Impact of Angiogenesis- and Hypoxia-Associated Polymorphisms on Tumor Recurrence in Patients with Hepatocellular Carcinoma Undergoing Surgical Resection
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Patients Characteristics
2.2. Analysis of IL-8 T-251A and Clinical Outcome
2.3. Analysis of VEGF C + 936T and Clinical Outcome
2.4. Combined Analysis of VEGF C + 936T, IL-8 T-251A and Clinical Outcome
2.5. Analysis of Other Tested Germline Polymorphisms
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Selection of Candidate Polymorphisms
4.3. Genotyping
4.4. Study Endpoints and Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Bray, F.; Soerjomataram, I. The changing global burden of cancer: Transitions in human development and implications for cancer prevention and control. In Cancer: Disease Control Priorities, 3rd ed.; Gelband, H., Jha, P., Sankaranarayanan, R., Horton, S., Eds.; World Bank: Washington, DC, USA, 2015; Volume 3, pp. 23–45. [Google Scholar]
- Akinyemiju, T.; Abera, S.; Ahmed, M.; Alam, N.; Alemayohu, M.A.; Allen, C.; Al-Raddadi, R.; Alvis-Guzman, N.; Amoako, Y.; Artaman, A.; et al. The Burden of Primary Liver Cancer and Underlying Etiologies From 1990 to 2015 at the Global, Regional, and National Level: Results From the Global Burden of Disease Study 2015. JAMA Oncol. 2017, 3, 1683–1691. [Google Scholar] [CrossRef]
- Lurje, I.; Czigany, Z.; Bednarsch, J.; Roderburg, C.; Isfort, P.; Neumann, U.P.; Lurje, G. Treatment Strategies for Hepatocellular Carcinoma (-) a Multidisciplinary Approach. Int. J. Mol. Sci. 2019, 20, 1465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lurje, G.; Lesurtel, M.; Clavien, P.A. Multimodal treatment strategies in patients undergoing surgery for hepatocellular carcinoma. Dig. Dis. 2013, 31, 112–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Czigany, Z.; Lurje, I.; Tolba, R.H.; Neumann, U.P.; Tacke, F.; Lurje, G. Machine perfusion for liver transplantation in the era of marginal organs-New kids on the block. Liver Int. 2019, 39, 228–249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Czigany, Z.; Schöning, W.; Ulmer, T.F.; Bednarsch, J.; Amygdalos, I.; Cramer, T.; Rogiers, X.; Popescu, I.; Botea, F.; Froněk, J.; et al. Hypothermic oxygenated machine perfusion (HOPE) for orthotopic liver transplantation of human liver allografts from extended criteria donors (ECD) in donation after brain death (DBD): A prospective multicentre randomised controlled trial (HOPE ECD-DBD). BMJ Open 2017, 7, e017558. [Google Scholar] [CrossRef] [PubMed]
- Lurje, G.; Bednarsch, J.; Czigany, Z.; Amygdalos, I.; Meister, F.; Schoning, W.; Ulmer, T.F.; Foerster, M.; Dejong, C.; Neumann, U.P. Prognostic factors of disease-free and overall survival in patients with hepatocellular carcinoma undergoing partial hepatectomy in curative intent. Langenbecks Arch. Surg. 2018, 403, 851–861. [Google Scholar] [CrossRef]
- Pompili, M.; Saviano, A.; de Matthaeis, N.; Cucchetti, A.; Ardito, F.; Federico, B.; Brunello, F.; Pinna, A.D.; Giorgio, A.; Giulini, S.M.; et al. Long-term effectiveness of resection and radiofrequency ablation for single hepatocellular carcinoma ≤3 cm. Results of a multicenter Italian survey. J. Hepatol. 2013, 59, 89–97. [Google Scholar] [CrossRef]
- Bednarsch, J.; Czigany, Z.; Lurje, I.; Trautwein, C.; Ludde, T.; Strnad, P.; Gaisa, N.T.; Barabasch, A.; Bruners, P.; Ulmer, T.; et al. Intraoperative Transfusion of Fresh Frozen Plasma Predicts Morbidity Following Partial Liver Resection for Hepatocellular Carcinoma. J. Gastrointest. Surg. 2020, 1–12. [Google Scholar] [CrossRef]
- Bergers, G.; Benjamin, L.E. Tumorigenesis and the angiogenic switch. Nat. Rev. Cancer 2003, 3, 401–410. [Google Scholar] [CrossRef]
- Baeriswyl, V.; Christofori, G. The angiogenic switch in carcinogenesis. Semin. Cancer Biol. 2009, 19, 329–337. [Google Scholar] [CrossRef]
- Tirpe, A.A.; Gulei, D.; Ciortea, S.M.; Crivii, C.; Berindan-Neagoe, I. Hypoxia: Overview on Hypoxia-Mediated Mechanisms with a Focus on the Role of HIF Genes. Int. J. Mol. Sci. 2019, 20, 6140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Finn, R.S.; Qin, S.; Ikeda, M.; Galle, P.R.; Ducreux, M.; Kim, T.Y.; Kudo, M.; Breder, V.; Merle, P.; Kaseb, A.O.; et al. Atezolizumab plus Bevacizumab in Unresectable Hepatocellular Carcinoma. N. Engl. J. Med. 2020, 382, 1894–1905. [Google Scholar] [CrossRef] [PubMed]
- Morse, M.A.; Sun, W.; Kim, R.; He, A.R.; Abada, P.B.; Mynderse, M.; Finn, R.S. The Role of Angiogenesis in Hepatocellular Carcinoma. Clin. Cancer Res. 2019, 25, 912–920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strieter, R.M. Masters of angiogenesis. Nat. Med. 2005, 11, 925–927. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.C.; Tang, Z.Y. Angiogenesis in hepatocellular carcinoma: The retrospectives and perspectives. J. Cancer Res. Clin. Oncol. 2004, 130, 307–319. [Google Scholar] [CrossRef]
- Rhodes, K.E.; Zhang, W.; Yang, D.; Press, O.A.; Gordon, M.; Vallbohmer, D.; Schultheis, A.M.; Lurje, G.; Ladner, R.D.; Fazzone, W.; et al. ABCB1, SLCO1B1 and UGT1A1 gene polymorphisms are associated with toxicity in metastatic colorectal cancer patients treated with first-line irinotecan. Drug Metab. Lett. 2007, 1, 23–30. [Google Scholar] [CrossRef] [PubMed]
- Lurje, G.; Husain, H.; Power, D.G.; Yang, D.; Groshen, S.; Pohl, A.; Zhang, W.; Ning, Y.; Manegold, P.C.; El-Khoueiry, A.; et al. Genetic variations in angiogenesis pathway genes associated with clinical outcome in localized gastric adenocarcinoma. Ann. Oncol. 2010, 21, 78–86. [Google Scholar] [CrossRef] [PubMed]
- Lurje, G.; Leers, J.M.; Pohl, A.; Oezcelik, A.; Zhang, W.; Ayazi, S.; Winder, T.; Ning, Y.; Yang, D.; Klipfel, N.E.; et al. Genetic variations in angiogenesis pathway genes predict tumor recurrence in localized adenocarcinoma of the esophagus. Ann. Surg. 2010, 251, 857–864. [Google Scholar] [CrossRef] [PubMed]
- Lurje, G.; Zhang, W.; Schultheis, A.M.; Yang, D.; Groshen, S.; Hendifar, A.E.; Husain, H.; Gordon, M.A.; Nagashima, F.; Chang, H.M.; et al. Polymorphisms in VEGF and IL-8 predict tumor recurrence in stage III colon cancer. Ann. Oncol. 2008, 19, 1734–1741. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Hua, Y.; Tan, S.; Li, M.; Yongxiang, S.; Fang, G. Interactions of smoking with rs833061 polymorphism on the risk of non-alcoholic fat liver disease in Hubei Han population: A preliminary case-control study. Iran. J. Basic Med. Sci. 2015, 18, 1112–1117. [Google Scholar] [PubMed]
- Deng, Y.; Ning, Z.; Hu, Z.; Yu, Q.; He, B.; Hu, G. High interleukin-8 and/or extracellular signal-regulated kinase 2 expression predicts poor prognosis in patients with hepatocellular carcinoma. Oncol. Lett. 2019, 18, 5215–5224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shakiba, E.; Sadeghi, M.; Shakiba, M. A systematic review and meta-analysis of evaluation of serum interleukin 8 levels in hepatocellular carcinoma. Clin. Exp. Hepatol. 2019, 5, 123–128. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Hormazabal, P.; Romero, S.; Musleh, M.; Bustamante, M.; Stambuk, J.; Pisano, R.; Lanzarini, E.; Chiong, H.; Rojas, J.; Castro, V.G.; et al. IL-8-251T>A (rs4073) Polymorphism Is Associated with Prognosis in Gastric Cancer Patients. Anticancer Res. 2018, 38, 5703–5708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baggiolini, M.; Walz, A.; Kunkel, S.L. Neutrophil-activating peptide-1/interleukin 8, a novel cytokine that activates neutrophils. J. Clin. Invest. 1989, 84, 1045–1049. [Google Scholar] [CrossRef]
