Next Article in Journal
Insect Antimicrobial Peptides, a Mini Review
Next Article in Special Issue
Transfer of Deoxynivalenol (DON) through Placenta, Colostrum and Milk from Sows to Their Offspring during Late Gestation and Lactation
Previous Article in Journal
Bacterial Superantigen Toxins, CD28, and Drug Development
Previous Article in Special Issue
Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Trichothecene Genotypes of Fusarium graminearum Populations Isolated from Winter Wheat Crops in Serbia

1
Institute for Animal Husbandry, Autoput 16, 11080 Belgrade-Zemun, Serbia
2
Maize Research Institute “Zemun Polje”, Slobodana Bajića 1, 11185 Belgrade, Serbia
3
Institute of Food Technology and Biochemistry, Faculty of Agriculture, University of Belgrade, Nemanjina 16, 11080 Belgrade-Zemun, Serbia
4
Faculty of Biology, University of Belgrade, Studentski trg 16, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Toxins 2018, 10(11), 460; https://doi.org/10.3390/toxins10110460
Submission received: 18 October 2018 / Revised: 2 November 2018 / Accepted: 5 November 2018 / Published: 8 November 2018
(This article belongs to the Special Issue Recent Advances in Fusarium Research)

Abstract

:
Fusarium graminearum as the main causal agent of Fusarium head blight (FHB) and its ability to produce trichothecenes was investigated by molecular techniques. A total of 37 strains isolated from the wheat, harvested in Serbia in 2005, 2008 and 2015, and previously designated by morphological observation as F. graminearum, were used for trichothecene genotypes characterization. The strains were identified using the species-specific primer set FG16R/FG16F while genotypic characterization was done using specific TRI13 and TRI3 sequences of the trichothecene gene clusters. The PCR assays identified all strains as species of F. graminearum sensu stricto with the DON/15-ADON genotype. The quantification of the mycotoxin (DON) was performed using the biochemical assay. The high levels of DON (>20,000 µg kg−1) were recorded in all of the strains from 2005, four strains from 2008 and two strains from 2015. Weather data of the investigated seasons, showed that the optimal temperature, frequent rains and high relative humidity (RH) was very favourable for the development of F. graminearum, affecting the DON biosynthesis.
Key Contribution: These results could contribute to increasing awareness on potential risk of toxigenic fungi on cereal crops in Serbia. They could also be encouraged for undertaking the preventive measures and implementation of disease management strategies for FHB in Serbia and might enhance understanding of FHB diversity in Europe and worldwide.

1. Introduction

Wheat (Triticum aestivum L.) is cultivated in Serbia on approximately 600,000 ha with the average yield of 4.8 t ha−1 in 2016 according to data of Serbian Statistical Yearbook. As a staple food, it is primarily used in the production of flour, semolina, bread, baked food, cakes, pasta etc. In addition, it can be used as concentrated feed in animal husbandry. This crop is a rich source of carbohydrate, proteins, polyunsaturated fats, α-tocopherol (vitamin E), vitamins of group B, dietary fiber, minerals, phytochemicals and antioxidants in the human diet.
Fusarium head blight (FHB) or head scab is the main disease of wheat (Triticum aestivum L.) worldwide [1]. This disease is caused by the complex of species of the genus Fusarium, wherein the incidence of certain species depends on a geographic region. Fusarium graminearum Schwabe (Gibberella zeae (Schwein.) Petch) and Fusarium culmorum (Wm. G. Smith) Sacc. are primary causal organisms of FHB in Europe. F. graminearum and F. culmorum are the predominant Fusarium spp. in Europe with the former commonly isolated in southern (warmer) and the latter in northern (colder) European domain [2,3]. The occurrence of FHB by F. graminearum in Serbia is a consequence of favourable agro-ecological conditions and moderate-continental climate [4].
In addition to extensive yield and quality losses of wheat, a great concern is the potential of F. graminearum to produce mycotoxins, in particular type B trichothecenes such as deoxynivalenol (DON) and nivalenol (NIV) along with their acetylated derivatives [5]. More acetylated derivatives of DON, 3-acetyldeoxynivalenol (3-ADON) and 15-acetyldeoxynivalenol (15-ADON) than the acetylated derivatives of NIV, 4-acetylnivalenol (4-ANIV or fusarenon X) were detected in the grains infected with F. graminearum. The incidence of these genotypes/chemotypes varies by geographic region. Thus, the occurrence of both genotypes (DON and NIV) is recorded in certain countries of Africa, Asia and Europe, while DON genotype occurs only in North America [6]. The Both genotypes of these mycotoxins have been identified within some strains of F. graminearum. A correlation between a geographical origin and occurrence of particular genotypes was established in F. graminearum strains that produced 3-ADON or 15-ADON. Accordingly, strains from China commonly produce 3-ADON, while strains derived from Mexico, North America and Europe mainly produce 15-ADON [7].
Trichothecenes may cause health disorders in humans and animals, especially when ingested in high amounts. Exposure to trichothecenes can cause feed refusal, intestinal disorders, vomiting, skin dermatitis, hemorrhagic lesions and immunological problems [8]. In addition, contamination of wheat grains with DON and NIV pose negative effects on the economy in food and livestock production [9].
Parry et al. [2] and Hooker et al. [10] reported that weather conditions in the period from pollination to maturation had strong impacts on grain infection with FHB and production of trichothecene during harvest. Therefore, it is of great importance to develop forecasting disease models based on the monitoring of weather conditions in order to disseminate information to farmers about the preventive measures against FHB disease and potential infection of grains with mycotoxins [11]. The risk assessment of the effects of disease is best expressed over the parameters for yield and grain quality. The levels of mycotoxins in the grains as well the isolation and molecular identification of Fusarium species as the main causative agents are also useful parameters of the severity of FHB infection [12]. One of the methods of developing the FHB monitoring model based on weather forecast is through a risk assessment over a period of several years. The probability of occurrence of harmful fungi and their potential to produce mycotoxins, can be estimated based on a given locations and weather conditions, which may contribute to both, the risk assessment of wheat contamination and the impact on food safety.
Although the mechanisms of tolerance to FHB and DON accumulation in wheat grain are complex and not sufficiently illuminated [13], FHB control encompasses the use of tolerant wheat varieties [14] as well as the application of chemical (triazole-based fungicides) [15] and biological protection measures [16].
ELISA and LC/MS are the conventional analytical methods used for determination of trichothecene concentrations of F. graminearum strains, while advanced PCR methods are used for amplification of trichothecene biosynthesis genes of F. graminearum strains that produce particular genotypes [17,18,19]. The biosynthesis of Fusarium trichothecenes is controlled by the 12-gene core TRI cluster. TRI13 and TRI7 are the two most important genes for determination of the production of the DON or NIV genotype. The conversion of DON to NIV in Fusarium is controlled by the TRI13 gene, while the TRI7 gene is responsible for acetylation of NIV to produce 4-ANIV [20]. PCR methods are used to determine the differences among the functionality and non-functionality of TRI13. Therefore, the TRI13 gene is one of the most commonly used genetic markers for the identification of 3-ADON, 15-ADON and NIV genotypes in PCR assays [21].
Regular analyses of genetic and toxigenic properties of main causal agents of FHB are important for the estimation of potential risks of occurrence of mycotoxins in wheat grains in a certain geographical region. Therefore, the aim of these studies was to apply the PCR assays in order to determine genetic diversity and trichothecene genotyping of F. graminearum (37 strains) isolated from the winter wheat grains, harvested in the vicinity of Belgrade, Serbia, during the three different growing seasons (2005, 2008, and 2015). In addition, the ability of 18 randomly picked strains to produce DON was also investigated, as well as the influence of climatic factors (temperature, rainfall and relative humidity) on genetic and toxigenic potential of F. graminearum populations.

