Phylogenetic and Molecular Analysis of the Porcine Epidemic Diarrhea Virus in Mexico during the First Reported Outbreaks (2013–2017)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction and cDNA Synthesis
2.3. Amplification of the PEDV Genome and Sequencing
2.4. Analysis of Sequences and Phylogeny
2.5. Trimeric Spike Protein Structure Prediction
3. Results
3.1. Analysis of Sequences
3.2. Phylogenetic Analysis
3.3. Prediction of the Structure of the Homotrimeric Spike Protein
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pensaert, M.B.; De Bouck, P. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef]
- Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef]
- Song, D.; Park, B. Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 2012, 44, 167–175. [Google Scholar] [CrossRef]
- Lei, J.; Kusov, Y.; Hilgenfeld, R. NSP3 of coronaviruses: Structures and functions of a large multi-domain protein. Antivir. Res. 2018, 149, 58–74. [Google Scholar] [CrossRef] [PubMed]
- Jarvis, M.C.; Lam, H.C.; Zhang, Y.; Wang, L.; Hesse, R.A.; Hause, B.M.; Vlasova, A.; Wang, Q.; Zhang, J.; Nelson, M.I.; et al. Genomic and evolutionary inferences between American and global strains of porcine epidemic diarrhea virus. Prev. Vet. Med. 2016, 123, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.M.; Hou, Y.; Marthaler, D.; Gao, X.; Liu, X.; Zheng, L.; Saif, L.J.; Wang, Q. Attenuation of an original US porcine epidemic diarrhea virus strain PC22A via serial cell culture passage. Vet. Microbiol. 2017, 201, 62–71. [Google Scholar] [CrossRef] [PubMed]
- Zuñiga, S.; Pascual-Iglesias, A.; Sanchez, C.M.; Sola, I.; Enjuanes, L. Virulence factors in porcine coronaviruses and vaccine design. Virus Res. 2016, 226, 142–151. [Google Scholar] [CrossRef]
- Li, W.; van Kuppeveld, F.J.; He, Q.; Rottier, P.J.; Bosch, B.J. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef]
- Chang, S.H.; Bae, J.L.; Kang, T.J.; Kim, J.; Chung, G.H.; Lim, C.W.; Laude, H.; Yang, M.S.; Jang, Y.S. Identification of the epitope region capable of inducing neutralizing antibodies against the porcine epidemic diarrhea virus. Mol. Cells 2002, 14, 295–299. [Google Scholar] [CrossRef]
- Li, C.; Li, W.; Lucio de Esesarte, E.; Guo, H.; van den Elzen, P.; Aarts, E.; van den Born, E.; Rottier, P.J.M.; Bosch, B.J. Cell attachment domains of the porcine epidemic diarrhea virus spike protein are key targets of neutralizing antibodies. J. Virol. 2017, 91, e00273-17. [Google Scholar] [CrossRef]
- Wang, L.; Byrum, B.; Zhang, Y. New variant of porcine epidemic diarrhea virus, United States, 2014. Emerg. Infect. Dis. 2014, 20, 917–919. [Google Scholar] [CrossRef]
- Okda, F.A.; Lawson, S.; Singrey, A.; Nelson, J.; Hain, K.S.; Joshi, L.R.; Christopher-Hennings, J.; Nelson, E.A.; Diel, D.G. The S2 glycoprotein subunit of porcine epidemic diarrhea virus contains immunodominant neutralizing epitopes. Virology 2017, 509, 185–194. [Google Scholar] [CrossRef]