- Renner, W.; Kotschan, S.; Hoffmann, C.; Obermayer-Pietsch, B.; Pilger, E. A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J. Vasc. Res. 2000, 37, 443–448. [Google Scholar] [CrossRef]
- Sankaran, D.; Asderakis, A.; Ashraf, S.; Roberts, I.S.; Short, C.D.; Dyer, P.A.; Sinnott, P.J.; Hutchinson, I.V. Cytokine gene polymorphisms predict acute graft rejection following renal transplantation. Kidney Int. 1999, 56, 281–288. [Google Scholar] [CrossRef] [Green Version]
- Schneider, B.P.; Radovich, M.; Sledge, G.W.; Robarge, J.D.; Li, L.; Storniolo, A.M.; Lemler, S.; Nguyen, A.T.; Hancock, B.A.; Stout, M.; et al. Association of polymorphisms of angiogenesis genes with breast cancer. Breast Cancer Res. Treat. 2008, 111, 157–163. [Google Scholar] [CrossRef]
- Faloppi, L.; Puzzoni, M.; Casadei Gardini, A.; Silvestris, N.; Masi, G.; Marisi, G.; Vivaldi, C.; Gadaleta, C.D.; Ziranu, P.; Bianconi, M.; et al. Angiogenesis Genotyping and Clinical Outcomes in Patients with Advanced Hepatocellular Carcinoma Receiving Sorafenib: The ALICE-2 Study. Target. Oncol. 2020, 15, 115–126. [Google Scholar] [CrossRef]
- Gholizadeh, M.; Khosravi, A.; Torabian, P.; Gholipoor, N.; Mansour Samaei, N. Association of the epidermal growth factor gene +61A>G polymorphism with hepatocellular carcinoma in an Iranian population. Gastroenterol. Hepatol. Bed Bench 2017, 10, 284–288. [Google Scholar]
- Zhang, S.; Qiao, K.; Trieu, C.; Huo, Z.; Dai, Q.; Du, Y.; Lu, W.; Hou, W. Genetic Polymorphism of Epidermal Growth Factor rs4444903 Influences Susceptibility to HCV-Related Liver Cirrhosis and Hepatocellular Carcinoma in a Chinese Han Population. Clin. Lab. 2017, 63, 845–850. [Google Scholar] [CrossRef]
- Choi, J.E.; Park, S.H.; Kim, K.M.; Lee, W.K.; Kam, S.; Cha, S.I.; Kim, C.H.; Kang, Y.M.; Kim, Y.C.; Han, S.B.; et al. Polymorphisms in the epidermal growth factor receptor gene and the risk of primary lung cancer: A case-control study. BMC Cancer 2007, 7, 199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, T.; Maesawa, C.; Ikeda, K.; Wakabayashi, G.; Masuda, T. Mutations of the epidermal growth factor receptor gene in gastrointestinal tract tumor cell lines. Oncol. Rep. 2006, 15, 1205–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grochola, L.F.; Zeron-Medina, J.; Mériaux, S.; Bond, G.L. Single-nucleotide polymorphisms in the p53 signaling pathway. Cold Spring Harb. Perspect. Biol. 2010, 2, a001032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Snoussi, K.; Mahfoudh, W.; Bouaouina, N.; Fekih, M.; Khairi, H.; Helal, A.N.; Chouchane, L. Combined effects of IL-8 and CXCR2 gene polymorphisms on breast cancer susceptibility and aggressiveness. BMC Cancer 2010, 10, 283. [Google Scholar] [CrossRef] [Green Version]
- Tak, K.H.; Yu, G.I.; Lee, M.Y.; Shin, D.H. Association Between Polymorphisms of Interleukin 1 Family Genes and Hepatocellular Carcinoma. Med. Sci. Monit. 2018, 24, 3488–3495. [Google Scholar] [CrossRef]
- Knechtel, G.; Szkandera, J.; Stotz, M.; Hofmann, G.; Langsenlehner, U.; Krippl, P.; Samonigg, H.; Renner, W.; Langner, C.; Dehchamani, D.; et al. Single nucleotide polymorphisms in the hypoxia-inducible factor-1 gene and colorectal cancer risk. Mol. Carcinog. 2010, 49, 805–809. [Google Scholar] [CrossRef]
- Choi, S.H.; Park, J.Y.; Kang, W.; Kim, S.U.; Kim do, Y.; Ahn, S.H.; Ro, S.W.; Han, K.H. Knockdown of HIF-1α and IL-8 induced apoptosis of hepatocellular carcinoma triggers apoptosis of vascular endothelial cells. Apoptosis 2016, 21, 85–95. [Google Scholar] [CrossRef]