2. Results

2.1. Climatic Conditions

According to the data supplied by the Republic Hydro-Meteorological Service of Serbia, higher temperatures and rainfalls were recorded in Belgrade area during the May, coinciding with the period of wheat anthesis where Fusarium species may cause infections of the spikes. The mean monthly temperatures and monthly rainfalls were 17.7, 19.3, and 19.1 °C and 47.4, 60.6, and 80.7 mm, for 2005, 2008, and 2015 respectively.
However, during the period of wheat anthesis in June, and maturation and ripening stage in July, rainfalls were significantly higher in 2005 than in 2008 and 2015. The monthly rainfalls for June and July were 95.1 and 144.3 mm, 43.3 and 53.0 mm and 38.6 and 10.6 mm, respectively, whereas the mean monthly temperatures were generally >20 °C and relative humidity (RH) >60% (Figure 1). Moreover, observing the wider environmental data from the start of the growing season from October to July, the total season rainfall and seasonal RH mean values were also higher in the growing seasons of 2004–2005 than in 2007–2008 and 2014–2015. The total season rainfall and mean RH were 724.5, 594, and 530.8 mm and 71.7%, 67.8%, and 67.7%, respectively.

2.2. Morphological and Molecular Identification of Species

Based on the appearance of colony and macroconidia, the fungal strains isolated from wheat grains have been identified as Fusarium graminearum. Among them, 37 strains were picked from fungal collection of the Institute for Animal Husbandry, Belgrade for molecular identification with PCR method. All of the tested strains yielding the product of amplification of 420 bp, confirming that they belong to the species of F. graminearum sensu stricto (s.s.) (lineage 7) (Figure 2).

2.3. Identification of F. graminearum Genotypes

The possibilities of F. graminearum strains to have DON and NIV genotypes were performed by another PCR assay with the primer pair TRI13F/TRI13R. The tested primer sets enabled identification of DON producers in all of the tested F. graminearum strains, with the fragment of amplification of 234 bp (Figure 3).
Results of the multiplex PCR assays with primers specific for identifying acetylated derivatives revealed the presence of only 15-ADON (Table 1), giving the PCR product of amplification of 610 bp (Figure 4).

2.4. Deoxynivalenol Production

The ability of tested strains to produce DON was evaluated in 18 randomly picked strains (six strains per year), under in vitro conditions, and results showed that selected strains were DON positive, with highest toxigenic potential of >25,000 µg kg−1 recorded in the three strains of 2005, followed by two strains isolated in 2008 and one strain isolated in 2015. The production of DON was not detected in the control sample, where the DON level was below the detection limit of 40 µg kg−1 (Table 2).

