Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716

Mase, Masaji; Hiramatsu, Kanae; Watanabe, Satoko; Iseki, Hiroshi

doi:10.3390/v14102098

Open AccessCorrection

Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716

by

Masaji Mase

^1,2,3,*

,

Kanae Hiramatsu

⁴,

Satoko Watanabe

¹ and

Hiroshi Iseki

¹

National Institute of Animal Health, National Agriculture and Food Research Organization, 3-1-5 Kannondai, Tsukuba 305-0856, Japan

²

United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan

³

Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Izumisano 598-8531, Japan

⁴

Oita Livestock Hygiene Service Center of Oita Prefecture, 442 Onozuru, Oita 870-1153, Japan

^*

Author to whom correspondence should be addressed.

Viruses 2022, 14(10), 2098; https://doi.org/10.3390/v14102098

Submission received: 14 September 2022 / Accepted: 20 September 2022 / Published: 22 September 2022

(This article belongs to the Special Issue State-of-the-Art Avian Viruses Research in Asia)

Download Versions Notes

Error in Table

In the original publication [1], there was a mistake in “Table 2. List of RT-PCR primers” as published. The primers in Table 2 are not for infectious bronchitis virus, and the sequence of avian reovirus amplification is mistakenly listed. The corrected Table 2 appears below. The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.

Reference

Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. [Google Scholar] [CrossRef]

Table 2. List of RT-PCR primers.

Name		Sequence (5’-3’)	Position ^a	Length (bp)	Reference
Forward	Reverse
15F		AGGAATGGTAAGTTRCTRGTWAGAG	20343–20367	671	Mase et al., 2004 [11]
	26Rm	GCGCAGTACCRTTRAYAAAATAAGC	21013–20989		Mase et al., 2004 [11]
19F		GCAGTGTTTGTTACGCATTG	20689–20708	1333	in this study
	1R	CATAACTAACATAAGGGCAA	22021–22002		in this study

^a Position is given for the S1 gene of strain Beadette42 (Acc.No.NC001451).

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Mase, M.; Hiramatsu, K.; Watanabe, S.; Iseki, H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses 2022, 14, 2098. https://doi.org/10.3390/v14102098

AMA Style

Mase M, Hiramatsu K, Watanabe S, Iseki H. Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716. Viruses. 2022; 14(10):2098. https://doi.org/10.3390/v14102098

Chicago/Turabian Style

Mase, Masaji, Kanae Hiramatsu, Satoko Watanabe, and Hiroshi Iseki. 2022. "Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716" Viruses 14, no. 10: 2098. https://doi.org/10.3390/v14102098

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Correction: Mase et al. Genetic Analysis of the Complete S1 Gene in Japanese Infectious Bronchitis Virus Strains. Viruses 2022, 14, 716

Error in Table

Reference

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI