The Tumor Suppressor DAB2IP Is Regulated by Cell Contact and Contributes to YAP/TAZ Inhibition in Confluent Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines, Culture Conditions, Transfections, Trasductions, and Drug Treatments
2.2. Protein Analysis
2.3. RNA Extraction and RT-qPCR
2.4. Immunofluorescence Microscopy
2.5. BrdU Incorporation Assay
2.6. AFM Force Spectroscopy
2.7. Luciferase Reporter Assay
2.8. Statistical Analysis
3. Results
3.1. DAB2IP Protein Levels Change with Cell Density in 2D Cultures
3.2. DAB2IP Levels Are Reduced When Cells Are Detached from the Substrate or Lose Contact with Adjacent Cells
3.3. Cytoskeletal Tension Sustains DAB2IP Levels in Low-Density Conditions but Is Not Required in Confluent Cells
3.4. DAB2IP Depletion Alters the Morphology of Epithelial Cells Grown at Confluency
3.5. DAB2IP Contributes to YAP/TAZ Inhibition in Confluent Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Northey, J.J.; Przybyla, L.; Weaver, V.M. Tissue Force Programs Cell Fate and Tumor Aggression. Cancer Discov. 2017, 7, 1224–1237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shmelev, M.E.; Titov, S.I.; Belousov, A.S.; Farniev, V.M.; Zhmenia, V.M.; Lanskikh, D.V.; Penkova, A.O.; Kumeiko, V.V. Cell and Tissue Nanomechanics: From Early Development to Carcinogenesis. Biomedicines 2022, 10, 345. [Google Scholar] [CrossRef] [PubMed]
- Le Bras, G.F.; Taubenslag, K.J.; Andl, C.D. The regulation of cell-cell adhesion during epithelial-mesenchymal transition, motility and tumor progression. Cell Adh. Migr. 2012, 6, 365–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pocaterra, A.; Romani, P.; Dupont, S. YAP/TAZ functions and their regulation at a glance. J. Cell Sci. 2020, 133, jcs230425. [Google Scholar] [CrossRef] [PubMed]
- Battilana, G.; Zanconato, F.; Piccolo, S. Mechanisms of YAP/TAZ transcriptional control. Cell Stress 2021, 5, 167–172. [Google Scholar] [CrossRef]
- Piccolo, S.; Panciera, T.; Contessotto, P.; Cordenonsi, M. YAP/TAZ as master regulators in cancer: Modulation, function and therapeutic approaches. Nat. Cancer 2023, 4, 9–26. [Google Scholar] [CrossRef]
- Zanconato, F.; Cordenonsi, M.; Piccolo, S. YAP and TAZ: A signalling hub of the tumour microenvironment. Nat. Rev. Cancer 2019, 19, 454–464. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Pan, D. The Hippo Signaling Pathway in Development and Disease. Dev. Cell 2019, 50, 264–282. [Google Scholar] [CrossRef]
- Cai, X.; Wang, K.C.; Meng, Z. Mechanoregulation of YAP and TAZ in Cellular Homeostasis and Disease Progression. Front. Cell Dev. Biol. 2021, 9, 673599. [Google Scholar] [CrossRef]
- Dupont, S.; Morsut, L.; Aragona, M.; Enzo, E.; Giulitti, S.; Cordenonsi, M.; Zanconato, F.; Le Digabel, J.; Forcato, M.; Bicciato, S.; et al. Role of YAP/TAZ in mechanotransduction. Nature 2011, 474, 179–183. [Google Scholar] [CrossRef]
- Aragona, M.; Panciera, T.; Manfrin, A.; Giulitti, S.; Michielin, F.; Elvassore, N.; Dupont, S.; Piccolo, S. A Mechanical Checkpoint Controls Multicellular Growth through YAP/TAZ Regulation by Actin-Processing Factors. Cell 2013, 154, 1047–1059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellazzo, A.; Di Minin, G.; Collavin, L. Block one, unleash a hundred. Mechanisms of DAB2IP inactivation in cancer. Cell Death Differ. 2017, 24, 15–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, L.; Xu, C.; Hsieh, J.T.; Gong, J.; Xie, D. DAB2IP in cancer. Oncotarget 2016, 7, 3766–3776. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, A.L.; Perurena, N.; Gardner, A.; Hinoue, T.; Loi, P.; Laird, P.W.; Cichowski, K. DAB2IP is a bifunctional tumor suppressor that regulates wildtype RAS and inflammatory cascades in KRAS mutant colon cancer. Cancer Res. 2023, 83, 1800–1814. [Google Scholar] [CrossRef] [PubMed]