3. Discussion

In this study, the presence and frequency of trichothecene genotypes and their acetylated derivatives among F. graminearum populations were established by different PCR analyses. In addition, the results on the toxigenic potential of 18 randomly picked F. graminearum strains to produce DON have been presented.
The first experimental identification of the strains was previously carried out using microscopic and morphological investigation (colony and conidial morphology). Based on these observations, they have already been designated as F. graminearum. In order to perform reliable identification on the molecular level, the primer set FG16F/FG16R was used in the current work and the product of amplification of 420 bp was obtained, confirming that all the strains belong to F. graminearum sensu stricto (F. graminearum s.s.). Within the Fusarium spp., F. graminearum has already been isolated and morphologically identified, under agro-ecological conditions of Serbia, as the major species associated with FHB in winter wheat varieties [4,22]. Additionally, other Fusarium species that are less pathogenic or opportunistic, such as F. oxysporum, F. poae, F. proliferatum, F. semitectum, F. sporotrichioides, F. subglutinans, and F. verticillioides have been determined, but with a lower incidence [23].
This study demonstrated that all the strains were DON genotype producers (234 bp), testing with the primer set developed for the TRI13 gene, whereas with another primer sets for the TRI3 gene, the 15-ADON genotype was clarified. In previous molecular studies of the presence of trichothecene genotypes in F. graminearum strains isolated from the wheat, maize and barley in Serbia, Obradović et al. [24] have also reported the occurrence of DON and its 15-ADON derivative. This survey represents the second report of the trichothecene genotyping of F. graminearum in Serbia, but included three different varieties of wheat and strains isolated during three different growing seasons, covering a relatively long distance period (2005, 2008 and 2015). Compering these results, based on the detected genotypes, there was no supposed genotype diversity between maize, barley and wheat, indicating that genotype diversity within F. graminearum is not mainly associated with the host. This was in line with the observation of Boutigny et al. [25] for the genotype diversity among the maize and wheat as host cultures in France.
The current study confirmed that FHB in Serbia was associated only with the 15-ADON genotype, while 3-ADON and NIV were not recorded. NIV producer has not been found in the current study, but has been found in one strain of F. graminearum isolated from the wheat crops in Romania and Turkey [26,27]. Additionally, Szécsi et al. [28] have reported that F. graminearum strains originating from Hungarian cereal and maize-growing regions mainly belong to the DON genotype, but that the majority of them had both 3-ADON and 15-ADON and only at one detected DON/NIV genotype. Interestingly, these authors have presumed that the variability between genotypes was independent of geographical and environmental conditions in Hungary, and supposed that these were caused by specific regional contamination of the wheat grain. The high proportion of DON genotypes within the F. graminearum s.s. has also been reported in the survey of Bilska et al. [29] who found 15-ADON genotypes in more than 80% of wheat samples from Poland. In the region of northern Italy, all three fungal genotypes among F. graminearum strains were isolated from durum wheat, with the 15-ADON as the most frequent (87.2%), followed by the 3-ADON (8.1%) and the NIV genotype (2.7%) [30]. Similar results were obtained by Covarelli et al. [8] in central Italy, and Talas et al. in Germany [31]. Likewise, in certain years, in the Netherlands, UK, Belgium, and Poland the increased proportion of NIV producers (>15%) were identified in the wheat [25]. A high occurrence of NIV should be of concern, as NIV is potentially more toxic to humans and animals compared to DON. Interestingly, unlike the DON producers, NIV have occurred regardless of climatic conditions, pointing that it could often be an under-estimated risk to be further analyzed [8].
In addition to European countries, the dominance of the DON/15-ADON genotype of F. graminearum s.s. isolated from the wheat crops has also been confirmed in southern Brazil [32], Argentina [33], South Africa [34], China [20,35], and in Taiwan [19]. In some countries, there are certain differences in the regional occurrence and distribution of DON genotypes. The predominance of 15-ADON producers of F. graminearum s.s. have been reported in Midwestern USA [36] unlike southern Louisiana where a high level of NIV genotypes has been found [37]. Regional differences between DON genotypes have also been observed in Japan, Russia and Iran, and the 15-ADON genotype of F. graminearum populations was dominant in the northern part of Japan, southern part of Russia and north-west of Iran [38]. Additionally, in western Canada, 3-ADON F. graminearum producers were replaced by 15-ADON producers [39]. Interestingly, Beyer et al. [40] supposed that changing from NIV-producing F. culmorum strains to 15-ADON-producing F. graminearum in Luxembourg were associated with better competitiveness of the latter strain to humid climate conditions.
The main reason for the differences in the distribution of DON and NIV genotypes in F. graminearum population is generally unknown but it could be possible that these might be a consequence of variations in climatic conditions, soil type, host genotype, applied cropping practices, such as soil tillage, fertilization, irrigation, fungicides, crop rotation and also condition during grain storage.
Quantitative analysis revealed a high toxigenic potential of identified strains to produce DON, with an amount that exceeded the 20,000 µg kg−1, in all six, four and two F. graminearum strains originated from 2005, 2008, and 2015, respectively. In previous research of Stanković et al. [41] significant levels of DON were also quantified in F. graminearum strains, isolated and morphologically identified, from the wheat grains collected from various regions in Serbia. Their results indicate that these high levels ranging from 160 to 45,260 µg kg−1 were regionally dependent. Under similar study conditions, conducted by Obradović et al. [24], the high DON levels from 23,800 to 88,700 µg kg−1, have also been recorded in wheat, confirming this assumption. Likewise, significant levels of DON were documented in Italian durum and soft wheat, where the higher average DON contamination was found in durum wheat than in the soft wheat, whereas NIV was evenly detected at significant concentrations in both wheat species [8]. Interestingly, different degrees of mycotoxins reduction could be accomplished during processing of food including sorting, cleaning, milling, baking etc. [42]. For example, DON is particularly concentrated in the bran coat which is eliminated in the production of flour and semolina, contributing to its lower value in the final food products [43].
In this survey, the climatic factors (temperature, rainfall and RH) did not affect diversity of trichothecene genotypes of F. graminearum, since the DON/15-ADON was the only genotype isolated. The temperatures during anthesis stage, in May (>17 °C), and June (>20 °C), contributed to development of F. graminearum populations in the grains of infected wheat, whereas high seasonal total rainfalls and seasonal mean RH were favorable for the production of DON and its 15-ADON derivatives. This is consistent with the results of Prodi et al. [44], who also documented the dominance of 15-ADON genotypes of F. graminearum in humid areas of northern Italy. However, Boutigny et al. [25] have found regional differences in the distribution of 15-ADON and NIV genotypes, with higher incidence of NIV-F. graminearum strains in the warmest area (South France). Likewise, Zhang et al. [35] recorded the increase presence of 15-ADON-F. graminearum genotypes in the colder wheat growing areas of China with the annual average temperatures of 15 °C or lower. In addition to the dominance of the DON/15-ADON genotype, high total rainfalls during anthesis and maturation, in June (95.1 mm) and July (144.3 mm) recorded in 2005, provoked the strains of F. graminearum isolated in that year to produce a higher level of DON than those of 2008 and 2015, which correlated well with the findings of Audenaert et al. [45] in Belgium. These authors found a positive correlation between the accumulation of DON in winter wheat and high amounts of rainfall (210 mm) in June of 2007, during and after the stage of anthesis. Similarly, in Argentina, Alvarez et al. [46] found different values of toxigenic potential for the production of DON, depending on the year of investigation, whereas Covarelli et al. [8] confirmed that climatic factors mainly affected the composition of fungal toxigenic species, and the level of mycotoxin contaminations in soft and durum wheat grains in central Italy.

