Inhibition of Hepatitis B Virus (HBV) by Tachyplesin, a Marine Antimicrobial Cell-Penetrating Peptide
Abstract
:1. Introduction
2. Methods
2.1. Peptide Synthesis
2.2. Cell Culture
2.3. HBV Plasmid and Transfection
2.4. Cellular Uptake Studies
2.5. Cytotoxicity Analysis
2.6. Dual-Luciferase Reporter Assay
2.7. Estimation of HBV Proteins by ELISA
2.8. qRT-PCR Studies
2.9. Estimation of Secreted Virion
2.10. Primers Used in the Study
Primer | Sequence (5′ to 3′) |
---|---|
pgRNA | FP: CACCTCTGCCTAATCATC [23] RP: GGAAAGAAGTCAGAAGGCAA |
pcRNA | FP: GGTCTGCGCACCAGCACC [23] RP: GGAAAGAAGTCAGAAGGCAA |
Virion | FP: GGTCTGCGCACCAGCACC [23] RP: GAACTTTAGGCCCATATTAGTG |
IFN-α | FP: GACTCCATCTTGGCTGTGA [29] RP: TGATTTCTGCTCTGACAACCT |
IFN-β | FP: GCTTGGATTCCTACAAAGAAGCA [30] RP: ATAGATGGTCAATGCGGCGTC |
GAPDH | FP: TGCACCACCAACTGCTTAGC [23] RP: GGCATGGACTGTGGTCATGAG |
2.11. Statistical Analysis
3. Results
3.1. Internalization of FITC-Tpl in Huh7 and HepG2 Cells
3.2. Tpl Is Well Tolerated by Huh7 and HepG2 Cells
3.3. Tpl Does Not Affect Transfection or the Cellular Transcription, Translation, and Secretion Machinery
3.4. Tpl Inhibits Secreted HBV Proteins
3.5. Tpl Inhibits HBV pcRNA and HBV pgRNA
3.6. Tpl Inhibits Hepatitis B Virion Secretion
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Tsukuda, S.; Watashi, K. Hepatitis B virus biology and life cycle. Antiviral Res. 2020, 182, 104925. [Google Scholar] [CrossRef] [PubMed]
- Locarnini, S. Molecular virology of Hepatitis B Virus. Semin. Liver Dis. 2004, 24, 3–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, L.; PLoSs, A. Mechanism of Hepatitis B Virus cccDNA Formation. Viruses 2021, 13, 1463. [Google Scholar] [CrossRef]
- Liang, T.J. Hepatitis B: The virus and disease. Hepatology 2009, 49, S13–S21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, H. Hepatitis Infection B Virus: Molecular Virology to Antiviral Drugs; Springer Nature: Singapore, 2020. [Google Scholar]
- Elnagdy, S.; AlKhazindar, M. The potential of antimicrobial peptides as an antiviral therapy against COVID-19. ACS Pharmacol. Transl. Sci. 2020, 3, 780–782. [Google Scholar] [CrossRef]
- Vilas Boas, L.C.P.; Campos, M.L.; Berlanda, R.L.A.; de Carvalho Neves, N.; Franco, O.L. Antiviral peptides as promising therapeutic drugs. Cell. Mol. Life Sci. 2019, 76, 3525–3542. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Hong, W.; Zeng, Z.; Wu, Y.; Hu, K.; Tian, X.; Li, W.; Cao, Z. Mucroporin-M1 inhibits hepatitis B virus replication by activating the mitogen-activated protein kinase (MAPK) pathway and down-regulating HNF4α in vitro and in vivo. J. Biol. Chem. 2012, 287, 30181–30190. [Google Scholar] [CrossRef] [Green Version]
- Järver, P.; Langel, Ü. Cell-penetrating peptides—A brief introduction. Biochim. Biophys. Acta Biomembr. 2006, 1758, 260–263. [Google Scholar] [CrossRef] [Green Version]
- Desale, K.; Kuche, K.; Jain, S. Cell-penetrating peptides (CPPs): An overview of applications for improving the potential of nanotherapeutics. Biomater. Sci. 2021, 9, 1153–1188. [Google Scholar] [CrossRef]
- Jain, A.; Yadav, B.K.; Chugh, A. Marine antimicrobial peptide Tachyplesin as an efficient nanocarrier for macromolecule delivery in plant and mammalian cells. FEBS J. 2015, 282, 732–745. [Google Scholar] [CrossRef]