- Olsen, S.N.; Wronski, A.; Castano, Z.; Dake, B.; Malone, C.; De Raedt, T.; Enos, M.; DeRose, Y.S.; Zhou, W.; Guerra, S.; et al. Loss of RasGAP Tumor Suppressors Underlies the Aggressive Nature of Luminal B Breast Cancers. Cancer Discov. 2017, 7, 202–217. [Google Scholar] [CrossRef] [Green Version]
- Bellazzo, A.; Collavin, L. Cutting the Brakes on Ras-Cytoplasmic GAPs as Targets of Inactivation in Cancer. Cancers 2020, 12, 3066. [Google Scholar] [CrossRef]
- Zhang, H.; He, Y.; Dai, S.; Xu, Z.; Luo, Y.; Wan, T.; Luo, D.; Jones, D.; Tang, S.; Chen, H.; et al. AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis in mice. J. Clin. Investig. 2008, 118, 3904–3916. [Google Scholar] [CrossRef] [Green Version]
- Di Minin, G.; Bellazzo, A.; Dal Ferro, M.; Chiaruttini, G.; Nuzzo, S.; Bicciato, S.; Piazza, S.; Rami, D.; Bulla, R.; Sommaggio, R.; et al. Mutant p53 Reprograms TNF Signaling in Cancer Cells through Interaction with the Tumor Suppressor DAB2IP. Mol. Cell 2014, 56, 617–629. [Google Scholar] [CrossRef] [Green Version]
- Yu, L.; Qin, L.; Zhang, H.; He, Y.; Chen, H.; Pober, J.S.; Tellides, G.; Min, W. AIP1 prevents graft arteriosclerosis by inhibiting interferon-γ-dependent smooth muscle cell proliferation and intimal expansion. Circ. Res. 2011, 109, 418–427. [Google Scholar] [CrossRef] [Green Version]
- Valentino, E.; Bellazzo, A.; Di Minin, G.; Sicari, D.; Apollonio, M.; Scognamiglio, G.; Di Bonito, M.; Botti, G.; Del Sal, G.; Collavin, L. Mutant p53 potentiates the oncogenic effects of insulin by inhibiting the tumor suppressor DAB2IP. Proc. Natl. Acad. Sci. USA 2017, 114, 7623–7628. [Google Scholar] [CrossRef] [Green Version]
- Wu, K.; Liu, J.; Tseng, S.F.; Gore, C.; Ning, Z.; Sharifi, N.; Fazli, L.; Gleave, M.; Kapur, P.; Xiao, G.; et al. The role of DAB2IP in androgen receptor activation during prostate cancer progression. Oncogene 2014, 33, 1954–1963. [Google Scholar] [CrossRef] [PubMed]
- Raza, Q.; Choi, J.Y.; Li, Y.; O'Dowd, R.M.; Watkins, S.C.; Chikina, M.; Hong, Y.; Clark, N.L.; Kwiatkowski, A.V. Evolutionary rate covariation analysis of E-cadherin identifies Raskol as a regulator of cell adhesion and actin dynamics in Drosophila. PLoS Genet. 2019, 15, e1007720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, M.; Xu, C.; Wang, H.Z.; Peng, Y.N.; Li, H.O.; Zhou, Y.J.; Liu, S.; Wang, F.; Liu, L.; Chang, Y.; et al. Soft fibrin matrix downregulates DAB2IP to promote Nanog-dependent growth of colon tumor-repopulating cells. Cell Death Dis. 2019, 10, 151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Capaci, V.; Bascetta, L.; Fantuz, M.; Beznoussenko, G.V.; Sommaggio, R.; Cancila, V.; Bisso, A.; Campaner, E.; Mironov, A.A.; Wisniewski, J.R.; et al. Mutant p53 induces Golgi tubulo-vesiculation driving a prometastatic secretome. Nat. Commun. 2020, 11, 3945. [Google Scholar] [CrossRef]
- Bellazzo, A.; Di Minin, G.; Valentino, E.; Sicari, D.; Torre, D.; Marchionni, L.; Serpi, F.; Stadler, M.B.; Taverna, D.; Zuccolotto, G.; et al. Cell-autonomous and cell non-autonomous downregulation of tumor suppressor DAB2IP by microRNA-149-3p promotes aggressiveness of cancer cells. Cell Death Differ. 2018, 25, 1224–1238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gumbiner, B.M.; Kim, N.G. The Hippo-YAP signaling pathway and contact inhibition of growth. J. Cell Sci. 2014, 127, 709–717. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lecuit, T.; Yap, A.S. E-cadherin junctions as active mechanical integrators in tissue dynamics. Nat. Cell Biol. 2015, 17, 533–539. [Google Scholar] [CrossRef]
- Tapial Martinez, P.; Lopez Navajas, P.; Lietha, D. FAK Structure and Regulation by Membrane Interactions and Force in Focal Adhesions. Biomolecules 2020, 10, 179. [Google Scholar] [CrossRef] [Green Version]
- Clapham, D.E. Calcium signaling. Cell 2007, 131, 1047–1058. [Google Scholar] [CrossRef] [Green Version]
- Ozawa, M.; Kemler, R. Correct proteolytic cleavage is required for the cell adhesive function of uvomorulin. J. Cell Biol. 1990, 111, 1645–1650. [Google Scholar] [CrossRef] [Green Version]
- Slack-Davis, J.K.; Martin, K.H.; Tilghman, R.W.; Iwanicki, M.; Ung, E.J.; Autry, C.; Luzzio, M.J.; Cooper, B.; Kath, J.C.; Roberts, W.G.; et al. Cellular characterization of a novel focal adhesion kinase inhibitor. J. Biol. Chem. 2007, 282, 14845–14852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paine, T.M.; Soule, H.D.; Pauley, R.J.; Dawson, P.J. Characterization of epithelial phenotypes in mortal and immortal human breast cells. Int. J. Cancer 1992, 50, 463–473. [Google Scholar] [CrossRef] [PubMed]
- Mugahid, D.; Kalocsay, M.; Liu, X.; Gruver, J.S.; Peshkin, L.; Kirschner, M.W. YAP regulates cell size and growth dynamics via non-cell autonomous mediators. Elife 2020, 9, e53404. [Google Scholar] [CrossRef] [PubMed]
- Azzolin, L.; Panciera, T.; Soligo, S.; Enzo, E.; Bicciato, S.; Dupont, S.; Bresolin, S.; Frasson, C.; Basso, G.; Guzzardo, V.; et al. YAP/TAZ incorporation in the beta-catenin destruction complex orchestrates the Wnt response. Cell 2014, 158, 157–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reddy, B.V.; Irvine, K.D. Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins. Dev. Cell 2013, 24, 459–471. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, X.; Nguyen, H.T.; Chen, Q.; Zhang, R.; Hagman, Z.; Voorhoeve, P.M.; Cohen, S.M. Opposing activities of the Ras and Hippo pathways converge on regulation of YAP protein turnover. EMBO J. 2014, 33, 2447–2457. [Google Scholar] [CrossRef] [PubMed]
- Lupo, B.; Sassi, F.; Pinnelli, M.; Galimi, F.; Zanella, E.R.; Vurchio, V.; Migliardi, G.; Gagliardi, P.A.; Puliafito, A.; Manganaro, D.; et al. Colorectal cancer residual disease at maximal response to EGFR blockade displays a druggable Paneth cell-like phenotype. Sci. Transl. Med. 2020, 12, eaax8313. [Google Scholar] [CrossRef]
- Panciera, T.; Citron, A.; Di Biagio, D.; Battilana, G.; Gandin, A.; Giulitti, S.; Forcato, M.; Bicciato, S.; Panzetta, V.; Fusco, S.; et al. Reprogramming normal cells into tumour precursors requires ECM stiffness and oncogene-mediated changes of cell mechanical properties. Nat. Mater. 2020, 19, 797–806. [Google Scholar] [CrossRef]
- Xie, D.; Gore, C.; Zhou, J.; Pong, R.-C.; Zhang, H.; Yu, L.; Vessella, R.L.; Min, W.; Hsieh, J.-T. DAB2IP coordinates both PI3K-Akt and ASK1 pathways for cell survival and apoptosis. Proc. Natl. Acad. Sci. USA 2009, 106, 19878–19883. [Google Scholar] [CrossRef] [Green Version]
- Fan, R.; Kim, N.-G.; Gumbiner, B.M. Regulation of Hippo pathway by mitogenic growth factors via phosphoinositide 3-kinase and phosphoinositide-dependent kinase-1. Proc. Natl. Acad. Sci. USA 2013, 110, 2569–2574. [Google Scholar] [CrossRef] [Green Version]
- Xie, D.; Gore, C.; Liu, J.; Pong, R.-C.; Mason, R.; Hao, G.; Long, M.; Kabbani, W.; Yu, L.; Zhang, H.; et al. Role of DAB2IP in modulating epithelial-to-mesenchymal transition and prostate cancer metastasis. Proc. Natl. Acad. Sci. USA 2010, 107, 2485–2490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, Z.; Yang, L.; Li, N.; Fu, J.; Liu, P.; Sun, P.; Wei, W.; Xie, X. DAB2IP attenuates chemoresistance of triple-negative breast cancer through sequestration of RAC1 to prevent β-catenin nuclear accumulation. Clin. Transl. Med. 2022, 12, e1133. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.; Maitra, A.; Anders, R.A.; Taketo, M.M.; Pan, D. β-Catenin destruction complex-independent regulation of Hippo-YAP signaling by APC in intestinal tumorigenesis. Genes. Dev. 2015, 29, 1493–1506. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imajo, M.; Miyatake, K.; Iimura, A.; Miyamoto, A.; Nishida, E. A molecular mechanism that links Hippo signalling to the inhibition of Wnt/beta-catenin signalling. EMBO J. 2012, 31, 1109–1122. [Google Scholar] [CrossRef] [Green Version]
siRNA | Sequence | Purchased from |
---|---|---|
Control siRNA | Unknown | AllStars negative control (1027281, Qiagen, Venlo, The Netherlands) |
siDAB2IP A | GGAGCGCAACAGUUACCUG | Eurofins (Luxembourg City, Luxembourg) |
siDAB2IP B | GGUGAAGGACUUCCUGACA | Eurofins |
siE-cadherin | GCAGAAAUUAUUGGGCUCUUU | Eurofins |
Target | Sequence | |
---|---|---|
ANKRD1 | Forward | 5′-CACTTCTAGCCCACCCTGTGA-3′ |
Reverse | 5′-CCACAGGTTCCGTAATGATTT-3′ | |
CTGF | Forward | 5′-AGGAGTGGGTGTGTGACGA-3′ |
Reverse | 5′-CCAGGCAGTTGGCTCTAATC-3′ | |
CYR61 | Forward | 5′-AGCCTCGCATCCTATACAACC-3′ |
Reverse | 5′-TTCTTTCACAAGGCGGCACTC-3′ | |
DAB2IP | Forward | 5′-CACATCACCAACCACTAC-3′ |
Reverse | 5′-TCCACCTCTGACATCATC-3′ | |
YAP | Forward | 5′-GCCGGAGCCCAAATCC-3′ |
Reverse | 5′-GCAGAGAAGCTGGAGAGGAATG-3′ | |
H3 | Forward | 5′-GAAGAAACCTCATCG TTACAGGCCTGGT-3′ |
Reverse | 5′-CTG CAAAGCACCAATAGCTGCACTCTGGAA-3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Apollonio, M.; Bellazzo, A.; Franco, N.; Lombardi, S.; Senigagliesi, B.; Casalis, L.; Parisse, P.; Thalhammer, A.; Baj, G.; De Florian Fania, R.; et al. The Tumor Suppressor DAB2IP Is Regulated by Cell Contact and Contributes to YAP/TAZ Inhibition in Confluent Cells. Cancers 2023, 15, 3379. https://doi.org/10.3390/cancers15133379
Apollonio M, Bellazzo A, Franco N, Lombardi S, Senigagliesi B, Casalis L, Parisse P, Thalhammer A, Baj G, De Florian Fania R, et al. The Tumor Suppressor DAB2IP Is Regulated by Cell Contact and Contributes to YAP/TAZ Inhibition in Confluent Cells. Cancers. 2023; 15(13):3379. https://doi.org/10.3390/cancers15133379
Chicago/Turabian StyleApollonio, Mattia, Arianna Bellazzo, Nicoletta Franco, Silvia Lombardi, Beatrice Senigagliesi, Loredana Casalis, Pietro Parisse, Agnes Thalhammer, Gabriele Baj, Rossella De Florian Fania, and et al. 2023. "The Tumor Suppressor DAB2IP Is Regulated by Cell Contact and Contributes to YAP/TAZ Inhibition in Confluent Cells" Cancers 15, no. 13: 3379. https://doi.org/10.3390/cancers15133379