- Walls, A.C.; Tortorici, M.A.; Frenz, B.; Snijder, J.; Li, W.; Rey, F.A.; DiMaio, F.; Bosch, B.J.; Veesler, D. Glycan shield and epitope masking of a coronavirus spike protein observed by cryo-electron microscopy. Nat. Struct. Mol. Biol. 2016, 23, 899–905. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Moon, H.; Kang, B. Porcine epidemic diarrhea: A review of current epidemiology and available vaccines. Clin. Exp. Vaccine Res. 2015, 4, 166–176. [Google Scholar] [CrossRef]
- Chen, F.; Zhu, Y.; Wu, M.; Ku, X.; Ye, S.; Li, Z.; Guo, X.; He, Q. Comparative genomic analysis of classical and variant virulent parental/attenuated strains of porcine epidemic diarrhea virus. Viruses 2015, 7, 5525–5538. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Lu, W.; Chen, J.; Xie, S.; Shi, H.; Hsu, H.; Yu, W.; Xu, K.; Bian, C.; Fischer, W.B.; et al. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett. 2012, 586, 384–391. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Xie, S.; Sun, B. Viral proteins function as ion channels. Biochim. Biophys. Acta 2011, 1808, 510–515. [Google Scholar] [CrossRef]
- Stevenson, G.W.; Hoang, H.; Schwartz, K.J.; Burrough, E.R.; Sun, D.; Madson, D.; Cooper, V.L.; Pillatzki, A.; Gauger, P.; Schmitt, B.J.; et al. Emergence of porcine epidemic diarrhea virus in the United States: Clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Investig. 2013, 25, 649–654. [Google Scholar] [CrossRef]
- Saif, L.J.; Pensaert, M.B.; Sestak, K.; Yeo, S.G.; Jung, K. Coronaviruses. In Diseases of Swine, 10th ed.; Zimmermam, J., Karriker, L., Ramirez, A., Schwartz, K., Stevenson, G., Eds.; Blackwell Publishing: Ames, IA, USA, 2012; pp. 501–524. [Google Scholar]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lau, C.C.; Tsang, A.K.; Lau, J.H.; Bai, R.; Teng, J.L.; Tsang, C.C.; Wang, M.; et al. Discovery of seven novel mammalian and avian coronaviruses in Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [CrossRef]
- Lara-Romero, R.; Gómez-Núñez, L.; Cerriteño-Sánchez, J.L.; Márquez-Valdelamar, L.; Mendoza-Elvira, S.; Ramírez-Mendoza, H.; Rivera-Benítez, J.F. Molecular characterization of the spike gene of the porcine epidemic diarrhea virus in Mexico, 2013–2016. Virus Genes 2018, 54, 215–224. [Google Scholar] [CrossRef]
- Trujillo-Ortega, M.E.; Beltrán-Figueroa, R.; García-Hernández, M.E.; Juárez-Ramírez, M.; Sotomayor-González, A.; Hernández-Villegas, E.N.; Becerra-Hernández, J.F.; Sarmiento-Silva, R.E. Isolation and characterization of porcine epidemic diarrhea virus associated with the 2014 disease outbreak in Mexico: Case report. BMC Vet. Res. 2016, 12, 132. [Google Scholar] [CrossRef]
- García-Hernández, M.E.; Trujillo-Ortega, M.E.; Alcaraz-Estrada, S.L.; Lozano-Aguirre-Beltrán, L.; Sandoval-Jaime, C.; Taboada-Ramírez, B.I.; Sarmiento-Silva, R.E. Molecular Detection and Characterization of Porcine Epidemic Diarrhea Virus and Porcine Aichivirus C Coinfection in México. Viruses 2021, 13, 738. [Google Scholar] [CrossRef]
- Reveles-Félix, S.; Carreón-Nápoles, R.; Mendoza-Elvira, S.; Quintero-Ramírez, V.; García-Sánchez, J.; Martínez-Bautista, R.; Saavedra-Montañez, M.; Mosqueda Gualito, J.J.; Sánchez-Betancourt, J.I. Emerging strains of porcine epidemic diarrhoea virus (PEDv) in Mexico. Transbound. Emerg. Dis. 2020, 67, 1035–1041. [Google Scholar] [CrossRef]