- Neundorf, I. Antimicrobial and Cell-Penetrating Peptides: How to understand two distinct functions despite similar physicochemical properties. Adv. Exp. Med. Biol. 2019, 1117, 93–109. [Google Scholar] [PubMed]
- Ndeboko, B.; Hantz, O.; Lemamy, G.J.; Cova, L. Developments in cell-penetrating peptides as antiviral agents and as vehicles for delivery of peptide nucleic acid targeting hepadnaviral replication pathway. Biomolecules 2018, 8, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ndeboko, B.; Ramamurthy, N.; Lemamy, G.J.; Jamard, C.; Nielsen, P.E.; Cova, L. Role of cell-penetrating peptides in intracellular delivery of peptide nucleic acids targeting hepadnaviral replication. Mol. Ther. Nucleic Acids 2017, 9, 162–169. [Google Scholar] [CrossRef] [Green Version]
- Choi, Y.-M.; Kim, H.; Lee, S.-A.; Lee, S.-Y.; Kim, B.-J. A Telomerase-derived peptide exerts an anti-Hepatitis B Virus effect via mitochondrial DNA stress-dependent type I interferon production. Front. Immunol. 2020, 11, 652. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, T.; Furunaka, H.; Miyata, T.; Tokunaga, F.; Muta, T.; Iwanaga, S.; Niwa, M.; Takao, T.; Shimonishi, Y. Tachyplesin, a class of antimicrobial peptide from the hemocytes of the horseshoe crab (Tachypleus tridentatus). Isolation and chemical structure. J. Biol. Chem. 1988, 263, 16709–16713. [Google Scholar] [CrossRef] [PubMed]
- Jana, A.; Narula, P.; Chugh, A.; Kulshreshtha, R. Efficient delivery of anti-miR-210 using Tachyplesin, a cell penetrating peptide, for glioblastoma treatment. Int. J. Pharm. 2019, 572, 118789. [Google Scholar] [CrossRef]
- Vernen, F.; Harvey, K.J.; Dias, S.A.; Veiga, A.S.; Huang, Y.-H.; Craik, D.J.; Lawrence, N.; Henriques, S.T. Characterization of Tachyplesin peptides and their cyclized analogues to improve antimicrobial and anticancer properties. Int. J. Mol. Sci. 2019, 20, 4184. [Google Scholar] [CrossRef] [Green Version]
- Kumar, V.; Chugh, A. Peptide-mediated leishmaniasis management strategy: Tachyplesin emerges as an effective anti-leishmanial peptide against Leishmania donovani. Biochim. Biophys. Acta Biomembr. 2021, 1863, 183629. [Google Scholar] [CrossRef]
- da Mata, É.C.G.; Mourão, C.B.F.; Rangel, M.; Schwartz, E.F. Antiviral activity of animal venom peptides and related compounds. J. Venom. Anim. Toxins Incl. Trop. Dis. 2017, 23, 3. [Google Scholar] [CrossRef] [Green Version]
- Xie, H.; Wei, J.; Qin, Q. Antiviral function of Tachyplesin I against iridovirus and nodavirus. Fish Shellfish Immunol. 2016, 58, 96–102. [Google Scholar] [CrossRef]
- Amir, F.; Siddiqui, Z.I.; Farooqui, S.R.; Anwer, A.; Khan, S.; Azmi, M.I.; Mehmankhah, M.; Dohare, R.; Khan, L.A.; Kazim, S.N. Impact of length of replication competent genome of hepatitis B virus over the differential antigenic secretion. J. Cell. Biochem. 2019, 120, 17858–17871. [Google Scholar] [CrossRef] [PubMed]
