The Secondary Structure of Potato Spindle Tuber Viroid Determines Its Infectivity in Nicotiana benthamiana
Abstract
:1. Introduction
2. Materials and Methods
2.1. Secondary Structure Prediction, Construction of 12 PSTVd Forms, and In Vitro Transcription
2.2. Plant Materials and Inoculation
2.3. PAGE Gel Electrophoresis
2.4. RNA Extraction and RNA Blot
3. Results
3.1. Construction of PSTVd Forms and Secondary Structure Prediction
3.2. Secondary Structure Verification through Native PAGE Gel Electrophoresis
3.3. Secondary Structure Determines the Infectivity of PSTVd
3.4. Enhancing the RNA Inoculum Quantity Partially Compensated for the Infectivity of PSTVd Forms Exhibiting Non-Rod-Like Structures
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bhatt, P.R.; Scaiola, A.; Loughran, G.; Leibundgut, M.; Kratzel, A.; Meurs, R.; Dreos, R.; O’Connor, K.M.; McMillan, A.; Bode, J.W.; et al. Structural basis of ribosomal frameshifting during translation of the SARS-CoV-2 RNA genome. Science 2021, 372, 1306–1313. [Google Scholar] [CrossRef]
- Johnson, G.E.; Lalanne, J.B.; Peters, M.L.; Li, G.W. Functionally uncoupled transcription–translation in Bacillus subtilis. Nature 2020, 585, 124–128. [Google Scholar] [CrossRef]
- Wang, C.; Molodtsov, V.; Firlar, E.; Kaelber, J.T.; Blaha, G.; Su, M.; Ebright, R.H. Structural basis of transcription-translation coupling. Science 2020, 369, 1359–1365. [Google Scholar] [CrossRef]
- Tinoco, I.; Bustamante, C. How RNA folds. J. Mol. Biol. 1999, 293, 271–281. [Google Scholar] [CrossRef] [PubMed]
- Leontis, N.B.; Stombaugh, J.; Westhof, E. The non-Watson-Crick base pairs and their associated isostericity matrices. Nucleic Acids Res. 2002, 30, 3497–3531. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Ma, B.; Zhang, K. An algorithm for searching RNA motifs in genomic sequences. Biomol. Eng. 2007, 24, 343–350. [Google Scholar] [CrossRef] [PubMed]
- Gorochowski, T.E.; Ignatova, Z.; Bovenberg, R.A.; Roubos, J.A. Trade-offs between tRNA abundance and mRNA secondary structure support smoothing of translation elongation rate. Nucleic Acids Res. 2015, 43, 3022–3032. [Google Scholar] [CrossRef]
- Ding, Y.; Tang, Y.; Kwok, C.K.; Zhang, Y.; Bevilacqua, P.C.; Assmann, S.M. In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features. Nature 2014, 505, 696–700. [Google Scholar] [CrossRef] [PubMed]
- Wilson, T.J.; David, M.L. RNA catalysis—Is that it? RNA 2015, 21, 534–537. [Google Scholar] [CrossRef]
- He, F.; Wei, R.; Zhou, Z.; Huang, L.; Wang, Y.; Tang, J.; Zou, Y.; Shi, L.; Gu, X.; Davis, M.J.; et al. Integrative Analysis of Somatic Mutations in Non-coding Regions Altering RNA Secondary Structures in Cancer Genomes. Sci. Rep. 2019, 9, 8205. [Google Scholar] [CrossRef]
- Kun, Á.; Szilágyi, A.; Könnyű, B.; Boza, G.; Zachar, I.; Szathmáry, E. The dynamics of the RNA world: Insights and challenges. Ann. N. Y. Acad. Sci. 2015, 1341, 75–95. [Google Scholar] [CrossRef]
- Flores, R.; Hernández, C.; Alba, A.E.M.D.; Daròs, J.A.; Serio, F.D. Viroids and viroid-host interactions. Annu. Rev. Phytopathol. 2005, 43, 117–139. [Google Scholar] [CrossRef]
- Ding, B. The biology of viroid-host interactions. Annu. Rev. Phytopathol. 2009, 47, 105–131. [Google Scholar] [CrossRef]
- Navarro, B.; Flores, R.; Di Serio, F. Advances in Viroid-Host Interactions. Annu. Rev. Virol. 2021, 8, 305–325. [Google Scholar] [CrossRef]