- Shin, H.D.; Winkler, C.; Stephens, J.C.; Bream, J.; Young, H.; Goedert, J.J.; O’Brien, T.R.; Vlahov, D.; Buchbinder, S.; Giorgi, J.; et al. Genetic restriction of HIV-1 pathogenesis to AIDS by promoter alleles of IL10. Proc. Natl. Acad. Sci. USA 2000, 97, 14467–14472. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Wang, Z.; Xiao, Y.; Lu, Y.; Lu, Y. Association between the interleukin-6 gene polymorphisms and renal cancer risk. Immunol. Lett. 2015, 164, 125–128. [Google Scholar] [CrossRef]
- Scartozzi, M.; Faloppi, L.; Svegliati Baroni, G.; Loretelli, C.; Piscaglia, F.; Iavarone, M.; Toniutto, P.; Fava, G.; De Minicis, S.; Mandolesi, A.; et al. VEGF and VEGFR genotyping in the prediction of clinical outcome for HCC patients receiving sorafenib: The ALICE-1 study. Int. J. Cancer 2014, 135, 1247–1256. [Google Scholar] [CrossRef] [Green Version]
- Zhu, A.X.; Duda, D.G.; Sahani, D.V.; Jain, R.K. HCC and angiogenesis: Possible targets and future directions. Nat. Rev. Clin. Oncol. 2011, 8, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Abou-Alfa, G.K.; Schwartz, L.; Ricci, S.; Amadori, D.; Santoro, A.; Figer, A.; De Greve, J.; Douillard, J.Y.; Lathia, C.; Schwartz, B.; et al. Phase II study of sorafenib in patients with advanced hepatocellular carcinoma. J. Clin. Oncol. 2006, 24, 4293–4300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Llovet, J.M.; Ricci, S.; Mazzaferro, V.; Hilgard, P.; Gane, E.; Blanc, J.F.; de Oliveira, A.C.; Santoro, A.; Raoul, J.L.; Forner, A.; et al. Sorafenib in advanced hepatocellular carcinoma. N. Engl. J. Med. 2008, 359, 378–390. [Google Scholar] [CrossRef] [PubMed]
- Schoenleber, S.J.; Kurtz, D.M.; Talwalkar, J.A.; Roberts, L.R.; Gores, G.J. Prognostic role of vascular endothelial growth factor in hepatocellular carcinoma: Systematic review and meta-analysis. Br. J. Cancer 2009, 100, 1385–1392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, B.; Lin, N.; Zhang, M.; Zhu, Y.; Cheng, H.; Chen, S.; Ling, Y.; Pan, W.; Xu, R. Activated hepatic stellate cells promote angiogenesis via interleukin-8 in hepatocellular carcinoma. J. Transl. Med. 2015, 13, 365. [Google Scholar] [CrossRef] [Green Version]
- Carmeliet, P. VEGF as a key mediator of angiogenesis in cancer. Oncology 2005, 69 (Suppl. 3), 4–10. [Google Scholar] [CrossRef]
- Kim, Y.-J.; Chung, W.C.; Jun, K.-H.; Chin, H.-M. Genetic polymorphisms of vascular endothelial growth factor (VEGF) associated with gastric cancer recurrence after curative resection with adjuvant chemotherapy. BMC Cancer 2019, 19, 483. [Google Scholar] [CrossRef]
- Jain, L.; Vargo, C.A.; Danesi, R.; Sissung, T.M.; Price, D.K.; Venzon, D.; Venitz, J.; Figg, W.D. The role of vascular endothelial growth factor SNPs as predictive and prognostic markers for major solid tumors. Mol. Cancer Ther. 2009, 8, 2496–2508. [Google Scholar] [CrossRef] [Green Version]
- Masago, K.; Fujita, S.; Kim, Y.H.; Hatachi, Y.; Fukuhara, A.; Nagai, H.; Irisa, K.; Ichikawa, M.; Mio, T.; Mishima, M. Effect of vascular endothelial growth factor polymorphisms on survival in advanced-stage non-small-cell lung cancer. Cancer Sci. 2009, 100, 1917–1922. [Google Scholar] [CrossRef]
- Fousek, K.; Horn, L.A.; Palena, C. Interleukin-8: A chemokine at the intersection of cancer plasticity, angiogenesis, and immune suppression. Pharmacol. Ther. 2020, 107692. [Google Scholar] [CrossRef]
- Marra, F.; Tacke, F. Roles for chemokines in liver disease. Gastroenterology 2014, 147, 577–594.e571. [Google Scholar] [CrossRef] [PubMed]