- Samal, J.; Kandpal, M.; Vivekanandan, P. Hepatitis B “e” antigen-mediated inhibition of HBV replication fitness and transcription efficiency in vitro. Virology 2015, 484, 234–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiruthika, S.; Bhat, R.; Dash, R.; Rathore, A.S.; Vivekanandan, P.; Jayaram, B. A novel piperazine derivative that targets hepatitis B surface antigen effectively inhibits tenofovir resistant hepatitis B virus. Sci. Rep. 2021, 11, 11723. [Google Scholar] [CrossRef] [PubMed]
- Kandpal, M.; Samal, J.; Biswas, B.; Negi, A.; Mishra, V.C.; Tyagi, N.; Raina, V.; Vivekanandan, P. Enhanced hepatitis B virus (HBV) pre-genomic RNA levels and higher transcription efficiency of defective HBV genomes. J. Gen. Virol. 2015, 96, 3109–3117. [Google Scholar] [CrossRef] [Green Version]
- Ahluwalia, S.; Choudhary, D.; Tyagi, P.; Kumar, V.; Vivekanandan, P. Vitamin D signaling inhibits HBV activity by directly targeting the HBV core promoter. J. Biol. Chem. 2021, 297, 101233. [Google Scholar] [CrossRef]
- Biswas, B.; Kandpal, M.; Vivekanandan, P. A G-quadruplex motif in an envelope gene promoter regulates transcription and virion secretion in HBV genotype B. Nucleic Acids Res. 2017, 45, 11268–11280. [Google Scholar] [CrossRef] [Green Version]
- Samal, J.; Kandpal, M.; Vivekanandan, P. A simple and rapid method for the quantitation of secreted hepatitis B virions in cell culture models. Indian J. Med. Microbiol. 2015, 33, 290–292. [Google Scholar] [CrossRef]
- Colantonio, A.D.; Epeldegui, M.; Jesiak, M.; Jachimowski, L.; Blom, B.; Uittenbogaart, C.H. IFN-α is constitutively expressed in the human thymus, but not in peripheral lymphoid organs. PLoS ONE 2011, 6, e24252. [Google Scholar] [CrossRef]
- Schuster, S.; Overheul, G.J.; Bauer, L.; van Kuppeveld, F.J.M.; van Rij, R.P. No evidence for viral small RNA production and antiviral function of Argonaute 2 in human cells. Sci. Rep. 2019, 9, 13752. [Google Scholar] [CrossRef] [Green Version]
- Kuroki, A.; Tay, J.; Lee, G.H.; Yang, Y.Y. Broad-Spectrum antiviral peptides and polymers. Adv. Healthc. Mater. 2021, 10, e2101113. [Google Scholar] [CrossRef]
- Donkers, J.M.; Appelman, M.D.; van de Graaf, S.F.J. Mechanistic insights into the inhibition of NTCP by myrcludex B. JHEP Rep. Innov. Hepatol. 2019, 1, 278–285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smolders, E.J.; Burger, D.M.; Feld, J.J.; Kiser, J.J. Review article: Clinical pharmacology of current and investigational hepatitis B virus therapies. Aliment. Pharmacol. Ther. 2020, 51, 231–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Narula, P.; Kiruthika, S.; Chowdhari, S.; Vivekanandan, P.; Chugh, A. Inhibition of Hepatitis B Virus (HBV) by Tachyplesin, a Marine Antimicrobial Cell-Penetrating Peptide. Pharmaceutics 2023, 15, 672. https://doi.org/10.3390/pharmaceutics15020672
Narula P, Kiruthika S, Chowdhari S, Vivekanandan P, Chugh A. Inhibition of Hepatitis B Virus (HBV) by Tachyplesin, a Marine Antimicrobial Cell-Penetrating Peptide. Pharmaceutics. 2023; 15(2):672. https://doi.org/10.3390/pharmaceutics15020672
Chicago/Turabian StyleNarula, Pankhuri, Sankar Kiruthika, Shruti Chowdhari, Perumal Vivekanandan, and Archana Chugh. 2023. "Inhibition of Hepatitis B Virus (HBV) by Tachyplesin, a Marine Antimicrobial Cell-Penetrating Peptide" Pharmaceutics 15, no. 2: 672. https://doi.org/10.3390/pharmaceutics15020672