Synergistic Pathogenicity by Coinfection and Sequential Infection with NADC30-like PRRSV and PCV2 in Post-Weaned Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Animal Inoculation and Samples Collection
2.3. Clinical Symptom Analysis
2.4. Antibody Responses Induced by PRRSV or PCV2
2.5. Viremia Detection and Viral Detection in Tissues of PRRSV and PCV2
2.6. Cytokine Detection in Serum
2.7. Necropsy and Histopathology
2.8. Statistical Analysis
3. Results
3.1. Clinical Evaluation of Pigs
3.2. PRRSV and PCV2 Antibody Response of the Infected Groups
3.3. Viremia Detection and Viral Detection in Tissues of PRRSV and PCV2
3.4. Cytokine Concentrations in Serum
3.5. Anatomy and Histopathology
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Ethical Statement
References
- Dee, S.A.; Bauermann, F.V.; Niederwerder, M.C.; Singrey, A.; Clement, T.; de Lima, M.; Long, C.; Patterson, G.; Sheahan, M.A.; Stoian, A.M.M.; et al. Survival of viral pathogens in animal feed ingredients under transboundary shipping models. PLoS ONE 2018, 13, e0194509. [Google Scholar] [CrossRef] [Green Version]
- Benfield, D.A.; Nelson, E.; Collins, J.E.; Harris, L.; Goyal, S.M.; Robison, D.; Christianson, W.T.; Morrison, R.B.; Gorcyca, D.; Chladek, D. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). J. Vet. Diagn. Investig. 1992, 4, 127–133. [Google Scholar] [CrossRef] [PubMed]
- Wensvoort, G.; Terpstra, C.; Pol, J.M.; ter Laak, E.A.; Bloemraad, M.; de Kluyver, E.P.; Kragten, C.; van Buiten, L.; den Besten, A.; Wagenaar, F.; et al. Mystery swine disease in The Netherlands: The isolation of Lelystad virus. Vet. Q. 1991, 13, 121–130. [Google Scholar] [CrossRef]
- Shi, M.; Lam, T.T.; Hon, C.C.; Murtaugh, M.P.; Davies, P.R.; Hui, R.K.; Li, J.; Wong, L.T.; Yip, C.W.; Jiang, J.W.; et al. Phylogeny-based evolutionary, demographical, and geographical dissection of North American type 2 porcine reproductive and respiratory syndrome viruses. J. Virol. 2010, 84, 8700–8711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darwich, L.; Gimeno, M.; Sibila, M.; Diaz, I.; de la Torre, E.; Dotti, S.; Kuzemtseva, L.; Martin, M.; Pujols, J.; Mateu, E. Genetic and immunobiological diversities of porcine reproductive and respiratory syndrome genotype I strains. Vet. Microbiol. 2011, 150, 49–62. [Google Scholar] [CrossRef] [PubMed]
- Fan, P.; Wei, Y.; Guo, L.; Wu, H.; Huang, L.; Liu, J.; Liu, C. Synergistic effects of sequential infection with highly pathogenic porcine reproductive and respiratory syndrome virus and porcine circovirus type 2. Virol. J. 2013, 10, 265. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Wang, X.; Bo, K.; Wang, X.; Tang, B.; Yang, B.; Jiang, W.; Jiang, P. Emergence of a highly pathogenic porcine reproductive and respiratory syndrome virus in the Mid-Eastern region of China. Vet. J. 2007, 174, 577–584. [Google Scholar] [CrossRef]
- Li, C.; Zhuang, J.; Wang, J.; Han, L.; Sun, Z.; Xiao, Y.; Ji, G.; Li, Y.; Tan, F.; Li, X.; et al. Outbreak Investigation of NADC30-Like PRRSV in South-East China. Transbound. Emerg. Dis. 2016, 63, 474–479. [Google Scholar] [CrossRef]
- Zhang, Q.; Jiang, P.; Song, Z.; Lv, L.; Li, L.; Bai, J. Pathogenicity and antigenicity of a novel NADC30-like strain of porcine reproductive and respiratory syndrome virus emerged in China. Vet. Microbiol. 2016, 197, 93–101. [Google Scholar] [CrossRef]
