1,25-Dihydroxyvitamin D3 Provides Benefits in Vitiligo Based on Modulation of CD8+ T Cell Glycolysis and Function
Abstract
1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. Procedure
2.2.1. Cell Culture and Treatment
2.2.2. Animals and Drug Treatment Protocols
2.2.3. Cell Viability
2.2.4. Enzyme-Linked Immunosorbent Assay (ELISA)
2.2.5. Flow Cytometry Analysis
2.2.6. Glucose Uptake Assay
2.2.7. Enzyme Activity Assays
2.2.8. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.2.9. Western Blot Analysis
2.2.10. Immunohistochemistry
2.3. Data Sources and Analysis
2.3.1. Data Source and Bioinformatic Analysis
2.3.2. Data Presentation and Statistical Analysis
3. Results
3.1. Deficiency of 1,25(OH)₂D₃ Is Associated with Disease Activity and Dysfunction of CD8+ T Cells in the Vitiligo Cohort
3.2. 1,25(OH)₂D₃ Influences Glucose Metabolism and Signaling Pathways of Circulating Immune Cells
3.3. 1,25(OH)₂D₃ Inhibits Proliferation and Cytotoxicity of CD8+ T Cells
3.4. 1,25(OH)₂D₃ Inhibits Glycolysis of CD8+ T Cells by Regulating the AMPK Pathway
3.5. Therapeutic Effect of 1,25(OH)₂D₃ on Melanocyte-Associated Vitiligo Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bergqvist, C.; Ezzedine, K. Vitiligo: A Review. Dermatology 2020, 236, 571–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frisoli, M.L.; Essien, K.; Harris, J.E. Vitiligo: Mechanisms of Pathogenesis and Treatment. Annu. Rev. Immunol. 2020, 38, 621–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Speeckaert, R.; van Geel, N. Vitiligo: An Update on Pathophysiology and Treatment Options. Am. J. Clin. Dermatol. 2017, 18, 733–744. [Google Scholar] [CrossRef] [Scilit]
- Wilson, L.R.; Tripkovic, L.; Hart, K.H.; Lanham-New, S.A. Vitamin D deficiency as a public health issue: Using vitamin D2 or vitamin D3 in future fortification strategies. Proc. Nutr. Soc. 2017, 76, 392–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Penna, G.; Adorini, L. 1α,25-Dihydroxyvitamin D3 Inhibits Differentiation, Maturation, Activation, and Survival of Dendritic Cells Leading to Impaired Alloreactive T Cell Activation. J. Immunol. 2000, 164, 2405–2411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pludowski, P.; Holick, M.F.; Pilz, S.; Wagner, C.L.; Hollis, B.W.; Grant, W.B.; Shoenfeld, Y.; Lerchbaum, E.; Llewellyn, D.J.; Kienreich, K.; et al. Vitamin D effects on musculoskeletal health, immunity, autoimmunity, cardiovascular disease, cancer, fertility, pregnancy, dementia and mortality-a review of recent evidence. Autoimmun. Rev. 2013, 12, 976–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atazadeh, F.; Fazeli, Z.; Vahidnezhad, H.; Namazi, N.; Younespour, S.; Youssefian, L.; Abdollahimajd, F.; Uitto, J. Increased level of cathelicidin (LL-37) in vitiligo: Possible pathway independent from vitamin D receptor gene polymorphism. Exp. Dermatol. 2020, 29, 1176–1185. [Google Scholar] [CrossRef] [Scilit]
- Silverberg, J.I.; Silverberg, A.I.; Malka, E.; Silverberg, N.B. A pilot study assessing the role of 25 hydroxy vitamin D levels in patients with vitiligo vulgaris. J. Am. Acad. Dermatol. 2010, 62, 937–941. [Google Scholar] [CrossRef] [Scilit]