- Vlasova, A.N.; Marthaler, D.; Wang, Q.; Culhane, M.R.; Rossow, K.D.; Rovira, A.; Collins, J.; Saif, L.J. Distinct characteristics and complex evolution of PEDV strains, North America, May 2013–February 2014. Emerg. Infect. Dis. 2014, 20, 1620–1628. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, Y.; Byrum, B. Development and evaluation of a duplex real-time RT-PCR for detection and differentiation of virulent and variant strains of porcine epidemic diarrhea viruses from the United States. J. Virol. Methods 2014, 207, 154–157. [Google Scholar] [CrossRef] [PubMed]
- Walls, A.C.; Tortorici, M.A.; Bosch, B.J.; Frenz, B.; Rottier, P.J.; DiMaio, F.; Rey, F.A.; Veesler, D. Cryo-electron microscopy structure of a coronavirus spike glycoprotein trimer. Nature 2016, 531, 114–117. [Google Scholar] [CrossRef] [PubMed]
- Schulz, L.L.; Tonsor, G.T. Assessment of the economic impacts of porcine epidemic diarrhea virus in the United States. J. Anim. Sci. 2015, 93, 5111–5118. [Google Scholar] [CrossRef]
- Olanratmanee, E.O.; Kunavongkrit, A.; Tummaruk, P. Impact of porcine epidemic diarrhea virus infection at different periods of pregnancy on subsequent reproductive performance in gilts and sows. Anim. Reprod. Sci. 2010, 122, 42–51. [Google Scholar] [CrossRef]
- Wojdyla, J.A.; Manolaridis, I.; van Kasteren, P.B.; Kikkert, M.; Snijder, E.J.; Gorbalenya, A.E.; Tucker, P.A. Papain-like protease 1 from transmissible gastroenteritis virus: Crystal structure and enzymatic activity toward viral and cellular substrates. J. Virol. 2010, 84, 10063–10073. [Google Scholar] [CrossRef]
- Suzuki, T.; Murakami, S.; Takahashi, O.; Kodera, A.; Masuda, T.; Itoh, S.; Miyazaki, A.; Ohashi, S.; Tsutsui, T. Molecular characterization of pig epidemic diarrhoea viruses isolated in Japan from 2013 to 2014. Infect. Genet. Evol. 2015, 36, 363–368. [Google Scholar] [CrossRef]
- Lee, S.; Lee, C. Complete genome sequence of a novel S-insertion variant of porcine epidemic diarrhea virus from South Korea. Arch. Virol. 2017, 162, 2919–2922. [Google Scholar] [CrossRef] [PubMed]
- Reguera, J.; Ordono, D.; Santiago, C.; Enjuanes, L.; Casasnovas, J.M. Antigenic modules in the N-terminal S1 region of the transmissible gastroenteritis virus spike protein. J. Gen. Virol. 2011, 92, 1117–1126. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Tang, J.; Ma, Y.; Liang, X.; Yang, Y.; Peng, G.; Qi, Q.; Jiang, S.; Li, J.; Du, L.; et al. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J. Virol. 2015, 89, 6121–6125. [Google Scholar] [CrossRef] [PubMed]
- Deng, F.; Ye, G.; Liu, Q.; Navid, M.T.; Zhong, X.; Li, Y.; Wan, C.; Xiao, S.; He, Q.; Fu, Z.F.; et al. Identification and comparison of receptor binding characteristics of the spike protein of two porcine epidemic diarrhea virus strains. Viruses 2016, 8, 55. [Google Scholar] [CrossRef]
Primer | 5′-3′ Sequence | Amplified Region of the PEDV * | Size bp |
---|---|---|---|
PEDv-WG-1F | TCTAGTTCCTGGTTGGCGTTC | 136–2527 | 2392 |
PEDv-WG-1R | CGTGCCACAGTGACAACAATG | ||
PEDv-WG-2F | TGGTAGCATCTGGCGGTCTT | 2420–4912 | 2493 |
PEDv-WG-2R | CCAGCAGGCACTGTTTTGTTA | ||
PEDv-WG-3F | CTTTCAGGATTGAAGGTGCTCA | 4711–7327 | 2616 |
PEDv-WG-3R | GACAAACTGGCCAACAACGC | ||
PEDv-WG-4F | GGTCCAGGCTGCACTTTTAT | 6975–9575 | 2600 |
