functional amyloid formation. Pigment Cell Melanoma Res. 2013, 26, 300–315. [Google Scholar] [CrossRef] [PubMed]
- Kimura, S.; Hatakeyama, T.; Koutaka, T.; Kubo, K.; Morita, S.; Eguchi, K.; Saitoh, K.; Yamauchi, K.; Imai, S.; Kashimura, A.; et al. PMEL p.Leu18del dilutes coat color of Kumamoto sub-breed of Japanese Brown cattle. BMC Genom. 2022, 23, 694. [Google Scholar] [CrossRef]
- Bhat, B.; Singh, A.; Iqbal, Z.; Kaushik, J.K.; Rao, A.R.; Ahmad, S.M.; Bhat, H.; Ayaz, A.; Sheikh, F.D.; Kalra, S.; et al. Comparative transcriptome analysis reveals the genetic basis of coat color variation in Pashmina goat. Sci. Rep. 2019, 9, 6361. [Google Scholar] [CrossRef] [PubMed]
- Liang, D.; Zhao, P.; Si, J.; Fang, L.; Pairo-Castineira, E.; Hu, X.; Xu, Q.; Hou, Y.; Gong, Y.; Liang, Z.; et al. Genomic Analysis Revealed a Convergent Evolution of LINE-1 in Coat Color: A Case Study in Water Buffaloes (Bubalus bubalis). Mol. Biol. Evol. 2021, 38, 1122–1136. [Google Scholar] [CrossRef]
- Lu, D.; Willard, D.; Patel, I.R.; Kadwell, S.; Overton, L.; Kost, T.; Luther, M.; Chen, W.; Woychik, R.P.; Wilkison, W.O.; et al. Agouti protein is an antagonist of the melanocyte-stimulating-hormone receptor. Nature 1994, 371, 799–802. [Google Scholar] [CrossRef]
- He, L.; Eldridge, A.G.; Jackson, P.K.; Gunn, T.M.; Barsh, G.S. Accessory proteins for melanocortin signaling: Attractin and mahogunin. Ann. N. Y. Acad. Sci. 2003, 994, 288–298. [Google Scholar] [CrossRef]
- Nazari-Ghadikolaei, A.; Mehrabani-Yeganeh, H.; Miarei-Aashtiani, S.R.; Staiger, E.A.; Rashidi, A.; Huson, H.J. Genome-Wide Association Studies Identify Candidate Genes for Coat Color and Mohair Traits in the Iranian Markhoz Goat. Front. Genet. 2018, 9, 105. [Google Scholar] [CrossRef]
- Li, B.; He, X.L.; Zhao, Y.P.; Wang, X.J.; Mang, L.; Zhang, Y.R. Molecular basis and applicability in equine color genetics. Hereditas 2010, 32, 1133–1140. [Google Scholar] [PubMed]
- Rieder, S.; Hagger, C.; Obexer-Ruff, G.; Leeb, T.; Poncet, P.A. Genetic analysis of white facial and leg markings in the Swiss Franches-Montagnes Horse Breed. J. Hered. 2008, 99, 130–136. [Google Scholar] [CrossRef] [PubMed]
- Hoashi, T.; Watabe, H.; Muller, J.; Yamaguchi, Y.; Vieira, W.D.; Hearing, V.J. MART-1 is required for the function of the melanosomal matrix protein PMEL17/GP100 and the maturation of melanosomes. J. Biol. Chem. 2005, 280, 14006–14016. [Google Scholar] [CrossRef]
- Vasu, M.; Ahlawat, S.; Chhabra, P.; Sharma, U.; Arora, R.; Sharma, R.; Mir, M.A.; Singh, M.K. Genetic insights into fiber quality, coat color and adaptation in Changthangi and Muzzafarnagri sheep: A comparative skin transcriptome analysis. Gene 2024, 891, 147826. [Google Scholar] [CrossRef] [PubMed]