- Khurrum, H.; AlGhamdi, K.M. The Relationship Between the Serum Level of Vitamin D and Vitiligo: A Controlled Study on 300 Subjects. J. Cutan. Med. Surg. 2016, 20, 139–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, Y.; Liu, J.; Li, W.; Zheng, H.; Dai, H.; Qiu, G.; Yu, D.; Yao, D.; Yin, X. Causal Associations between Vitamin D Levels and Psoriasis, Atopic Dermatitis, and Vitiligo: A Bidirectional Two-Sample Mendelian Randomization Analysis. Nutrients 2022, 14, 5284. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.; Chen, D.; Hu, Y.; Jiang, K.; Huang, H.; Du, Y.; Wu, W.; Wang, J.; Sui, J.; Wang, W.; et al. Anatomically distinct fibroblast subsets determine skin autoimmune patterns. Nature 2022, 601, 118–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sukumar, M.; Liu, J.; Ji, Y.; Subramanian, M.; Crompton, J.G.; Yu, Z.; Roychoudhuri, R.; Palmer, D.C.; Muranski, P.; Karoly, E.D.; et al. Inhibiting glycolytic metabolism enhances CD8+ T cell memory and antitumor function. J. Clin. Investig. 2013, 123, 4479–4488. [Google Scholar] [CrossRef] [Scilit]
- Thien, R.; Baier, K.; Pietschmann, P.; Peterlik, M.; Willheim, M. Interactions of 1α,25-dihydroxyvitamin D3 with IL-12 and IL-4 on cytokine expression of human T lymphocytes. J. Allergy Clin. Immunol. 2005, 116, 683–689. [Google Scholar] [CrossRef] [Scilit]
- Bishop, E.L.; Gudgeon, N.H.; Mackie, G.M.; Chauss, D.; Roberts, J.; Tennant, D.A.; Maslowski, K.M.; Afzali, B.; Hewison, M.; Dimeloe, S. 1,25-Dihydroxyvitamin D3 suppresses CD4(+) T-cell effector functionality by inhibition of glycolysis. Immunology 2022, 166, 299–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Xu, Z.; Cui, J.; Chen, T. A mouse model of vitiligo based on endogenous auto-reactive CD8 + T cell targeting skin melanocyte. Cell Regen. 2022, 11, 31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boniface, K.; Seneschal, J.; Picardo, M.; Taïeb, A. Vitiligo: Focus on Clinical Aspects, Immunopathogenesis, and Therapy. Clin. Rev. Allergy Immunol. 2018, 54, 52–67. [Google Scholar] [CrossRef] [Scilit]
- Youssef, R.; Emad, N.; Mogawer, R.M. Comparative Analysis of the Most Used Versus the Recently Developed Vitiligo Activity and Extent Scores and Their Change with Treatment. Dermatol. Pr. Concept. 2023, 13, e2023186. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Zhou, T.; She, Q.; Nie, X.; Liu, Z.; Pan, R.; Wei, Y.; Deng, Y. Circulating Exosomal miR-493-3p Affects Melanocyte Survival and Function by Regulating Epidermal Dopamine Concentration in Segmental Vitiligo. J. Investig. Dermatol. 2022, 142, 3262–3273. [Google Scholar] [CrossRef] [Scilit]
- Lo, J.A.; Kawakubo, M.; Juneja, V.R.; Su, M.Y.; Erlich, T.H.; LaFleur, M.W.; Kemeny, L.V.; Rashid, M.; Malehmir, M.; Rabi, S.A.; et al. Epitope spreading toward wild-type melanocyte-lineage antigens rescues suboptimal immune checkpoint blockade responses. Sci. Transl. Med. 2021, 13, eabd8636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maeda, Y.; Nishikawa, H.; Sugiyama, D.; Ha, D.; Hamaguchi, M.; Saito, T.; Nishioka, M.; Wing, J.B.; Adeegbe, D.; Katayama, I.; et al. Detection of self-reactive CD8+ T cells with an anergic phenotype in healthy individuals. Science 2014, 346, 1536–1540. [Google Scholar] [CrossRef] [Scilit]
- Jin, R.; Zhou, M.; Lin, F.; Xu, W.; Xu, A. Pathogenic Th2 Cytokine Profile Skewing by IFN-γ-Responding Vitiligo Fibroblasts via CCL2/CCL8. Cells 2023, 12, 217. [Google Scholar]
- Halprin, K.M. Epidermal “turnover time”–A re-examination. Br. J. Dermatol. 1972, 86, 14–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ao, T.; Kikuta, J.; Ishii, M. The Effects of Vitamin D on Immune System and Inflammatory Diseases. Biomolecules 2021, 11, 1624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baeke, F.; Takiishi, T.; Korf, H.; Gysemans, C.; Mathieu, C. Vitamin D: Modulator of the immune system. Curr. Opin. Pharmacol. 2010, 10, 482–496. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, S.; Li, C. Clinical Features, Immunopathogenesis, and Therapeutic Strategies in Vitiligo. Clin. Rev. Allergy Immunol. 2021, 61, 299–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cantorna, M.T.; Waddell, A. The vitamin D receptor turns off chronically activated T cells. Ann. N. Y Acad. Sci. 2014, 1317, 70–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, J.; Liao, S.; Zeng, F.; Liao, Q.; Luo, G.; Zhou, Y. Effects of altered glycolysis levels on CD8+ T cell activation and function. Cell Death Dis. 2023, 14, 407. [Google Scholar] [CrossRef] [Scilit]