- Wang, Y. Current view and perspectives in viroid replication. Curr. Opin. Virol. 2021, 47, 32–37. [Google Scholar] [CrossRef]
- Wu, J.; Bisaro, D.M. Biased Pol II fidelity contributes to conservation of functional domains in the Potato spindle tuber viroid genome. PLoS Pathog. 2020, 16, e1009144. [Google Scholar] [CrossRef]
- Wu, J.; Bisaro, D.M. Tobacco mosaic virus movement protein complements a Potato spindle tuber viroid RNA mutant impaired for mesophyll entry but not mutants unable to enter the phloem. PLoS Pathog. 2022, 18, e1011062. [Google Scholar] [CrossRef]
- Wu, J.; Leontis, N.B.; Zirbel, C.L.; Bisaro, D.M.; Ding, B. A three-dimensional RNA motif mediates directional trafficking of Potato spindle tuber viroid from epidermal to palisade mesophyll cells in Nicotiana benthamiana. PLoS Pathog. 2019, 15, e1008147. [Google Scholar] [CrossRef]
- Wu, J.; Zhou, C.; Li, J.; Li, C.; Tao, X.; Leontis, N.B.; Zirbel, C.L.; Bisaro, D.M.; Ding, B. Functional analysis reveals G/U pairs critical for replication and trafficking of an infectious non-coding viroid RNA. Nucleic Acids Res. 2020, 48, 3134–3155. [Google Scholar] [CrossRef]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Beaudry, D.; Perreault, J. An efficient strategy for the synthesis of circular RNA molecules. Nucleic Acids Res. 2016, 23, 3064–3066. [Google Scholar] [CrossRef] [PubMed]
- Al-Hashimi, H.M.; Walter, N.G. RNA dynamics: It is about time. Curr. Opin. Struct. Biol. 2008, 18, 321–329. [Google Scholar] [CrossRef]
- Moelling, K.; Broecker, F. Viroids and the Origin of Life. Int. J. Mol. Sci. 2021, 22, 3476. [Google Scholar] [CrossRef]
- Ding, B.; Itaya, A. Viroid: A useful model for studying the basic principles of infection and RNA biology. Molecular Plant-Microbe Interactions. Mol. Plant Microbe Interact. 2007, 20, 7–20. [Google Scholar] [CrossRef]
- Flores, R.; Minoia, S.; Carbonell, A.; Gisel, A.; Delgado, S.; López-Carrasco, A.; Navarro, B.; Di Serio, F. Viroids, the simplest RNA replicons: How they manipulate their hosts for being propagated and how their hosts react for containing the infection. Virus Res. 2015, 209, 136–145. [Google Scholar] [CrossRef]
- Góra-Sochacka, A. Viroids: Unusual small pathogenic RNAs. Acta Biochim. Pol. 2004, 51, 587–607. [Google Scholar] [CrossRef]
- Flores, R.; Serra, P.; Minoia, S.; Di Serio, F.; Navarro, B. Viroids: From genotype to phenotype just relying on RNA sequence and structural motifs. Front. Microbiol. 2012, 3, 217. [Google Scholar] [CrossRef]
- Giguere, T.; Adkar-Purushothama, C.R.; Perreault, J.P. Comprehensive secondary structure elucidation of four genera of the family Pospiviroidae. PLoS ONE 2014, 9, e98655. [Google Scholar] [CrossRef]
- Lee, B.D.; Neri, U.; Oh, C.J.; Simmonds, P.; Koonin, E.V. ViroidDB: A database of viroids and viroid-like circular RNAs. Nucleic Acids Res. 2022, 50, D432–D438. [Google Scholar] [CrossRef] [PubMed]
- Steger, G.; Riesner, D. Viroid research and its significance for RNA technology and basic biochemistry. Nucleic Acids Res. 2018, 46, 10563–10576. [Google Scholar] [CrossRef] [PubMed]
- Flores, R.; Gas, M.-E.; Molina-Serrano, D.; Nohales, M.-Á.; Carbonell, A.; Gago, S.; De la Peña, M.; Daròs, J.-A. Viroid replication: Rolling-circles, enzymes and ribozymes. Viruses 2009, 1, 317–334. [Google Scholar] [CrossRef] [PubMed]