PEDv-WG-4R | TTCACCCGGTCTAACTGTGC | ||
PEDv-WG-5F | TACTGTTATCTGCCCACGCC | 9350–11815 | 2466 |
PEDv-WG-5R | ATACGCTCACACCCAAGGAC | ||
PEDv-WG-6F | ACTTGGCAAAGGATGGGGTT | 11566–14154 | 2588 |
PEDv-WG-6R | GTGGGCAGGATGTTACGCTT | ||
PEDv-WG-7F | AGCTCGCGTCGTGTATCAAA | 13945–16336 | 2392 |
PEDv-WG-7R | GCGTGAACATTTGTCATTGCTA | ||
PEDv-WG-8F | GCAGCGGTCGATTCACTTTG | 16274–18639 | 2365 |
PEDv-WG-8R | TCAAACGAAGTAGGCACCCAA | ||
PEDv-WG-9F | TGTTGGTGGTGCTGTCTGTAG | 18529–20966 | 2438 |
PEDv-WG-9R | AGTCGCGCAGTAGCATTAGT | ||
PEDv-WG-10F | GAGGTGGTCATGGCTTTGAGA | 20855–23380 | 2525 |
PEDv-WG-10R | CTGCCACAGAGCGACCATTA | ||
PEDv-WG-11F | ACACTGCAGCATGTAAGACCA | 23075–25541 | 2466 |
PEDv-WG-11R | CGGTGACAAGTGAAGCACAG | ||
PEDv-WG-12F | GCTTTTCGTACTCTTTTTCCTGCT | 25464–27820 | 2357 |
PEDv-WG-12R | ACCACTGGCTTACCGTTGTG |
Strain Name | Strain Type | Access Number |
---|---|---|
PEDV/MEX/MICH/01/2013 | Pandemic 1 | MH006957 |
PEDV/MEX/MICH/02/2013 | Pandemic 1 | MH006965 |
PEDV/MEX/MICH/19/2013 | INDEL | MH006958 |
PEDV/MEX/GTO/01/2013 | Pandemic 1 | MH006959 |
PEDV/MEX/JAL/01/2014 | Pandemic 1 | MH006961 |
PEDV/MEX/JAL/02/2014 | Pandemic 1 | MH006965 |
PEDV/MEX/JAL/19/2014 | Pandemic 1 | MH004415 |
PEDV/MEX/VER/01/2014 | INDEL | MH006960 |
PEDV/MEX/MICH/02/2015 | INDEL | MH006962 |
PEDV/MEX/PUE/01/2015 | Pandemic 1 | MH004421 |
PEDV/MEX/VER/01/2015 | Pandemic 1 | MH013463 |
PEDV/MEX/VER/02/2015 | Pandemic 1 | MH011364 |
PEDV/MEX/SON/01/2015 | Pandemic 2 | MH013462 |
PEDV/MEX/PUE/01/2016 | Pandemic 1 | MH006963 |
PEDV/MEX/GTO/01/2016 | Pandemic 1 | MH004412 |
PEDV/MEX/JAL/03/2016 | Pandemic 1 | MH004413 |
PEDV/MEX/JAL/01/2017 | Pandemic 1 | MH004416 |
PEDV/MEX/JAL/02/2017 | Pandemic 1 | MH004417 |
PEDV/MEX/JAL/03/2017 | Pandemic 1 | MH004418 |
PEDV/MEX/JAL/04/2017 | Pandemic 1 | MH004419 |
PEDV/MEX/JAL/05/2017 | Pandemic 1 | MH004420 |
PEDV/MEX/JAL/19/2017 | Pandemic 1 | MH004419 |
PEDV/MEX/QRO/01/2017 | Pandemic 1 | MH013464 |
PEDV/MEX/QRO/02/2017 | Pandemic 1 | MH013466 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivera-Benítez, J.F.; Martínez-Bautista, R.; González-Martínez, R.; De la Luz-Armendáriz, J.; Herrera-Camacho, I.; Rosas-Murrieta, N.; Márquez-Valdelamar, L.; Lara, R. Phylogenetic and Molecular Analysis of the Porcine Epidemic Diarrhea Virus in Mexico during the First Reported Outbreaks (2013–2017). Viruses 2024, 16, 309. https://doi.org/10.3390/v16020309
Rivera-Benítez JF, Martínez-Bautista R, González-Martínez R, De la Luz-Armendáriz J, Herrera-Camacho I, Rosas-Murrieta N, Márquez-Valdelamar L, Lara R. Phylogenetic and Molecular Analysis of the Porcine Epidemic Diarrhea Virus in Mexico during the First Reported Outbreaks (2013–2017). Viruses. 2024; 16(2):309. https://doi.org/10.3390/v16020309
Chicago/Turabian StyleRivera-Benítez, José Francisco, Rebeca Martínez-Bautista, Raúl González-Martínez, Jazmín De la Luz-Armendáriz, Irma Herrera-Camacho, Nora Rosas-Murrieta, Laura Márquez-Valdelamar, and Rocio Lara. 2024. "Phylogenetic and Molecular Analysis of the Porcine Epidemic Diarrhea Virus in Mexico during the First Reported Outbreaks (2013–2017)" Viruses 16, no. 2: 309. https://doi.org/10.3390/v16020309