- Souto-Carneiro, M.M.; Klika, K.D.; Abreu, M.T.; Meyer, A.P.; Saffrich, R.; Sandhoff, R.; Jennemann, R.; Kraus, F.V.; Tykocinski, L.; Eckstein, V.; et al. Effect of Increased Lactate Dehydrogenase A Activity and Aerobic Glycolysis on the Proinflammatory Profile of Autoimmune CD8+ T Cells in Rheumatoid Arthritis. Arthritis Rheumatol. 2020, 72, 2050–2064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prunk, M.; Perišić Nanut, M.; Jakoš, T.; Sabotič, J.; Švajger, U.; Kos, J. Extracellular Cystatin F Is Internalised by Cytotoxic T Lymphocytes and Decreases Their Cytotoxicity. Cancers 2020, 12, 3660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Connor, R.; Cesano, A.; Lange, B.; Finan, J.; Nowell, P.C.; Clark, S.C.; Raimondi, S.C.; Rovera, G.; Santoli, D. Growth Factor Requirements of Childhood Acute T-Lymphoblastic Leukemia: Correlation Between Presence of Chromosomal Abnormalities and Ability to Grow Permanently In Vitro. Blood 1991, 77, 1534–1545. [Google Scholar] [CrossRef] [Scilit]
- Ma, E.H.; Poffenberger, M.C.; Wong, A.H.T.; Jones, R.G. The role of AMPK in T cell metabolism and function. Curr. Opin. Immunol. 2017, 46, 45–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cool, B.; Zinker, B.; Chiou, W.; Kifle, L.; Cao, N.; Perham, M.; Dickinson, R.; Adler, A.; Gagne, G.; Iyengar, R.; et al. Identification and characterization of a small molecule AMPK activator that treats key components of type 2 diabetes and the metabolic syndrome. Cell Metab. 2006, 3, 403–416. [Google Scholar] [CrossRef] [Scilit]
- Blagih, J.; Coulombe, F.; Vincent, E.E.; Dupuy, F.; Galicia-Vázquez, G.; Yurchenko, E.; Raissi, T.C.; van der Windt, G.J.W.; Viollet, B.; Pearce, E.L.; et al. The Energy Sensor AMPK Regulates T Cell Metabolic Adaptation and Effector Responses In Vivo. Immunity 2015, 42, 41–54. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Chhipa, R.R.; Nakano, I.; Dasgupta, B. The AMPK inhibitor compound C is a potent AMPK-independent antiglioma agent. Mol. Cancer Ther. 2014, 13, 596–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- AlGhamdi, K.; Kumar, A.; Moussa, N. The role of vitamin D in melanogenesis with an emphasis on vitiligo. Indian. J. Dermatol. Venereol. Leprol. 2013, 79, 750–758. [Google Scholar] [CrossRef] [Scilit]
- Christakos, S.; Dhawan, P.; Verstuyf, A.; Verlinden, L.; Carmeliet, G. Vitamin D: Metabolism, Molecular Mechanism of Action, and Pleiotropic Effects. Physiol. Rev. 2016, 96, 365–408. [Google Scholar] [CrossRef] [Scilit]
- Karagüzel, G.; Sakarya, N.P.; Bahadır, S.; Yaman, S.; Ökten, A. Vitamin D status and the effects of oral vitamin D treatment in children with vitiligo: A prospective study. Clin. Nutr. ESPEN 2016, 15, 28–31. [Google Scholar] [CrossRef] [Scilit]
- Finamor, D.C.; Sinigaglia-Coimbra, R.; Neves, L.C.; Gutierrez, M.; Silva, J.J.; Torres, L.D.; Surano, F.; Neto, D.J.; Novo, N.F.; Juliano, Y.; et al. A pilot study assessing the effect of prolonged administration of high daily doses of vitamin D on the clinical course of vitiligo and psoriasis. Dermatoendocrinol 2013, 5, 222–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glebocka, A.; Chiellini, G. A-ring analogs of 1,25-dihydroxyvitamin D3. Arch. Biochem. Biophys. 2012, 523, 48–57. [Google Scholar] [CrossRef] [Scilit]