- LeCuyer, K.A.; Crothers, D.M. The Leptomonas collosoma spliced leader RNA can switch between two alternate structural forms. Biochemistry 1993, 32, 5301–5311. [Google Scholar] [CrossRef] [PubMed]
- Gultyaev, A.P.; Van Batenburg, F.H.D.; Pleij, C.W. Dynamic competition between alternative structures in viroid RNAs simulated by an RNA folding algorithm. J. Mol. Biol. 1998, 276, 43–55. [Google Scholar] [CrossRef] [PubMed]
- Tabler, M.; Sänger, H.L. Infectivity studies on different potato spindle tuber viroid (PSTV) RNAs synthesized in vitro with the SP6 transcription system. EMBO J. 1985, 4, 2191–2199. [Google Scholar] [CrossRef] [PubMed]
- Rigden, J.E.; Rezaian, M.A. In vitro synthesis of an infectious viroid: Analysis of the infectivity of monomeric linear CEV. Virology 1992, 186, 201–206. [Google Scholar] [CrossRef]
- Rakowski, A.G.; Symons, R.H. Infectivity of linear monomeric transcripts of citrus exocortis viroid: Terminal sequence requirements for processing. Virology 1994, 203, 328–335. [Google Scholar] [CrossRef]
- Hataya, T.; Takashi, N. Precisely Monomeric Linear RNAs of Viroids Belonging to Pospiviroid and Hostuviroid Genera Are Infectious Regardless of Transcription Initiation Site and 5′-Terminal Structure. Cells 2021, 10, 2971. [Google Scholar] [CrossRef]
Forms | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
PSTVd-2 | TAATACGACTCACTATAGGAACTAAACTCGTGGTTCC | GAGGAACCAACTGCGGTTCC |
PSTVd-16 | TAATACGACTCACTATAGGTTCCTGTGGTTCACACC | ACGAGTTTAGTTCCGAGGAAC |
PSTVd-17 | TAATACGACTCACTATAGTTCCTGTGGTTCACACC | CACGAGTTTAGTTCCGAGGAAC |
PSTVd-36 | TAATACGACTCACTATAGACCTCCTGAGCAGAAAAG | AGGTGTGAACCACAGGAACC |
PSTVd-86 | TAATACGACTCACTATAGGGATCCCCGGGGAAACC | TGAAGCGCTCCTCCGAGCC |
PSTVd-132 | TAATACGACTCACTATAGGGAGTGCCCAGCGGCCGAC | CACCGTCCTTTTTTGCCAGTTC |
PSTVd-174 | TAATACGACTCACTATAGGGTTTTCACCCTTCCTTTCTTC | TGTTTCGGCGGGAATTACTCC |
PSTVd-197 | TAATACGACTCACTATAGGGTGTCCTTCCTCGCGC | GAAGAAAGGAAGGGTGAAAACCC |
PSTVd-250 | TAATACGACTCACTATAGCTTCGGCTACTACCCGGTG | CGACAGCGCAAAGGGGGC |
PSTVd-265 | TAATACGACTCACTATAGGTGGAAACAACTGAAGCTCC | GGGTAGTAGCCGAAGCGACA |
PSTVd-319 | TAATACGACTCACTATAGGGGCGAGGGTGTTTAGC | GAAGCAAGTAAGATAGAGAAAAAGC |
PSTVd-326 | TAATACGACTCACTATAGGGTGTTTAGCCCTTGGAACCG | TCGCCCCGAAGCAAGTAAGATAG |
Forms | 300 ng per Plant | 3000 ng per Plant |
---|---|---|
PSTVd-2 | 6/6 | NA |
PSTVd-16 | 6/6 | NA |
PSTVd-17 | 0/6 | 2/6 |
PSTVd-36 | 6/6 | NA |
PSTVd-86 | 6/6 | NA |
PSTVd-132 | 6/6 | NA |
PSTVd-174 | 6/6 | NA |
PSTVd-197 | 6/6 | NA |
PSTVd-250 | 2/6 | 4/6 |
PSTVd-265 | 0/6 | 2/6 |
PSTVd-319 | 6/6 | NA |
PSTVd-326 | 6/6 | NA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nie, Y.; Zhang, Y.; Wu, J. The Secondary Structure of Potato Spindle Tuber Viroid Determines Its Infectivity in Nicotiana benthamiana. Viruses 2023, 15, 2307. https://doi.org/10.3390/v15122307
Nie Y, Zhang Y, Wu J. The Secondary Structure of Potato Spindle Tuber Viroid Determines Its Infectivity in Nicotiana benthamiana. Viruses. 2023; 15(12):2307. https://doi.org/10.3390/v15122307
Chicago/Turabian StyleNie, Yuxin, Yuhong Zhang, and Jian Wu. 2023. "The Secondary Structure of Potato Spindle Tuber Viroid Determines Its Infectivity in Nicotiana benthamiana" Viruses 15, no. 12: 2307. https://doi.org/10.3390/v15122307