4. Conclusions

The 37 strains isolated from three wheat varieties, and previously designated as Fusarium graminearum, were confirmed to belong to the species F. graminearum sensu stricto (F. graminearum s.s.), using precise molecular assay. Multiplex PCR assay revealed the presence of only DON/15-ADON genotypes in all of the tested strains, with the product of amplification of 610 bp. The concentrations of DON were quantified by ELISA method, were high level (>20,000 µg kg−1), and was recorded in 12 of 18 randomly picked strains. Considering the optimal temperature for the development of F. graminearum during the wheat anthesis (<17 °C), as well as another stimulated condition (frequent rain and high relative humidity), had a crucial impact on the dominance of the DON/15-ADON genotype as expected. Likewise, abundant rainfall in the tested location (Belgrade area) in June and July, especially in 2005, during and after anthesis, resulted in a high potential of all the F. graminearum strains, isolated from that year, to produce DON.
The results from this survey indicate that the combined approach might contribute to rapid and precise identification of F. graminearum and the presence of trichothecene genotypes, as well as DON producers in wheat crops. Thus, an integrated disease management strategy is necessary in order to minimize economic losses and mycotoxin contamination with negative impact on human and animal health. The knowledge about F. graminearum population and genotype diversity and distribution could be of great importance for development of forecasting disease strategies on a regional level. This would be useful tool in early detection of trends and potential hazard of trichothecene Fusarium species. Further investigation should focus on more strains from other regions of Serbia in order to obtain more comprehensive insight on the F. graminearum populations at a national level.

5. Materials and Methods

5.1. Fungal Strains

The samples of the local varieties of winter wheat (Pobeda, Simonida, NS40S) were taken from the production plots of the Institute for Animal Husbandry, Belgrade-Zemun, during the harvest in 2005, 2008 and 2015. According to the morphological (macroscopic and microscopic) observation, the strains were identified as F. graminearum and kept in the fungal collection. The 37 single-spore F. graminearum were used in this investigation to confirm their identification on molecular level by advanced PCR methods.
The data information about the origin of the strains and year of isolation are shown in Table 1.
All of the isolated single-spore F. graminearum strains (37) were taken for these investigations, and cultivated on potato dextrose agar (PDA, Biolife, Milano, Italy), in order to analyze their potential to produce trichothecene genotypes.

5.2. DNA Extraction

F. graminearum strains were grown on PDA (potato dextrose agar, Biolife, Milano, Italy) and incubated at 25 °C for 7 days (Memmert incubator, Schwabach, Germany). DNA was extracted from the fungal mycelium according to the manufacturer’s instructions (DNeasy Plant Mini Kit, Qiagen, Hilden, Germany). The extracted DNAs were stored at −20 °C, prior to the analysis.

5.3. Polymerase Chain Reaction

A total of 37 strains were identified using the primer pair FG16F/FG16R, which produced polymorphic products only with DNA of F. graminearum, but did not amplify with DNA of closely related Fusarium species or fungi of other genera [47]. In order to analyze the potential of tested strains to produce trichothecene genotypes, this was based on the production of DON and NIV using the primer pair TRI13F/TRI13R for the TRI13 gene [48]. The multiplex PCR reaction was performed with the primer sets 3CON, 3NA, 3D15A, and 3D3A for the TRI3 gene [49] for identifying acetylated derivatives (Table 3).
The amplification reactions were conducted using 1.1 µL of fungal DNA (10–20 ng) in a total volume of 20 µL containing, 2 µL of 10 × buffer PCR (100 mM tris-HCL, 15 mM MgCl2, 500 mM KCl, pH 8), 1.2 µL of MgCl2 (25 mM), 0.4 µL of dNTPs (10 mM), 0.1 µL of Taq DNA polymerase (5 U/µL) and 1 µL of each primer (20 mM). All the PCR reactions were performed in a thermocycler (Quantarus, UK). The conditions for the amplification of the FG16 gene was as follows: Denaturation step at 94 °C for 30 s, 30 cycles of 95 °C (30 s)/57 °C (30 s)/2 °C (60 s), and a final extension at 72 °C for 5 min. For the amplifications of the TRI13 gene and for the multiplex PCR reaction of TRI3 genes, the amplification conditions were as follows: Denaturation step at 95 °C for 5 min, 40 cycles of 95 °C (30 s)/57 °C (30 s)/72 °C (1 min), and a final extension at 72 °C for 10 min.
The expected fragments of 400–500 bp for FG16, 234 or 415 bp for TRI13 and 840, 610 and 243 bp for TRI3 were separated on 1.5% agarose gel in 1 × TBE (Tris-borate-EDTA) buffer, and visualized under UV light on a transilluminator (UV-transilluminator, MD-20, 312 nm, Wealtec Corp., Sparks, NV, USA). DNA was stained with Midori Green (Nippon Genetics Europe, Dueren, Germany). The 100 bp DNA ladder (Nippon Genetics Europe, Dueren, Germany) was used as a molecular marker.

5.4. Deoxynivalenol Production

The 18 randomly picked strains were cultivated on the PDA plates for seven days, at room temperature and 50 g of wheat grains were used for inoculum. The grains were kept (immersed) in the distilled water (22.5 mL) in the 250-mL flasks for 24 h, until they reached 45% moisture content. Thereafter, the wheat grains were autoclaved at 121 °C for 30 min. Small fragments of agar inoculated with F. graminearum mycelium were added to the autoclaved wheat grains (50 g), whereas the agar fragment without mycelium was used as a negative control. After inoculation the samples were incubated at 25 °C for 3 weeks, and the obtained cultures were firstly dried for 72 h at 50 °C and thereafter ground to the fine powder used for mycotoxin analyses.
The DON content (sum of the 3-ADON, DON, 3-glucosil-DON and 15-ADON) was determined with Celer Tecna® DON ELISA kit (Tecna S.r.l., Trieste, Italy) according to the manufacturer’s instructions. The DON dosage range was 40–5000 μg kg−1, with the detection limit for wheat of 40 μg kg−1. In the samples with >5000 μg kg−1, the extract was diluted 5 times (1:4) in 70% methanol, in order to obtain a dosage range of 20–25,000 μg kg−1.

Author Contributions

Conceptualization, V.K., S.S. and A.O.; Funding acquisition, S.S. and V.K.; Investigation, V.K, S.S., A.O., T.P., V.M., Z.B., M.B.; Supervision, S.S.; Writing—original draft, V.K. and T.P.

Funding

This research was funded by Ministry of Education, Science and Technological Development of the Republic of Serbia, projects TR-31023, TR-31053 and TR-46010.

Acknowledgments

We thank the reviewers for improving the quality of this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Goswami, R.S.; Kistler, H.C. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef] [PubMed]
  2. Parry, D.W.; Jenkinson, P.; McLeod, L. Fusarium ear blight (scab) in small grain cereals—A review. Plant Pathol. 1995, 44, 207–238. [Google Scholar] [CrossRef]
  3. Lemmens, M.; Haim, K.; Lew, H.; Ruckenbauer, P. The effect of nitrogen fertilization on Fusarium head blight development and deoxynivalenol contamination in wheat. J. Phytopathol. 2004, 152, 1–8. [Google Scholar] [CrossRef]
  4. Stanković, S.Ž.; Lević, J.T.; Krnjaja, V.S.; Bočarov-Stančić, A.S.; Tančić, S.L.; Kovačević, T.M. Frequency of toxigenic Fusarium species and fusariotoxins in wheat grain in Serbia. Matica Srp. Proc. Nat. Sci. 2007, 113, 93–102. [Google Scholar] [CrossRef]
  5. Bottalico, A.; Perrone, G. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grains cereals in Europe. Eur. J. Plant Pathol. 2002, 108, 611–624. [Google Scholar] [CrossRef]
  6. Lee, T.; Han, Y.K.; Kim, K.H.; Yun, S.H.; Lee, Y.W. Tri13 and Tri7 determine deoxynivalenol- and nivalenol-producing chemotypes of Gibberella zeae. Appl. Environ. Microbiol. 2002, 68, 2148–2154. [Google Scholar] [CrossRef] [PubMed]
  7. Wegulo, S.N. Factors influencing deoxynivalenol accumulation in small grain cereals. Toxins 2012, 4, 1157–1180. [Google Scholar] [CrossRef] [PubMed]
  8. Covarelli, L.; Beccari, G.; Prodi, A.; Generotti, S.; Etruschi, F.; Juan, C.; Ferrer, E.; Mañes, J. Fusarium species, chemotype characterisation and trichothecene contamination of durum and soft wheat in an area of central Italy. J. Sci. Food Agric. 2015, 95, 540–551. [Google Scholar] [CrossRef] [PubMed]
  9. Windels, C.E. Economic and social impacts of Fusarium head blight: Changing farms and rural communities in the Northern Great Plains. Phytopathology 2000, 90, 17–21. [Google Scholar] [CrossRef] [PubMed]
  10. Hooker, D.C.; Schaafsma, A.W.; Tamburic-Ilincic, L. Using weather variables pre- and postheading to predict deoxynivalenol content in winter wheat. Plant Dis. 2002, 86, 611–619. [Google Scholar] [CrossRef]
  11. De Wolf, E.D.; Madden, L.V.; Lipps, P.E. Risk assesment models for wheat Fusarium head blight epidemics based on within-season weather data. Phytopathology 2003, 93, 428–435. [Google Scholar] [CrossRef] [PubMed]
  12. Scheider, N.; Guo, J.R.; Verreet, J.A.; Beyer, M. Assessing the intensity of Fusarium-damage in wheat: A comparison of selected disease parameters during disease development and the role of fungicides. J. Plant Dis. Protect. 2009, 116, 118–123. [Google Scholar] [CrossRef]
  13. Bai, G.; Shaner, G. Management and resistance in wheat and barley to Fusarium head blight. Annu. Rev. Phytopathol. 2004, 42, 135–161. [Google Scholar] [CrossRef] [PubMed]
  14. Miedaner, T.; Reinbrecht, C.; Lauber, U.; Schollenberger, M.; Geiger, H.H. Effects of genotype and genotype-environment interaction on deoxynivalenol accumulation and resistance to Fusarium head blight in rye, triticale, and wheat. Plant Breed. 2001, 120, 97–105. [Google Scholar] [CrossRef]
  15. Simpson, D.R.; Weston, G.E.; Turner, J.A.; Jennings, P.; Nicholson, P. Differential control of head blight pathogens of wheat by fungicides and consequences for mycotoxin contamination of grain. Eur. J. Plant Pathol. 2001, 107, 421–431. [Google Scholar] [CrossRef]
  16. Wegulo, S.N.; Baenziger, P.S.; Nopsa, J.H.; Bockus, W.W.; Hallen-Adams, H. Management of Fusarium head blight of wheat and barley. Crop Protect. 2015, 73, 100–107. [Google Scholar] [CrossRef]
  17. Righetti, L.; Galaverna, G.; Dall’Asta, C. Group detection of DON and its modified forms by an ELISA kit. Food Addit. Contam. Part A 2017, 2, 248–254. [Google Scholar] [CrossRef] [PubMed]
  18. Maragos, C.M.; Plattner, R.D. Rapid fluorescence polarization immunoassay for the mycotoxin deoxynivalenol in wheat. J. Agric. Food Chem. 2002, 50, 1827–1832. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, C.L.; Cheng, Y.H. Identification and trichothecene genotypes of Fusarium graminearum species complex from wheat in Taiwan. J. Plant Dis. Protect. 2017, 58, 4. [Google Scholar] [CrossRef] [PubMed]
  20. Ji, L.; Cao, K.; Hu, T.; Wang, S. Determination of deoxynivalenol and nivalenol chemotypes of Fusarium graminearum isolates from China by PCR assay. J. Phytopathol. 2007, 155, 505–512. [Google Scholar] [CrossRef]
  21. Przemieniecki, S.W.; Kurowski, T.P.; Korzekwa, K. Chemotypes and geographic distribution of the Fusarium graminearum species complex. Environ. Biotechnol. 2014, 10, 45–59. [Google Scholar] [CrossRef]
  22. Krnjaja, V.; Tomić, Z.; Stanković, S.; Petrović, T.; Bijelić, Z.; Mandić, V.; Obradović, A. Fusarium infection and deoxynivalenol contamination in winter wheat. Biotechnol. Anim. Husb. 2015, 31, 123–131. [Google Scholar] [CrossRef]
  23. Krnjaja, V.; Lević, J.; Stanković, S. Pathogenic fungi on wheat grain in Serbia. J. Plant Pathol. 2008, 90, 84. [Google Scholar]
  24. Obradović, A.; Stanković, S.; Krnjaja, V.; Nikolić, A.; Ignjatović-Micić, D.; Stepanović, J.; Duduk, B. Trichothecene chemotype diversity of Fusarium graminearum isolated from wheat, maize and barley in Serbia. Genetika 2017, 49, 355–364. [Google Scholar] [CrossRef]