- Zhao, K.; Ye, C.; Chang, X.B.; Jiang, C.G.; Wang, S.J.; Cai, X.H.; Tong, G.Z.; Tian, Z.J.; Shi, M.; An, T.Q. Importation and Recombination Are Responsible for the Latest Emergence of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus in China. J. Virol. 2015, 89, 10712–10716. [Google Scholar] [CrossRef] [Green Version]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Wang, J.; Bai, X.; Ji, G.; Yan, H.; Li, Y.; Wang, Y.; Tan, F.; Xiao, Y.; Li, X.; et al. Pathogenicity comparison between highly pathogenic and NADC30-like porcine reproductive and respiratory syndrome virus. Arch. Virol. 2016, 161, 2257–2261. [Google Scholar] [CrossRef] [PubMed]
- Denner, J.; Mankertz, A. Porcine Circoviruses and Xenotransplantation. Viruses 2017, 9, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Opriessnig, T.; Karuppannan, A.K.; Castro, A.; Xiao, C.T. Porcine circoviruses: Current status, knowledge gaps and challenges. Virus Res. 2020, 286, 198044. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Du, Q.; Han, Z.; Bi, J.; Lan, T.; Wang, W.; Zheng, M. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 2021, 773, 145384. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.H.; Hu, W.Q.; Li, J.Y.; Liu, T.N.; Zhou, J.Y.; Opriessnig, T.; Xiao, C.T. Novel circovirus species identified in farmed pigs designated as Porcine circovirus 4, Hunan province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef]
- Morozov, I.; Sirinarumitr, T.; Sorden, S.D.; Halbur, P.G.; Morgan, M.K.; Yoon, K.J.; Paul, P.S. Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome. J. Clin. Microbiol. 1998, 36, 2535–2541. [Google Scholar] [CrossRef] [Green Version]
- Segales, J. Porcine circovirus type 2 (PCV2) infections: Clinical signs, pathology and laboratory diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef]
- Zheng, G.; Lu, Q.; Wang, F.; Xing, G.; Feng, H.; Jin, Q.; Guo, Z.; Teng, M.; Hao, H.; Li, D.; et al. Phylogenetic analysis of porcine circovirus type 2 (PCV2) between 2015 and 2018 in Henan Province, China. BMC Vet. Res. 2020, 16, 6. [Google Scholar] [CrossRef]
- Niederwerder, M.C.; Jaing, C.J.; Thissen, J.B.; Cino-Ozuna, A.G.; McLoughlin, K.S.; Rowland, R.R. Microbiome associations in pigs with the best and worst clinical outcomes following co-infection with porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus type 2 (PCV2). Vet. Microbiol. 2016, 188, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Drolet, R.; Larochelle, R.; Morin, M.; Delisle, B.; Magar, R. Detection rates of porcine reproductive and respiratory syndrome virus, porcine circovirus type 2, and swine influenza virus in porcine proliferative and necrotizing pneumonia. Vet. Pathol. 2003, 40, 143–148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-Infection of Swine with Porcine Circovirus Type 2 and Other Swine Viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef] [Green Version]
- Harms, P.A.; Sorden, S.D.; Halbur, P.G.; Bolin, S.R.; Lager, K.M.; Morozov, I.; Paul, P.S. Experimental reproduction of severe disease in CD/CD pigs concurrently infected with type 2 porcine circovirus and porcine reproductive and respiratory syndrome virus. Vet. Pathol. 2001, 38, 528–539. [Google Scholar] [CrossRef] [PubMed]
- Tian, K. NADC30-Like Porcine Reproductive and Respiratory Syndrome in China. Open Virol. J. 2017, 11, 59–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, X.J. Porcine circovirus type 2 (PCV2): Pathogenesis and interaction with the immune system. Annu. Rev. Anim. Biosci. 2013, 1, 43–64. [Google Scholar] [CrossRef]
- Chen, N.; Li, S.; Ye, M.; Huang, Y.; Huang, Y.; Xiao, Y.; Yu, X.; Dong, J.; Tian, K.; Zhu, J. A novel NADC30-like porcine reproductive and respiratory syndrome virus (PRRSV) plays a limited role in the pathogenicity of porcine circoviruses (PCV2 and PCV3) and PRRSV co-infection. Transbound. Emerg. Dis. 2019, 66, 28–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eclercy, J.; Larcher, T.; Andraud, M.; Renson, P.; Bernard, C.; Bigault, L.; Ledevin, M.; Paboeuf, F.; Grasland, B.; Rose, N.; et al. PCV2 co-infection does not impact PRRSV MLV1 safety but enhances virulence of a PRRSV MLV1-like strain in infected SPF pigs. Vet. Microbiol. 2020, 244, 108656. [Google Scholar] [CrossRef] [PubMed]
- Sinha, A.; Shen, H.G.; Schalk, S.; Beach, N.M.; Huang, Y.W.; Meng, X.J.; Halbur, P.G.; Opriessnig, T. Porcine reproductive and respiratory syndrome virus (PRRSV) influences infection dynamics of porcine circovirus type 2 (PCV2) subtypes PCV2a and PCV2b by prolonging PCV2 viremia and shedding. Vet. Microbiol. 2011, 152, 235–246. [Google Scholar] [CrossRef]
- Shi, K.C.; Guo, X.; Ge, X.N.; Liu, Q.; Yang, H.C. Cytokine mRNA expression profiles in peripheral blood mononuclear cells from piglets experimentally co-infected with porcine reproductive and respiratory syndrome virus and porcine circovirus type 2. Vet. Microbiol. 2010, 140, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Charerntantanakul, W.; Kasinrerk, W. Interleukin-10 antisense oligodeoxynucleotide suppresses IL-10 expression and effects on proinflammatory cytokine responses to porcine reproductive and respiratory syndrome virus. Viral Immunol. 2010, 23, 425–435. [Google Scholar] [CrossRef]
- Meerts, P.; Misinzo, G.; Nauwynck, H.J. Enhancement of porcine circovirus 2 replication in porcine cell lines by IFN-gamma before and after treatment and by IFN-alpha after treatment. J. Interferon Cytokine Res. 2005, 25, 684–693. [Google Scholar] [CrossRef] [PubMed]
- Vandenbroeck, K.; Nauwynck, H.; Vanderpooten, A.; Van Reeth, K.; Goddeeris, B.; Billiau, A. Recombinant porcine IFN-gamma potentiates the secondary IgG and IgA responses to an inactivated suid herpesvirus-1 vaccine and reduces postchallenge weight loss and fever in pigs. J. Interferon Cytokine Res. 1998, 18, 739–744. [Google Scholar] [CrossRef] [PubMed]
Name of Primers | Primers (5′→3′) | Size of Products (bp) |
---|---|---|
PRRSV-qPCR-F | GAAGAAGAATAAGAATAGAAACCCG | 195 |
PRRSV-qPCR-R | GGCAAACTAAACTCCACAGTGTAAC | |
PCV2-qPCR-F | AAAAGCAAATGGGCTGCTAA | 83 |
PCV2-qPCR-R | TGGTAACCACCCACCACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Wang, P.; Xie, C.; Ha, Z.; Shi, N.; Zhang, H.; Li, Z.; Han, J.; Xie, Y.; Qiu, X.; et al. Synergistic Pathogenicity by Coinfection and Sequential Infection with NADC30-like PRRSV and PCV2 in Post-Weaned Pigs. Viruses 2022, 14, 193. https://doi.org/10.3390/v14020193
Zhang J, Wang P, Xie C, Ha Z, Shi N, Zhang H, Li Z, Han J, Xie Y, Qiu X, et al. Synergistic Pathogenicity by Coinfection and Sequential Infection with NADC30-like PRRSV and PCV2 in Post-Weaned Pigs. Viruses. 2022; 14(2):193. https://doi.org/10.3390/v14020193
Chicago/Turabian StyleZhang, Jinyong, Peng Wang, Changzhan Xie, Zhuo Ha, Ning Shi, He Zhang, Zhuoxin Li, Jicheng Han, Yubiao Xie, Xiangshu Qiu, and et al. 2022. "Synergistic Pathogenicity by Coinfection and Sequential Infection with NADC30-like PRRSV and PCV2 in Post-Weaned Pigs" Viruses 14, no. 2: 193. https://doi.org/10.3390/v14020193