- Xiao, P.; Long, X.; Zhang, L.; Ye, Y.; Guo, J.; Liu, P.; Zhang, R.; Ning, J.; Yu, W.; Wei, F.; et al. Neurotensin/IL-8 pathway orchestrates local inflammatory response and tumor invasion by inducing M2 polarization of Tumor-Associated macrophages and epithelial-mesenchymal transition of hepatocellular carcinoma cells. Oncoimmunology 2018, 7, e1440166. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.; Wang, J.; Sun, Q.; Li, F.; Gao, H.; Xu, L.; Zhang, J.; Sun, X.; Tian, Y.; Zhao, Q.; et al. Interleukin-8 promotes integrin β3 upregulation and cell invasion through PI3K/Akt pathway in hepatocellular carcinoma. J. Exp. Clin. Cancer Res. 2019, 38, 449. [Google Scholar] [CrossRef]
- Loosen, S.H.; Schulze-Hagen, M.; Leyh, C.; Benz, F.; Vucur, M.; Kuhl, C.; Trautwein, C.; Tacke, F.; Bruners, P.; Roderburg, C.; et al. IL-6 and IL-8 Serum Levels Predict Tumor Response and Overall Survival after TACE for Primary and Secondary Hepatic Malignancies. Int. J. Mol. Sci. 2018, 19, 1766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.L.; Nong, L.G.; Wei, Y.S.; Tang, Y.J.; Wang, J.C.; Wang, C.F. Association of interleukin-8 gene polymorphisms with the risk of hepatocellular carcinoma. Mol. Biol. Rep. 2014, 41, 1483–1489. [Google Scholar] [CrossRef] [PubMed]
- Motawi, T.K.; Shaker, O.G.; Ismail, M.F.; Sayed, N.H. Genetic variants associated with the progression of hepatocellular carcinoma in hepatitis C Egyptian patients. Gene 2013, 527, 516–520. [Google Scholar] [CrossRef]
- Chien, M.H.; Yeh, C.B.; Li, Y.C.; Wei, L.H.; Chang, J.H.; Peng, Y.T.; Yang, S.F.; Kuo, W.H. Relationship of interleukin-8 gene polymorphisms with hepatocellular carcinoma susceptibility and pathological development. J. Surg. Oncol. 2011, 104, 798–803. [Google Scholar] [CrossRef]
- Hull, J.; Thomson, A.; Kwiatkowski, D. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax 2000, 55, 1023–1027. [Google Scholar] [CrossRef] [Green Version]
- Lu, X.H.; Mao, G.X.; Zhang, Y.Y.; Chu, Y.S.; Yuan, H.X.; Zhu, X.Q. Association between variants of IL-8 and IL-10 genes, and efficacy of transcatheter arterial chemoembolization and subsequent prognosis in patients with liver cancer. Eur. Rev. Med. Pharmacol. Sci. 2015, 19, 3218–3223. [Google Scholar]
- Hicklin, D.J.; Ellis, L.M. Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. J. Clin. Oncol. 2005, 23, 1011–1027. [Google Scholar] [CrossRef]
- Loosen, S.H.; Roderburg, C.; Kauertz, K.L.; Koch, A.; Vucur, M.; Schneider, A.T.; Binnebösel, M.; Ulmer, T.F.; Lurje, G.; Schoening, W.; et al. CEA but not CA19-9 is an independent prognostic factor in patients undergoing resection of cholangiocarcinoma. Sci. Rep. 2017, 7, 16975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
No. | Gene | Allele | SNP 1 | Allele Function | Minor Allele Freq. | Description | Ref. |
---|---|---|---|---|---|---|---|
1 | IL-8 − 251 | A > T | rs4073 | A-allele: higher IL-8 plasma levels | 45% | The dominant allele AT and AA is associated with a poor prognosis and may increase CXCL 6, which stimulates endothelial production | [21,22,23,24,25] |
2 | VEGF + 936 | C > T | rs3025039 | T-allele: lower VEGF plasma levels | 20% | De novo vascularization, endothelial proliferation Increased risk of NASH C-allele associated with higher VEGF production | [21,26,27,28] |
3 | EGFR-497 | G > A | rs2227983 | A-allele: lower EGFR ligand binding, growth stimulation | 29% | Identified in gastrointestinal and colorectal tumors | [29,30] |
4 | EGFA 61G | A > G | rs4444903 | A-allele: lower EGF serum levels | 45% | Increased susceptibility to hepatitis C | [30,31,32] |
5 | p53 | C > G | rs1042522 | Tumor suppressor, induces cell cycle arrest | 35% | Associates with LiFraumeni syndrome, is detected as inducer of different types of cancer | [33] |