  25. Boutigny, A.L.; Ward, T.J.; Ballos, N.; Iancu, G.; Ioos, R. Diversity of the Fusarium graminearum species complex on French cereals. Eur. J. Plant Pathol. 2014, 138, 133–148. [Google Scholar] [CrossRef]
  26. Bozac, P.; Popescu, S.; Botau, D.; Boldura, O.M.; Pirvulescu, P. Molecular characterization for some new Fusarium isolates collected from the West Part of Romania. Rom. Biotechnol. Lett. 2016, 21, 11560–11568. [Google Scholar]
  27. Yörük, E.; Albayrak, G. Chemotyping of Fusarium graminearum and F. culmorum isolates from Turkey by PCR assay. Mycopathologia 2012, 173, 53–61. [Google Scholar] [CrossRef] [PubMed]
  28. Szécsi, Á.; Bartók, T.; Varga, M.; Magya, D.; Mesterházy, Á. Determination of trichothecene chemotypes of Fusarium graminearum strains isolated in Hungary. J. Phytopathol. 2005, 153, 445–448. [Google Scholar] [CrossRef]
  29. Bilska, K.; Jurczak, S.; Kulik, T.; Ropelewska, E.; Olszewski, J.; Żelechowski, M.; Zapotoczny, P. Species composition and trichothecene genotype profiling of Fusarium field isolates recovered from wheat in Poland. Toxins 2018, 10, 325. [Google Scholar] [CrossRef] [PubMed]
  30. Prodi, A.; Tonti, S.; Nipoti, P.; Pancaldi, D.; Pisi, A. Identification of deoxynivalenol and nivalenol producing chemotypes of Fusarium graminearum isolates from durum wheat in a restricted area of Northern Italy. J. Plant Pathol. 2009, 91, 727–731. [Google Scholar]
  31. Talas, F.; Parzies, H.K.; Miedaner, T. Diversity in genetic structure and chemotype composition of Fusarium graminearum sensu stricto populations causing wheat head blight in individual fields in Germany. Eur. J. Plant Pathol. 2011, 131, 39–48. [Google Scholar] [CrossRef]
  32. Scoz, L.B.; Astolfi, P.; Reartes, D.S.; Schmale, D.G., III; Moraes, M.G.; Del Ponte, E.M. Trichothecene mycotoxin genotypes of Fusarium raminearum sensu stricto and Fusarium meridionale in wheat from southern Brazil. Plant Pathol. 2009, 58, 344–351. [Google Scholar] [CrossRef]
  33. Reynoso, M.M.; Ramirez, M.L.; Torres, A.M.; Chulze, S.N. Trichothecene genotypes and chemotypes in Fusarium graminearum strains isolated from wheat in Argentina. Int. J. Food Microbiol. 2011, 145, 444–448. [Google Scholar] [CrossRef] [PubMed]
  34. Boutigny, A.L.; Ward, T.J.; Van Coller, G.J.; Flett, B.; Lamprecht, S.C.; O’Donnell, K.; Viljoen, A. Analysis of the Fusarium graminearum species complex from wheat, barley and maize in South Africa provides evidence of species-specific differences in host preference. Fungal Genet. Biol. 2011, 48, 914–920. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, J.B.; Li, H.P.; Dang, F.J.; Qu, B.; Xu, Y.B.; Zhao, C.S.; Liao, Y.C. Determination of the trichothecene mycotoxin chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China. Mycol. Res. 2007, 111, 967–975. [Google Scholar] [CrossRef] [PubMed]
  36. Gale, L.R.; Ward, T.J.; Balmas, V.; Kistler, C. Population subdivision of Fusarium graminearum sensu stricto in the Upper Midwestern United States. Phytopathology 2007, 97, 1434–1439. [Google Scholar] [CrossRef] [PubMed]
  37. Gale, L.R.; Harrison, S.A.; Ward, T.J.; O’Donnell, K.; Milus, E.A.; Gale, S.W.; Kistler, H.C. Nivalenol-type populations of Fusarium graminearum and F. asiaticum are prevalent on wheat in southern Louisiana. Phytopathology 2011, 101, 124–134. [Google Scholar] [CrossRef] [PubMed]
  38. Van der Lee, T.; Zhang, H.; van Diepeningen, A.; Waalwijk, C. Biogeography of Fusarium graminearum species complex and chemotypes: A review. Food Addit. Contam. Part A 2015, 32, 453–460. [Google Scholar] [CrossRef] [PubMed]
  39. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [PubMed]
  40. Beyer, M.; Pogoda, F.; Pallez, M.; Lazic, J.; Hoffmann, L.; Pasquali, M. Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads. Int. J. Food Microbiol. 2014, 182–183, 51–56. [Google Scholar] [CrossRef] [PubMed]
  41. Stanković, S.; Tančić, S.; Lević, J.; Krnjaja, V. Production of deoxynivalenol by Fusarium graminearum and Fusarium culmorum isolated from wheat kernels in Serbia. Cereal Res. Commun. 2008, 36, 395–396. [Google Scholar]
  42. Schaarschmidt, S.; Fauhl-Hassek, C. The fate of mycotoxins during the processing of wheat for human consumption. Compr. Rev. Food Sci. Food Saf. 2018, 17, 556–593. [Google Scholar] [CrossRef]
  43. Tibola, C.S.; Fernandes, J.M.C.; Guarienti, E.M.; Nicolau, M. Distribution of Fusarium mycotoxins in wheat milling process. Food Control 2015, 53, 91–95. [Google Scholar] [CrossRef]
  44. Prodi, A.; Purahong, W.; Tonti, S.; Salomoni, D.; Nipoti, P.; Covarelli, L.; Pisi, A. Difference in chemotype composition of Fusarium graminearum populations isolated from durum wheat in adjacent areas separated by the Apennines in Northern-Central Italy. Plant Pathol. J. 2011, 27, 354–359. [Google Scholar] [CrossRef]
  45. Audenaert, K.; Van Broeck, R.; Bekaert, B.; De Witte, F.; Heremans, B.; Messens, K.; Höfte, M.; Haesaert, G. Fusarium head blight (FHB) in Flanders: Population diversity, inter-species associations and DON contamination in commercial winter wheat varieties. Eur. J. Plant Pathol. 2009, 125, 445–458. [Google Scholar] [CrossRef]
  46. Alvarez, C.L.; Azcarate, M.P.; Pinto, V.F. Toxigenic potential of Fusarium graminearum sensu stricto isolates from wheat in Argentina. Int. J. Food Microbiol. 2009, 135, 131–135. [Google Scholar] [CrossRef] [PubMed]
