HLA-DQA1 and HLA-DQB1 Alleles, Conferring Susceptibility to Celiac Disease and Type 1 Diabetes, Are More Expressed Than Non-Predisposing Alleles and Are Coordinately Regulated
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients Enrollment and Selection of Antigen Presenting Cells
2.2. Monoclonal Antibodies and Flow Cytometry Analysis
2.3. cDNA Cloning and B-LCL Nucleofection
2.4. RNA Quantization
2.5. T Cell Functional Assay
2.6. Statistical Analysis
3. Results
3.1. The DQA1*03 and DQB1*03 mRNA Associated with T1D Risk Were More Abundant than the mRNA of Non-T1D Related Alleles
3.2. Analysis of Co-Regulated Expression of DQA1*05 and DQB1*02 mRNA
3.3. DR7/DR14 B-LCLs Transfected with pDQA105 Efficiently Stimulated Gluten-Specific CD4+ T Cells
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Romanos, J.; Bakker, S.F.; Onengut-gumuscu, S.; Simsek, S.; Rewers, M.; Mulder, C.J.; Liu, E.; Rich, S.S. Contrasting the Genetic Background of Type 1 Diabetes and Celiac Disease Autoimmunity. Diab. Care 2015, 38, 37–44. [Google Scholar]
- Van Lummel, M.; Duinkerken, G.; Van Veelen, P.A.; De Ru, A.; Cordfunke, R.; Zaldumbide, A.; Gomez-Touriño, I.; Arif, S.; Peakman, M.; Drijfhout, J.W.; et al. Posttranslational modification of HLA-DQ binding islet autoantigens in type 1 diabetes. Diabetes 2014, 63, 237–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abadie, V.; Sollid, L.M.; Barreiro, L.B.; Jabri, B. Integration of Genetic and Immunological Insights into a Model of Celiac Disease Pathogenesis. Annu. Rev. Immunol. 2011, 29, 493–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noble, J.A.; Valdes, A.M. Genetics of the HLA region in the prediction of type 1 diabetes. Curr. Diab. Rep. 2011, 11, 533–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meresse, B.; Malamut, G.; Cerf-Bensussan, N. Celiac Disease: An Immunological Jigsaw. Immunity 2012, 36, 907–919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Erlich, H.; Valdes, A.M.; Noble, J.; Carlson, J.A.; Varney, M.; Concannon, P.; Mychaleckyj, J.C.; Todd, J.A.; Bonella, P.; Fear, A.L.; et al. HLA DR-DQ Haplotypes and Genotypes and Type 1 Diabetes Risk. Diabetes 2008, 57, 1084–1092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noble, J.A. Immunogenetics of type 1 diabetes: A comprehensive review. J. Autoimmun. 2015, 64, 101–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pisapia, L.; Camarca, A.; Picascia, S.; Bassi, V.; Barba, P.; Del Pozzo, G.; Gianfrani, C. HLA-DQ2.5 genes associated with celiac disease risk are preferentially expressed with respect to non-predisposing HLA genes: Implication for anti-gluten T cell response. J. Autoimmun. 2016, 70, 63–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corso, C.; Pisapia, L.; Citro, A.; Cicatiello, V.; Barba, P.; Cigliano, L.; Abrescia, P.; Maffei, A.; Manco, G.; Del Pozzo, G. EBP1 and DRBP76/NF90 binding proteins are included in the major histocompatibility complex class II RNA operon. Nucleic Acids Res. 2011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pisapia, L.; Cicatiello, V.; Barba, P.; Malanga, D.; Maffei, A.; Hamilton, R.S.; Del Pozzo, G. Co-regulated expression of alpha and beta mRNAs encoding HLA-DR surface heterodimers is mediated by the MHCII RNA operon. Nucleic Acids Res. 2013, 41, 3772–3786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amar, A.; Radka, S.F.; Holbeck, S.L.; Kim, S.J.; Nepom, B.S.; Nelson, K.; Nepom, G.T. Characterization of specific HLA-DQ alpha allospecificities by genomic, biochemical, and serologic analysis. J. Immunol. 1987, 138, 3986–3990. [Google Scholar] [PubMed]
- Viken, H.D.; Paulsen, G.; Sollid, L.M.; Lundin, K.E.A.; Tjønnfjord, G.E.; Thorsby, E.; Gaudernack, G. Characterization of an HLA-DQ2-specific monoclonal antibody. Influence of amino acid substitutions in DQβ 1*0202. Hum. Immunol. 1995, 42, 319–327. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Camarca, A.; Anderson, R.P.; Mamone, G.; Fierro, O.; Facchiano, A.; Costantini, S.; Zanzi, D.; Sidney, J.; Auricchio, S.; Sette, A.; et al. Intestinal T cell responses to gluten peptides are largely heterogeneous: Implications for a peptide-based therapy in celiac disease. J.Imunol. 2009, 182, 4158–4166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vader, W.; Stepniak, D.; Kooy, Y.; Mearin, L.; Thompson, A.; van Rood, J.J.; Spaenij, L.; Koning, F. The HLA-DQ2 gene dose effect in celiac disease is directly related to the magnitude and breadth of gluten-specific T cell responses. Proc. Natl. Acad. Sci. USA 2003, 100, 12390–12395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavalli, G.; Hayashi, M.; Jin, Y.; Yorgov, D.; Santorico, S.A.; Holcomb, C.; Spritz, R.A.; Dinarello, C.A. MHC class II super-enhancer increases surface expression of HLA-DR and HLA-DQ and affects cytokine production in autoimmune vitiligo. Proc. Natl. Acad. Sci. USA 2015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raj, P.; Rai, E.; Song, R.; Khan, S.; Wakeland, B.E.; Viswanathan, K.; Arana, C.; Liang, C.; Zhang, B.; Dozmorov, I.; et al. Regulatory polymorphisms modulate the expression of HLA class II molecules and promote autoimmunity. eLife 2016, 5, e12089. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gianfrani, C.; Pisapia, L.; Picascia, S.; Strazzullo, M.; Del Pozzo, G. Expression level of risk genes of MHC class II is a susceptibility factor for autoimmunity: New insights. J. Autoimmun. 2018, 89, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Code | Cells a | Diagnosis | DQA1 Genotype | DQB1 Genotype | DQ Phenotype | DR Phenotype |
|---|---|---|---|---|---|---|
| §1 | B-LCL | T1D | *03/*05 | *02/*03 | DQ2.5/DQ8 | DR3/DR4 |
| §2 | B-LCL | T1D | *03/*05 | *02/*02 | DQ2.5/DQ2.3 | DR3/DR9 |
| §3 | B-LCL | T1D | *05/*05 | *02/*02 | DQ2.5/DQ2.5 | DR3/DR3 |
| §4 | B-LCL | T1D with CD | *03/*05 | *02/*03 | DQ2.5/DQ8 | DR3/DR4 |
| §5 | B-LCL | T1D with CD | *01/*03 | *05/*03 | DQ8/DQ5 | DR4/DR16 |
| §6 | B-LCL | T1D with CD | *01/*05 | *02/*05 | DQ2.5/DQ5 | DR1/DR3 |
| §7 | B-LCL | T1D with CD | *02/*05 | *02/*02 | DQ2.5/DQ2.2 | DR3/DR7 |
| §8 | B-LCL | T1D with CD | *05/*05 | *02/*02 | DQ2.5/DQ2.5 | DR3/DR3 |
| §9 | PBMC | T1D | *01/*05 | *02/*05 | DQ2.5/DQ5 | DR1/DR3 |
| §10 | PBMC | T1D | *01/*05 | *02/*06 | DQ2.5/DQ6 | DR3/DR15 |
| §11 | PBMC | T1D | *01/*05 | *02/*05 | DQ2.5/DQ5 | DR1/DR3 |
| §12 | PBMC | T1D | *01/*03 | *03/*05 | DQ8/DQ5 | DR4/DR1 |
| §13 | PBMC | T1D | *03/*05 | *02/*03 | DQ2.5/DQ8 | DR3/DR4 |
| §14 | PBMC | T1D | *03/*05 | *02/*03 | DQ2.5/DQ8 | DR3/DR4 |
| §15 | PBMC | T1D | *01/*03 | *03/*05 | DQ8/DQ5 | DR4/DR1 |
| §16 | PBMC | T1D | *05/*05 | *02/*03 | DQ2.5/DQ7 | DR3/DR5 |
| §17 | PBMC | T1D | *01/*05 | *02/*05 | DQ2.5/DQ5 | DR3/DR1 |
| §18 | PBMC | T1D | *03/*03 | *03/*03 | DQ8/DQ8 | DR4/DR4 |
| §19 | PBMC | T1D | *01/*03 | *03/*05 | DQ8/DQ5 | DR4/DR1 |
| §20 | PBMC | T1D | *03/*03 | *03/*03 | DQ8/DQ8 | DR4/DR4 |
| §21 | PBMC | T1D | *01/*03 | *03/*05 | DQ8/DQ5 | DR4/DR1 |
| Gene | Primers | Sequences 5′ → 3′ |
|---|---|---|
| β-Actin | ACT-F ACT-R | TCATGAAGTGTGACGTTGACA CCTAGAAGCATTTGCGGTGCAC |
| HLA-DQA1*01 | DQA1*01-F DQA1*R | CGGTGGCCTGAGTTCAGCAA GGAGACTTGGAAAACACTGTGACC |
| HLA-DQA1*02 | DQA1*02-F DQA1*R | AAGTTGCCTCTGTTCCACAGAC GGAGACTTGGAAAACACTGTGACC |
| HLA-DQA1*03 | DQA1*03-F DQA1*R | CTCTGTTCCGCAGATTTAGAAGA GGAGACTTGGAAAACACTGTGACC |
| HLA-DQA1*05 | DQA1*05-F DQA1*R | CTCTGTTCCGCAGATTTAGAAGA GGAGACTTGGAAAACACTGTGACC |
| HLA-DQB1*02 | DQB1*02-F DQB1*R | TCTTGTGAGCAGAAGCATCT CAGGATCTGGAAGGTCCAGT |
| HLA-DQB1*03 | DQB1*03-F DQB1*R | CGGAGTTGGACACGGTGTGC CAGGATCTGGAAGGTCCAGT |
| HLA-DQB1*05 | DQB1*05 DQB1*R | ACAACTACGAGGTGGCGTACC CAGGATCTGGAAGGTCCAGT |
| HLA-DQB1*06 | DQB1*06-F DQB1*R | CAGATCAAAGTCCGGTGGTTTC CAGGATCTGGAAGGTCCAGT |
| Cells | Patients | mRNA Alleles | Fold Change | Cells | Patients | mRNA Alleles | Fold Change |
|---|---|---|---|---|---|---|---|
| B-LCL | §1 | DQA1*05 = DQA1*03 | 1 | B-LCL | §5 | DQB1*03 > DQB1*05 | 3.2 |
| §4 | |||||||
| B-LCL | §2 | DQA1*05 > DQA1*03 | 2.7 | B-LCL | §6 | DQB1*02 > DQB1*05 | 4.6 |
| B-LCL | §5 | DQA1*03 > DQA1*01 | 3.2 | B-LCL | §1 | DQB1*02 = DQB1*03 | 1 |
| §4 | |||||||
| B-LCL | §6 | DQA1*05 > DQA1*01 | 3.0 | PBMC | §9 | DQB1*02 > DQB1*05 | 5.6 |
| §11 | |||||||
| §17 | |||||||
| B-LCL | §7 | DQA1*05 > DQA1*02 | 2.7 | PBMC | §10 | DQB1*02 > DQB1*06 | 5.9 |
| PBMC | §9 | DQA1*05 > DQA1*01 | 4.8 | PBMC | §19 | DQB1*03 > DQB1*05 | 3.1 |
| §10 | §21 | ||||||
| §11 | §12 | ||||||
| §17 | §15 | ||||||
| PBMC | §12 | DQA1*03 > DQA1*01 | 2.9 | PBMC | §13 | DQB1*02 = DQB1*03 | 1 |
| §15 | |||||||
| §19 | §14 | ||||||
| §21 | |||||||
| PBMC | §13 | DQA1*05 = DQA1*03 | 1 | PBMC | §16 | DQB1*02 > DQB1*03 | 3.3 |
| §14 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Farina, F.; Picascia, S.; Pisapia, L.; Barba, P.; Vitale, S.; Franzese, A.; Mozzillo, E.; Gianfrani, C.; Del Pozzo G, G. HLA-DQA1 and HLA-DQB1 Alleles, Conferring Susceptibility to Celiac Disease and Type 1 Diabetes, Are More Expressed Than Non-Predisposing Alleles and Are Coordinately Regulated. Cells 2019, 8, 751. https://doi.org/10.3390/cells8070751
Farina F, Picascia S, Pisapia L, Barba P, Vitale S, Franzese A, Mozzillo E, Gianfrani C, Del Pozzo G G. HLA-DQA1 and HLA-DQB1 Alleles, Conferring Susceptibility to Celiac Disease and Type 1 Diabetes, Are More Expressed Than Non-Predisposing Alleles and Are Coordinately Regulated. Cells. 2019; 8(7):751. https://doi.org/10.3390/cells8070751
Chicago/Turabian StyleFarina, Federica, Stefania Picascia, Laura Pisapia, Pasquale Barba, Serena Vitale, Adriana Franzese, Enza Mozzillo, Carmen Gianfrani, and Giovanna Del Pozzo G. 2019. "HLA-DQA1 and HLA-DQB1 Alleles, Conferring Susceptibility to Celiac Disease and Type 1 Diabetes, Are More Expressed Than Non-Predisposing Alleles and Are Coordinately Regulated" Cells 8, no. 7: 751. https://doi.org/10.3390/cells8070751
APA StyleFarina, F., Picascia, S., Pisapia, L., Barba, P., Vitale, S., Franzese, A., Mozzillo, E., Gianfrani, C., & Del Pozzo G, G. (2019). HLA-DQA1 and HLA-DQB1 Alleles, Conferring Susceptibility to Celiac Disease and Type 1 Diabetes, Are More Expressed Than Non-Predisposing Alleles and Are Coordinately Regulated. Cells, 8(7), 751. https://doi.org/10.3390/cells8070751