6 | CXCR | G > C | rs2234671 | C-allele: higher ligand binding | 10% | Interleukin-8 acts through CXCR receptor | [34] |
7 | IL-1b | C > T | rs1143634 | Increased tumor growth and proliferation | 20% | Stomach cell cancer, gall bladder cancer, breast cancer, and liver cell cancer | [35] |
8 | HIF1 A588T | C > T | rs11549465 | T-allele with cancer associated | 8% | Associated with tumor size and location in colorectal carcinoma, tumor tissue is over-stimulated with HIF1 | [36,37] |
9 | IL-10 | T > G | rs1800872 | Higher Il-10, more immunosuppressive effect | 30–40% | Increases risk of liver cell cancer, negatively modulates NFKappaB and TNF alpha production (inhibits gene expression) | [38] |
10 | IL-6 | G > C | rs1800795 | Proinflammatory cytokine, response to cancer | 20% | Increased risk of cervical and renal cancer Stimulates endothelial production | [39,40] |
Variable | Cutoff | Total No. Patients (%) | Event in Group (%) | Median DFS (Months) (95% CI) | Relative Risk (95% CI) | p Value 1 |
---|---|---|---|---|---|---|
Sex | Female | 37 (29.1%) | 19 (51.4%) | 38 (17.1–58.9) | 0.763 (0.443–1.314) | 0.329 |
Male | 90 (70.9%) | 43 (47.8%) | 26 (16.1–35.3) | 1 (reference) | ||
Age (years) | <65 | 48 (37.8%) | 26 (44.2%) | 26 (12.7–39.3) | 1.222 (0.736–2.032) | 0.438 |
>65 | 79 (62.2%) | 36 (45.6%) | 32 (17.0–47.0) | 1 (reference) | ||
BMI | <25 | 51 (40.2%) | 22 (43.1%) | 35 (15.4–54.6) | 0.790 (0.469–1.330) | 0.375 |
>25 | 76 (59.8%) | 40 (52.6%) | 26 (05.3–15.7) | 1 (reference) | ||
Diameter (mm) | <50 | 49 (38.6%) | 24 (49.0%) | 39 (26.9–51.1) | 0.695 (0.415–1.165) | 0.168 |
>50 | 78 (61.4%) | 38 (48.7%) | 21 (12.5–29.5) | 1 (reference) | ||
T-category | T1/2 | 95 (74.8%) | 51 (53.7%) | 39 (12.1–65.9) | 0.407 (0.244–0.679) | <0.0001 |
T3/4 | 32 (25.2%) | 12 (37.5%) | 12 (05.1–18.9) | 1 (reference) | ||
N-category | 0 | 29 (22.8%) | 13 (55.2%) | 26 (05.4–47.0) | 0.976 (0.543- 1.756) | 0.936 |
N | 98 (74.7%) | 41 (44.8%) | 30 (12.9–47.1) | 1 (reference) | ||
HCC tumor nodes | =1 | 51 (39.3%) | 35 (68.6%) | 12 (07.6–16.4) | 0.543 (0.342–0.862) | 0.0001 |
>1 | 76 (59.8%) | 27 (35.5%) | 67 (43.3–90.7) | 1 (reference) | ||
Steatosis | No | 79 (61.9%) | 39 (49.3%) | 30 (18.2–41.8) | 1.093 (0.652–1.833) | 0.736 |
Yes | 48 (38.1%) | 23 (47.9%) | 25 (0.00–61.7) | 1 (reference) | ||
Cirrhosis | No | 63 (49.6%) | 26 (41.3%) | 58 (14.5–101.5) | 0.519 (0.308–0.874) | 0.012 |
Yes | 64 (50.4%) | 36 (48.8%) | 24 (15.7–32.3) | 1 (reference) | ||
AFP (µL/L) | <100 | 50 (39.4%) | 27 (54.0%) | 32 (22.4–41.6) | 0.732 (0.455–1.180) | 0.200 |
>100 | 77 (60.6%) | 35 (55.5%) | 24 (09.5–38.5) | 1 (reference) | ||
BCLC Stage | 0/A | 77 (57.5%) | 33 (42.8%) | 65 (33.6–96.4) | 0.291 (0.171–0.496) | <0.0001 |
B/C | 50 (39.4%) | 33 (66.0%) | 11 (06.7–15.2) | 1 (reference) |
Variable | Cutoff | Total No. Patients (%) | Event in Group (%) | Median OS (Months) (95% CI) | Relative Risk (95% CI) | p Value 2 |
---|---|---|---|---|---|---|
Sex | Female | 37 (29.1%) | 15 (40.5%) | 78 (56.0–89.3) | 0.410 (0.231–0.723) | 0.002 |
Male | 90 (70.9%) | 59 (65.6%) | 24 (16.0–32.0) | 1 (reference) | ||
Age (years) | <65 | 48 (37.8%) | 27 (46.2%) | 38 (00.0–77.8) | 0.840 (0.523–1.351) | 0.473 |
>65 | 79 (62.2%) | 47 (59.5%) | 32 (18.7–45.3) | 1 (reference) | ||
BMI | <25 | 51 (40.2%) | 28 (54.9%) | 31 (12.3–49.7) | 0.9 (0.562–1.441) | 0.660 |
>25 | 76 (59.8%) | 46 (60.5%) | 35 (22.2–47.8) | 1 (reference) | ||
Diameter (mm) | <50 | 49 (38.6%) | 25 (51.0%) | 58 (36.2–79.8) | 0.601 (0.370–0.976) | 0.035 |
>50 | 78 (61.4%) | 49 (62.8%) | 23 (15.6–30.4) | 1 (reference) | ||