- Aydin, I.T.; Hummler, E.; Smit, N.P.; Beermann, F. Coat color dilution in mice because of inactivation of the melanoma antigen MART-1. Pigment Cell Melanoma Res. 2012, 25, 37–46. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequences (5′–3′) | Accession Number | Product Length (bp) |
---|---|---|---|
TYRP1 | F: TGGCAATTTCTCAGGACAC R: CTGGACAAAGCGGTTCTT | NM_001285727.1 | 133 |
DCT | F: TCTGCTGCCAATGATCC R: GGGAAGAAAGGAACCATGT | XM_005687700.3 | 158 |
ASIP | F: AGTGCCCCACAGTTTTCA R: CAAGGTAGCCAGGAAGAGGT | XM_018057736.1 | 150 |
PMEL | F: AGGGACCTACTGCCTCAA R: AGCAAGATGCCCACAAAC | XM_018048106.1 | 180 |
AHCY | F: GGCAAGGTGGCAGTGGTT R: CAGCCTGAAGTGCGTTGAT | XM_018057737.1 | 121 |
TYR | F: GCGGAAGTTGTAAGTTTGG R: GGGCTGGTGGTATGTTTT | NM_001287562.1 | 142 |
β-actin | F: GCAAATGCTTCTAGGCGGAC R: TGCTGTCACCTTCACCGTTC | NM_001314342.1 | 194 |
DEG Sample | Up DEG NO. | Down DEG NO. | Total |
---|---|---|---|
WGs vs. BGs | 255 | 187 | 442 |
WGs vs. RGs | 220 | 152 | 372 |
BGs vs. RGs | 170 | 169 | 339 |
Gene ID | Gene Name | Gene Description |
---|---|---|
102182281 | TYR | Tyrosinase |
100861390 | TYRP1 | Tyrosinase-related protein 1 |
102169882 | DCT | Dopachrome tautomerase |
100860915 | ASIP | Agouti signaling protein |
102176102 | PMEL | Premelanosome protein |
102178069 | MLANA | Melan-A |
102181897 | TSPAN10 | Tetraspanin 10 |
102182733 | TRPM1 | Transient receptor potential cation channel subfamily M member 1 |
102189431 | CLDN16 | Claudin 16 |
106503350 | LOC106503350 | Uncharacterized LOC106503350 |
102175263 | LOC102175263 | Vitamin D3 hydroxylase-associated protein |
102180584 | LOC102180584 | BOLA class I histocompatibility antigen |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, D.; Fan, J.; Pang, Y.; Wen, B.; Li, W.; Yang, G.; Cheng, H.; Shi, J.; Wang, T.; Hu, S.; et al. Identification and Expression Patterns of Critical Genes Related to Coat Color in Cashmere Goats. Genes 2025, 16, 222. https://doi.org/10.3390/genes16020222
Wu D, Fan J, Pang Y, Wen B, Li W, Yang G, Cheng H, Shi J, Wang T, Hu S, et al. Identification and Expression Patterns of Critical Genes Related to Coat Color in Cashmere Goats. Genes. 2025; 16(2):222. https://doi.org/10.3390/genes16020222
Chicago/Turabian StyleWu, Dubala, Jing Fan, Yue Pang, Binhong Wen, Wei Li, Guanghao Yang, Huiyu Cheng, Jiahui Shi, Ting Wang, Sile Hu, and et al. 2025. "Identification and Expression Patterns of Critical Genes Related to Coat Color in Cashmere Goats" Genes 16, no. 2: 222. https://doi.org/10.3390/genes16020222
APA StyleWu, D., Fan, J., Pang, Y., Wen, B., Li, W., Yang, G., Cheng, H., Shi, J., Wang, T., Hu, S., Li, C., Liu, B., Yin, J., & Wu, J. (2025). Identification and Expression Patterns of Critical Genes Related to Coat Color in Cashmere Goats. Genes, 16(2), 222. https://doi.org/10.3390/genes16020222