| mRNA | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| GLUT1 | GGCCAAGAGTGTGCTAAAGAA | ACAGCGTTGATGCCAGACAG |
| LDHA | ATGGCAACTCTAAAGGATCAGC | CCAACCCCAACAACTGTAATCT |
| HKII | GAGCCACCACTCACCCTACT | CCAGGCATTCGGCAATGTG |
| IFNG | TCGGTAACTGACTTGAATGTCCA | TCGCTTCCCTGTTTTAGCTGC |
| β-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
| All (N = 327) | 1,25(OH)₂D₃ Sufficient (≥20 ng/mL, N = 94, 28.74%) | 1,25(OH)₂D₃ Deficient (<20 ng/mL, N = 233, 71.62%) | p | |
|---|---|---|---|---|
| Serum 1,25(OH)₂D₃ concentration, mean ± SD, μg/mL | 16.73 ± 6.353 | 24.82 ± 3.745 | 13.47 ± 3.730 | <0.0001 |
| Disease duration, mean ± SD, month | 46.2 6 ± 82.62 | 50.36 ± 97.79 | 44.61 ± 75.82 | 0.1826 |
| total counts of T cells, mean ± SD | 1442 ± 511.8 | 1372 ± 527.5 | 1470 ± 503.7 | 0.0830 |
| CD8+ T cells/T cells, mean ± SD, % | 24.36 ± 5.793 | 22.88 ± 5.444 | 24.96 ± 5.834 | 0.0019 |
| IFN−γ+ CD8+ T cells/CD8+ T cells, mean ± SD, % | 38.69 ± 12.90 | 36.26 ± 15.466 | 39.67 ± 11.61 | 0.0011 |
| VASI, mean ± SD | 1.904 ± 5.437 | 1.422 ± 2.238 | 2.099 ± 6.277 | 0.2683 |
| VIDA, No (%) | 0.0024 | |||
| −1 | 7 (2.14%) | 3 (3.19%) | 4 (1.72%) | |
| 0 | 13 (3.98%) | 7 (7.45%) | 6 (2.58%) | |
| 1 | 21 (6.42%) | 4 (4.26%) | 17 (7.3%) | |
| 2 | 70 (21.41%) | 30 (31.91%) | 40 (17.17%) | |
| 3 | 85 (25.99%) | 25 (26.6%) | 60 (25.75%) | |
| 4 | 131 (40.06%) | 25 (26.6%) | 106 (45.49%) | |
| Types of vitiligo, No (%) | 0.7556 | |||
| Nonsegmental | 194 (59.33%) | 54 (57.45%) | 140 (60.09%) | |
| Segmental | 95 (29.05%) | 30 (31.91%) | 65 (27.9%) | |
| Unclassified | 38 (11.62%) | 10 (10.64%) | 28 (12.02%) | |
| Sex, No (%) | 0.0930 | |||
| Male | 157 (48.01%) | 52 (55.32%) | 105 (45.06%) | |
| Female | 170 (51.99%) | 42 (44.68%) | 128 (54.94%) | |
| Smoking, No. (%) | 0.2121 | |||
| No | 304 (92.97%) | 90 (95.74%) | 214 (91.85%) | |
| Yes | 23 (7.03%) | 4 (4.26%) | 19 (8.15%) | |
| Drinking, No (%) | 0.3650 | |||
| No | 311 (95.11%) | 91 (96.81%) | 220 (94.42%) | |
| Yes | 16 (4.89%) | 3 (3.19%) | 13 (5.58%) | |
| Insomnia, No (%) | 0.1619 | |||
| No | 278 (85.02%) | 84 (89.36%) | 194 (83.26%) | |
| Yes | 49 (14.98%) | 10 (10.64%) | 39 (16.74%) | |
| Hereditary, No (%) | 0.8362 | |||
| No | 263 (80.43%) | 78 (82.98%) | 187 (80.26%) | |
| Yes | 64 (19.57%) | 18 (19.15%) | 46 (19.74%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, Y.; Wang, T.; Nie, X.; Shi, Z.; Liu, Z.; Zeng, Y.; Pan, R.; Zhang, R.; Deng, Y.; Li, D. 1,25-Dihydroxyvitamin D3 Provides Benefits in Vitiligo Based on Modulation of CD8+ T Cell Glycolysis and Function. Nutrients 2023, 15, 4697. https://doi.org/10.3390/nu15214697
Wei Y, Wang T, Nie X, Shi Z, Liu Z, Zeng Y, Pan R, Zhang R, Deng Y, Li D. 1,25-Dihydroxyvitamin D3 Provides Benefits in Vitiligo Based on Modulation of CD8+ T Cell Glycolysis and Function. Nutrients. 2023; 15(21):4697. https://doi.org/10.3390/nu15214697
Chicago/Turabian StyleWei, Yujia, Tingmei Wang, Xiaoqi Nie, Zeqi Shi, Zhong Liu, Ying Zeng, Ronghua Pan, Ri Zhang, Yunhua Deng, and Dong Li. 2023. "1,25-Dihydroxyvitamin D3 Provides Benefits in Vitiligo Based on Modulation of CD8+ T Cell Glycolysis and Function" Nutrients 15, no. 21: 4697. https://doi.org/10.3390/nu15214697
APA StyleWei, Y., Wang, T., Nie, X., Shi, Z., Liu, Z., Zeng, Y., Pan, R., Zhang, R., Deng, Y., & Li, D. (2023). 1,25-Dihydroxyvitamin D3 Provides Benefits in Vitiligo Based on Modulation of CD8+ T Cell Glycolysis and Function. Nutrients, 15(21), 4697. https://doi.org/10.3390/nu15214697