T-category | T1/2 | 95 (74.8%) | 47 (51.6%) | 47 (26.8–67.2) | 0.261 (0.060–1.131) | 0.002 |
T3/4 | 32 (25.2%) | 24 (55.0%) | 15 (06.4–23.6) | 1 (reference) | ||
N-category | 0 | 29 (22.8%) | 14 (48.3%) | 65 (26.5–103.5) | 0.591 (0.324–1.077) | 0.082 |
N | 98 (74.7%) | 46 (59.0%) | 32 (18.0–46.0) | 1 (reference) | ||
HCC tumor nodes | =1 | 51 (39.3%) | 38 (50.0%) | 42 (22.9–61.1) | 0.543 (0.342–0.862) | 0.010 |
>1 | 76 (59.8%) | 35 (70.0%) | 20 (12.0–28.0) | 1 (reference) | ||
Steatosis | No | 79 (61.9%) | 51 (65.4%) | 30 (18.2–29.2) | 1.590 (0.963–2.623) | 0.070 |
Yes | 48 (38.1%) | 22 (45.8%) | 58 (29.2–86.8) | 1 (reference) | ||
Cirrhosis | No | 63 (49.6%) | 30 (47.6%) | 55 (25.9–84.1) | 0.515 (0.322–0.825) | 0.005 |
Yes | 64 (50.4%) | 44 (68.7%) | 24 (11.9–36.1) | 1 (reference) | ||
AFP (µL/L) | <100 | 50 (39.4%) | 27 (54.0%) | 42 (18.8–65.2) | 1.025 (0.618–1.699) | 0.924 |
>100 | 77 (60.6%) | 47 (61.0%) | 29 (04.2–20.8) | 1 (reference) | ||
BCLC Stage | 0/A | 77 (57.5%) | 33 (42.8%) | 47 (27.7–66.2) | 0.493 (0.309–0.789) | 0.003 |
B/C | 50 (39.4%) | 33 (66.0%) | 17 (09.1–24.9) | 1 (reference) |
SNP | n | DFS | OS | |||||
---|---|---|---|---|---|---|---|---|
Median DFS (Months) (95% CI) | RR (95% CI) | p Value | Median OS (Months) (95% CI) | RR (95% CI) | p Value | |||
IL-8 | 0.047 | 0.366 | ||||||
AA | 14 | 20 (8.7–40.1) | 2.040 (1.000–4.179) | 22 (8.7–35.3) | 0.710 (0.337–1.479) | |||
AT 1 | 65 | 32 (18.3–45.8) | 1 (reference) | 32 (10.5–53.5) | 1 (reference) | |||
TT 1 | 46 | |||||||
VEGF | 0.045 | 0.350 | ||||||
CT 1 | 41 | 20 (12.0–30.0) | 1.668 (1.007–2.764) | 27 (18.1–36.0) | 1.038 (0.646–1.667) | |||
TT 1 | 5 | |||||||
CC | 81 | 41 (12.5–69.5) | 1 (reference) | 38 (27.0–50.0) | 1 (reference) | |||
IL-1 | 0.120 | 0.229 | ||||||
CC | 54 | 51 (39.8–61.8) | 0.583 (0.321–1.060) | 38 (20.5–55.5) | 0.657 (0.392–1.1) | |||
TT | 21 | 20 (12.1–27.8) | 1.060 (0.545–2.063) | 38 (0.0–90.0) | 0.671 (0.335–1.342) | |||
CT | 43 | 25 (17.0–33.0) | 1 (reference) | 23 (8.0–38.0) | 1 (reference) | |||
IL-6 | 0.301 | 0.415 | ||||||
GG | 54 | 25 (11.8–38.2) | 1.552 (0.873–2.759) | 32 (16.9–47.1) | 0.856 (0.522–1.404) | |||
CC | 23 | 32 (1.4–62.7) | 1.458 (0.719–2.955) | 65 (12.2–117.7) | 0.632 (0.318–1.258) | |||
GC | 50 | 38 (2.7–73.3) | 1 (reference) | 30 (14.8–45.2) | 1 (reference) | |||
IL-10 | 0.580 | 0.456 | ||||||
TT | 7 | 21 (6.4–35.6) | 1.172 (0.343–4.009) | 33 (17.3–47.8) | 0.914 (0.271–3.079) | |||
GG | 74 | 30 (16.0–44.0) | 1.356 (0.763–2.410) | 30 (21.0–39.0) | 1.359 (0.802–2.301) | |||
GT | 41 | 30 (13.0–47.0) | 1 (reference) | 41 (19.7–46.3) | 1 (reference) | |||
EGFA | 0.145 | 0.073 | ||||||
AA 1 | 63 | 24 (0.9–47.1) | 1.463 (0.877–2.441) | 29 (15.8–42.2) | 1.519 (0.959–2.406) | |||
GG 1 | 10 | |||||||
AG | 50 | 30 (13.2–46.8) | 1 (reference) | 38 (18.7–57.3) | 1 (reference) | |||
EGFR | 0.393 | 0.523 | ||||||
GG | 50 | 18 (7.8–28.2) | 1.272 (0.721–2.243) | 23 (14.0–32.0) | 1.177 (0.703–1.972) | |||
AA | 27 | 38 (0.0–76.3) | 0.807 (0.385–1.690) | 38 (0–81.9) | 0.819 (0.420–1.597) | |||
AG | 45 | 33 (23.1–42.9) | 1 (reference) | 47 (22.4–71.6) | 1 (reference) | |||
CXCR | 0.693 | 0.847 | ||||||
GG | 29 | 30 (13.4–46.6) | 1.012 (0.527–1.941) | 42 (4.8–79.2) | 0.836 (0.455–1.538) | |||
CC | 11 | 21 (15.5–26.5) | 1.414 (0.632–3.162) | 30 (22.5–37.5) | 0.960 (0.436–2.115) | |||
GC | 87 | 35 (17.4–52.6) | 1 (reference) | 31 (15.8–46.2) | 1(reference) | |||
p53 | 0.897 | 0.673 | ||||||
GG | 43 | 38 (3.1–72.9) | 0.653 (0.343–2.000) | 38 (25.0–51.0) | 0.944 (0.410–2.171) | |||
CC | 36 | 24 (7.8–40.2) | 0.961 (0.528–1.800) | 30 (12.0–48.1) | 1.254 (0.687–2.3) | |||
GC | 16 | 25 (7.8–40.2) | 1 (reference) | 35 (15.4–55.0) | 1 (reference) | |||
HIF | 0.229 | 0.779 | ||||||
CC | 7 | 30 (16.7–43.4) | 0.555 (0.135–2.279) | 40 (0.0–90.4) | 1.214 (0.439–3.355) | |||
TT | 18 | 56 (36.1–75.2) | 0.518 (0.222–1.209) | 23 (6.9–39.1) | 1.223 (0.656–2.280) | |||
CT | 102 | 26 (18.7–41.3) | 1 (reference) | 35 (24.1–45.9) | 1 (reference) |
SNP | Multivariable Analysis | |||
n | Adjusted RR | Adjusted p Value | Median DFS (Months) (95% CI) | |
IL-8 AA = unfavorable | 14 | 2.817 (1.278–6.168) | 0.010 | 33 (19.6–44.4) |
IL-8 AT/TT = favorable | 111 | 1 (reference) | 20 (0.0–40.1) | |
VEGF TT/CT = unfavorable | 46 | 1.351 (0.736–2.480) | 0.332 | 20 (12.0–28.0) |
VEGF CC = favorable | 79 | 1 (reference) | 39 (10.2–67.8) | |
SNP | Combined Analysis | |||
n | Adjusted RR | Adjusted p Value | Median DFS (Months) (95% CI) | |
0 unfavorable | 70 | 1 (reference) | 0.034 | 58 (32.4–83.6) |
1 unfavorable | 54 | 1.853 (1.045–3.284) | 20 (13.8–26.2) | |
2 unfavorable | 3 | 4.910 (1.047–23.031) | 7 (0.0–10.0) |
No. | Gene | Allele | Primer Forward | Primer Reverse | Annealing Temp. | Enzyme |
---|---|---|---|---|---|---|
1 | IL-8 251 | A > T | TTG TTC TAA CAC CTG CCA CTC T | GGC AAA CCT GAG TCA TCA CA | 60 °C | Mfe I |
2 | VEGF +936 | C > T | AGA CTC CGG CGG AAG CAT | TGT ATG TGG GTG GGT GTG TC | 60 °C | Nla III |
3 | EGFR -497 | G > A | TGC TGT GAC CCA CTC TGT CT | CCA GAA GGT TGC ACT TGT CC | 60 °C | Bstni |
4 | EGFA 61G | A > G | CAT TTG CAA ACA GAG GCT CA | TGT GAC AGA GCA AGG CAA AG | 60 °C | Alu Ia |
5 | p53 | C > G | ATC TAC AGT CCC CCT TGC CG | GCA ACT GAC CGT GCA AGT CA | 60 °C | Bstni |
6 | CXCR1 | G > C | CTC ATG AGG ACC CAG GTG AT | GGT TGA GGC AGC TAT GGA GA | 60 °C | Alu I |
7 | IL-1b | C > T | GTT GTC ATC CAG ACT TTG ACC | TTC AGT TCA TAT GGA CCA GA | 60 °C | Taq1 |
8 | HIF1 A588T | C > T | CCC AAT GGA TGA TGA CTT CC | AGT GGT GGC ATT AGC AGT AGG | 60 °C | Tsp-45 I |
9 | IL-10 | T > G | GAGCACTACCTGACTAGCATATAAG | GTGGGCTAAATATCCTCAAAGT | 60 °C | RSAI |
10 | IL-6 | G > C | GCC TCA ATG ACG AC | TCA TGG GAA AAT CC | 60 °C | NiaIII |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miller, H.; Czigany, Z.; Lurje, I.; Reichelt, S.; Bednarsch, J.; Strnad, P.; Trautwein, C.; Roderburg, C.; Tacke, F.; Gaisa, N.T.; et al. Impact of Angiogenesis- and Hypoxia-Associated Polymorphisms on Tumor Recurrence in Patients with Hepatocellular Carcinoma Undergoing Surgical Resection. Cancers 2020, 12, 3826. https://doi.org/10.3390/cancers12123826
Miller H, Czigany Z, Lurje I, Reichelt S, Bednarsch J, Strnad P, Trautwein C, Roderburg C, Tacke F, Gaisa NT, et al. Impact of Angiogenesis- and Hypoxia-Associated Polymorphisms on Tumor Recurrence in Patients with Hepatocellular Carcinoma Undergoing Surgical Resection. Cancers. 2020; 12(12):3826. https://doi.org/10.3390/cancers12123826
Chicago/Turabian StyleMiller, Hannah, Zoltan Czigany, Isabella Lurje, Sophie Reichelt, Jan Bednarsch, Pavel Strnad, Christian Trautwein, Christoph Roderburg, Frank Tacke, Nadine Therese Gaisa, and et al. 2020. "Impact of Angiogenesis- and Hypoxia-Associated Polymorphisms on Tumor Recurrence in Patients with Hepatocellular Carcinoma Undergoing Surgical Resection" Cancers 12, no. 12: 3826. https://doi.org/10.3390/cancers12123826
APA StyleMiller, H., Czigany, Z., Lurje, I., Reichelt, S., Bednarsch, J., Strnad, P., Trautwein, C., Roderburg, C., Tacke, F., Gaisa, N. T., Knüchel-Clarke, R., Neumann, U. P., & Lurje, G. (2020). Impact of Angiogenesis- and Hypoxia-Associated Polymorphisms on Tumor Recurrence in Patients with Hepatocellular Carcinoma Undergoing Surgical Resection. Cancers, 12(12), 3826. https://doi.org/10.3390/cancers12123826