  47. Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef]
  48. Waalwijk, C.; Kastelein, P.; Vries, I.; Kerenyi, Z.; van der Lee, T.; Hesselink, T.; Kohl, J.; Kema, G. Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 2003, 109, 743–754. [Google Scholar] [CrossRef]
  49. Ward, T.J.; Bielawski, J.P.; Kistler, H.C.; Sullivan, E.; O’Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proc. Natl. Acad. Sci. USA 2002, 99, 9278–9283. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Mean monthly temperature, total monthly rainfall and mean relative humidity (RH) from October to July for seasons 2004–2005, 2007–2008 and 2014–2015 in the Belgrade area.
Figure 1. Mean monthly temperature, total monthly rainfall and mean relative humidity (RH) from October to July for seasons 2004–2005, 2007–2008 and 2014–2015 in the Belgrade area.
Toxins 10 00460 g001
Figure 2. Amplification of PCR products with species-specific primers FG16F/FG16R for the identification of Fusarium graminearum; lane M, 100 bp DNA ladder and lane C, control.
Figure 2. Amplification of PCR products with species-specific primers FG16F/FG16R for the identification of Fusarium graminearum; lane M, 100 bp DNA ladder and lane C, control.
Toxins 10 00460 g002
Figure 3. Amplification PCR products with primers TRI13F/TRI13R specific to deoxynivalenol (234 bp) and nivalenol (415 bp) genotypes; lane M, 100 bp DNA ladder and lane C, control.
Figure 3. Amplification PCR products with primers TRI13F/TRI13R specific to deoxynivalenol (234 bp) and nivalenol (415 bp) genotypes; lane M, 100 bp DNA ladder and lane C, control.
Toxins 10 00460 g003
Figure 4. Amplification PCR products with primers TRI3F/TRI3R specific for 4-acetylnivalenol (840 bp), 15-acetyldeoxynivalenol (610 bp), and 3-acetyldeoxynivalenol (243 bp) genotypes; lane M, 100 bp DNA ladder and lane C, control.
Figure 4. Amplification PCR products with primers TRI3F/TRI3R specific for 4-acetylnivalenol (840 bp), 15-acetyldeoxynivalenol (610 bp), and 3-acetyldeoxynivalenol (243 bp) genotypes; lane M, 100 bp DNA ladder and lane C, control.
Toxins 10 00460 g004
Table 1. The detailed data on F. graminearum strains.
Table 1. The detailed data on F. graminearum strains.
StrainWheat Variety (Host)Year of IsolationF. graminearum Genotypes
TRI13 PrimersTRI3 Primers
DONNIV3-ADON15-ADON
IZS 146Pobeda2005++
IZS 147Pobeda2005++
IZS 148Pobeda2005++
IZS 149Pobeda2005++
IZS 150Pobeda2005++
IZS 151Pobeda2005++
IZS 152Pobeda2005++
IZS 153Pobeda2005++
IZS 243Pobeda2008++
IZS 244Pobeda2008++
IZS 250Pobeda2008++
IZS 251Pobeda2008++
IZS 252Pobeda2008++
IZS 254Pobeda2008++
IZS 255Pobeda2008++
IZS 256Pobeda2008++
IZS 257Pobeda2008++
IZS 258Pobeda2008++
IZS 362Simonida2015++
IZS 363Simonida2015++
IZS 364Simonida2015++
IZS 365Simonida2015++
IZS 366Simonida2015++
IZS 367NS40S2015++
IZS 368NS40S2015++
IZS 369NS40S2015++
IZS 370NS40S2015++
IZS 371NS40S2015++
IZS 372Simonida2015++
IZS 373NS40S2015++
IZS 374NS40S2015++
IZS 375NS40S2015++
IZS 376NS40S2015++
IZS 377Simonida2015++
IZS 378NS40S2015++
IZS 379NS40S2015++
IZS 380NS40S2015++
DON, deoxynivalenol. NIV, nivalenol. 3-ADON, 3-acetyldeoxynivalenol. 15-ADON, 15-acetyldeoxynivalenol. +, products amplified of 234 bp (DON) and 610 bp (15-ADON). −, no amplification.
Table 2. Toxigenic potential for DON production of tested F. graminearum strains.
Table 2. Toxigenic potential for DON production of tested F. graminearum strains.
F. graminearum StrainsWheat VarietyYear of IsolationDON (µg kg−1)
IZS 146Pobeda2005>25,000
IZS 147Pobeda2005>25,000
IZS 148Pobeda2005>25,000
IZS 149Pobeda200523,830
IZS 150Pobeda200523,610
IZS 151Pobeda200520,020
IZS 243Pobeda2008>25,000
IZS 244Pobeda20082061
IZS 250Pobeda200821,460
IZS 251Pobeda200820,260
IZS 252Pobeda2008>25,000
IZS 254Pobeda20086130
IZS 362Simonida20159250
IZS 363Simonida20153089
IZS 364Simonida2015>25,000
IZS 367NS40S20157500
IZS 368NS40S20157420
IZS 369NS40S201521,050
Control--<40
DON, deoxynivalenol.
Table 3. Sequences of primers used in PCR assays.
Table 3. Sequences of primers used in PCR assays.
Gene PrimerSequence (5′–3′)Size (bp)
FG16 FG16F/FG16RCTCCGGATATGTTGCGTCAA
GGTAGGTATCCGACATGGCAA
400–500
TRI13 TRI13F/TRI13RTACGTGAAACATTGTTGGC
GGTGTCCCAGGATCTGCG
234 or 415
TRI3common3CONTGGCAAAGACTGGTTCAC-
specific3NAGTGCACAGAATATACGAGCTRI NIV 840
3D15AACTGACCCAAGCTGCCATC15-ADON 610
3D3ACGCATTGGCTAACACATG3-ADON 243

Share and Cite

MDPI and ACS Style

Krnjaja, V.; Stanković, S.; Obradović, A.; Petrović, T.; Mandić, V.; Bijelić, Z.; Božić, M. Trichothecene Genotypes of Fusarium graminearum Populations Isolated from Winter Wheat Crops in Serbia. Toxins 2018, 10, 460. https://doi.org/10.3390/toxins10110460

AMA Style

Krnjaja V, Stanković S, Obradović A, Petrović T, Mandić V, Bijelić Z, Božić M. Trichothecene Genotypes of Fusarium graminearum Populations Isolated from Winter Wheat Crops in Serbia. Toxins. 2018; 10(11):460. https://doi.org/10.3390/toxins10110460

Chicago/Turabian Style

Krnjaja, Vesna, Slavica Stanković, Ana Obradović, Tanja Petrović, Violeta Mandić, Zorica Bijelić, and Manja Božić. 2018. "Trichothecene Genotypes of Fusarium graminearum Populations Isolated from Winter Wheat Crops in Serbia" Toxins 10, no. 11: 460. https://doi.org/10.3390/toxins10110460

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop